Tetracycline-susceptible Isolates Research Articles

Genotypic characterization, antimicrobial susceptibility and virulence determinants of Campylobacter jejuni and Campylobacter coli isolated from pastured poultry farms.

Campylobacter is the leading bacterial pathogen that causes foodborne illnesses worldwide. Pasture farming is regarded as an important source of agricultural production for small farming communities. Consumer preference for pasture-raised animal products has increased; however, there is a paucity of information on the microbiological quality of pasture-raised poultry products. The purpose of this study was to explore genetic relatedness of thermophilic Campylobacter isolates, to assess antibiotic resistance phenotypically and genotypically, and to screen the presence of virulence determinants of Campylobacter isolates from pasture-raised poultry farms from southeastern United States. Ninety-seven Campylobacter isolates previously identified by Q7 BAX® System Real-Time PCR were genotyped by multilocus sequence typing (MLST). Campylobacter isolates were then evaluated for their phenotypic antimicrobial susceptibility against nine antimicrobial agents using Sensititre plates. Additionally, Campylobacter isolates were tested for the presence of antimicrobial resistance-associated elements. Furthermore, Campylobacter isolates were screened for the presence of 13 genes encoding putative virulence factors by PCR. These included genes involved in motility (flaA and flhA), adhesion and colonization (cadF, docC, racR, and virB11), toxin production (cdtA, cdtB, cdtC, wlaN, and ceuE) and invasion (ciaB and iamA). Among 97 Campylobacter isolates, Campylobacter jejuni (n = 79) and Campylobacter coli (n = 18) were identified. By MLST, C. jejuni isolates were assigned to seven clonal complexes. Among them, ST-353, ST-607 and ST-21 were the most common STs recognized. All C. coli (n = 18) isolates were included in CC-828. Interestingly, eight STs identified were not belonging any previous identified clonal complex. Campylobacter isolates displayed a high resistance rate against tetracycline (81.4%), while a low rate of resistance was observed against macrolides (azithromycin and erythromycin), quinolones and fluoroquinolones (nalidixic acid and ciprofloxacin), aminoglycosides (gentamicin), ketolide (telithromycin), amphenicol (florfenicol) and lincomycin (clindamycin). Thirteen isolates (13.54%) were pan-susceptible to all tested antibiotics, while nine isolates were multi-antimicrobial resistant (MAR; resist to three or more antimicrobial classes). Interestingly, there were no isolates resistant to all antimicrobial classes. Thr86Ile mutation was identified in all quinolones resistant strains. Erythromycin encoding gene (ermB) was identified in 75% of erythromycin resistant isolates. The A2075 mutation was detected in one erythromycin resistant strain, while A2074 could not be identified. The tetO gene was identified in 93.7% of tetracycline resistant isolates and six tetracycline susceptible isolates. In conclusion, the results of this study revealed that Campylobacter isolates from pasture-raised poultry farms showed the ST relatedness to Campylobacter isolates commonly associated with humans, indicating pasture-raised broiler flocks, similar to conventionally-reared broiler flocks, as a potential vector for antibiotic-resistant and pathogenic strains of thermophilic Campylobacter to humans.

Antimicrobial Resistance of Seventy Lactic Acid Bacteria Isolated from Commercial Probiotics in Korea.

In this study, lactic acid bacteria were isolated from 21 top-selling probiotic products on Korean market and their antimicrobial resistance were analyzed. A total 152 strains were claimed to be contained in these products and 70 isolates belonging to three genera (Bifidobacterium, Lactobacillus, and Lactococcus) were obtained from these products. RAPD-PCR showed diversity among isolates of the same species except for two isolates of Lacticaibacillus rhamnosus from two different products. The agar dilution method and the broth dilution method produced different MICs for several antimicrobials. With the agar dilution method, five isolates (three isolates of Bifidobacterium animalis subsp. lactis, one isolate of B. breve, one isolate of B. longum) were susceptible to all nine antimicrobials and 15 isolates were multi-drug resistant. With the broth microdilution method, only two isolates (one isolate of B. breve and one isolate of B. longum) were susceptible while 16 isolates were multi-drug resistant. In this study, only two AMR genes were detected: 1) lnu(A) in one isolate of clindamycin-susceptible and lincomycin-resistant Limosilactobacillus reuteri; and 2) tet(W) in one tetracycline-susceptible isolate of B. longum B1-1 and two tetracycline-susceptible isolates and three tetracycline resistant isolates of B. animalis subsp. lactis. Transfer of these two genes via conjugation with a filter mating technique was not observed. These results suggest a need to monitor antimicrobial resistance in newly registered probiotics as well as probiotics with a long history of use.

Genetic and phenotypic characterization of tetracycline-resistant Pasteurella multocida isolated from pigs

Pasteurella multocida causes single or complex respiratory disease in pigs. Although antimicrobial therapy is the most effective treatment for porcine respiratory disease, P. multocida shows increased antimicrobial resistance in Korea. Therefore, we aimed to investigate the phenotypic and genotypic characterization of tetracycline-resistant P. multocida. Thirty-seven of 454 P. multocida isolates from South Korea between 2010 and 2016 were selected. Four tet genes [tet(B) (78.4%), tet(H) (16.2%), tet(C) (5.4%), and tet(O) (2.7%)] were observed. This is the first report of tet(C) in P. multocida. Various virulence factors were observed in both tetracycline-resistant and -susceptible P. multocida isolates. Genes encoding pmHAS and pfhA were more prevalent in tetracycline-resistant than in tetracycline-susceptible isolates. Some virulence factors exhibited association with serogroups. tadD and sodA were common in serogroup A, while hsf-l was significantly associated with serogroup D (p < 0.01). Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) results showed the genetic diversity of tetracycline-resistant P. multocida. MLST showed six different sequence types (ST), with clonal complex 13 encompassing 56.8% of the strains. PFGE was more efficient in differentiating the isolates, and 29 PFGE patterns of the strains were observed. By combining these methods, identical STs and PFGE patterns were observed in isolates from different farms, suggesting that transmission of antimicrobial-resistant P. multocida strains between farms might occur in a geographically discrete population. In future, epidemiological approaches and development of effective vaccines should focus on the major clonal lineages carrying the important virulence factors and frequently observed resistance genes to prevent the transmission and control the disease.

The moderate drift towards less tetracycline-susceptible isolates of contagious agalactia causative agents might result from different molecular mechanisms

Contagious agalactia is a mycoplasmosis that affects small ruminants, is associated with loss of milk production and high morbidity rates, and is highly deleterious to dairy industries. The etiological agents are four mycoplasma (sub)species, of which the relative importance depends on the countries and the animal host. Tetracyclines are non-expensive, broad-spectrum antimicrobials and are often used to control mastitis in dairy herds. However, the in vitro efficiency of tetracyclines against each of the etiological agents of contagious agalactia has been poorly assessed.The aims of this study were i) to compare the tetracycline susceptibilities of various field isolates, belonging to different mycoplasma (sub)species and subtypes, collected over the years from different clinical contexts in France or Spain, and ii) to investigate the molecular mechanisms behind the decreased susceptibility of some isolates to tetracyclines.The Minimum Inhibitory Concentrations (MICs) of tetracyclines were determined in vitro on a set of 120 isolates. Statistical analyses were run to define the significance of any observed differences in MICs distribution. As mutations in the genes encoding the tetracycline targets (rrs loci) are most often associated with increased tetracycline MICs in animal mycoplasmas, these genes were sequenced.The loss of susceptibility to tetracyclines after year 2010 is not significant and recent MICs are higher in M. agalactiae, especially isolates from mastitis cases, than in other etiological agents of contagious agalactia. The observed increases in MICs were not always associated with mutations in the rrs alleles which suggests the existence of other resistance mechanisms yet to be deciphered.

Genomic Characteristics of Bifidobacterium thermacidophilum Pig Isolates and Wild Boar Isolates Reveal the Unique Presence of a Putative Mobile Genetic Element with tetW for Pig Farm Isolates.

Genomic analysis was performed on seven strains of Bifidobacterium thermacidophilum, a Sus-associated Bifidobacterium. Three strains from the feces of domestic pigs (Sus scrofa domesticus) and four strains from the rectal feces of free-range Japanese wild boars (S. s. scrofa) were compared. The phylogenetic position of these isolates suggested by genomic analyses were not concordant with that suggested by 16S rRNA sequence. There was biased distribution of genes for virulence, phage, metabolism of aromatic compounds, iron acquisition, cell division, and DNA metabolism. In particular four wild boar isolates harbored fiber-degrading enzymes, such as endoglucanase, while two of the pig isolates obtained from those grown under an intensive feeding practice with routine use of antimicrobials, particularly tetracycline harbored a tetracycline resistance gene, which was further proved functional by disk diffusion test. The tetW gene is associated with a serine recombinase of an apparently non-bifidobacterial origin. The insertion site of the tetW cassette was precisely defined by analyzing the corresponding genomic regions in the other tetracycline-susceptible isolates. The cassette may have been transferred from some other bacteria in the pig gut.

Molecular Mechanisms of Tetracycline and Macrolide Resistance andemmCharacterization ofStreptococcus pyogenesIsolates in Tunisia

Streptococcus pyogenes or group A Streptococcus, a major human pathogen, remains susceptible to beta-lactams, but resistance to other antibiotics is becoming more common. The purpose of this study was to characterize both phenotypic and genotypic epidemiological markers of group A Streptococcus and to identify the mechanisms of resistance to macrolides and tetracyclines. A total of 103 strains, isolated at Charles Nicolle University Hospital of Tunis, were investigated. The rate of resistance to erythromycin was low (5%), whereas a high rate of tetracycline resistance was found (70%). All the macrolide-resistant isolates expressed the constitutive macrolide, lincosamide, and streptograminB phenotype and harbored the erm(B) gene. Resistance to tetracycline was mainly due to the tet(M) gene, which is commonly associated with the conjugative transposon Tn916. No significant association was found between erm(B) and tet(M) genes. The tetracycline-resistant strains belonged to 28 distinct emm types. Among them, emm118 was the most prevalent type, followed by emm42, std432, emm76, and emm18. However, emm1, emm4, emm6, emm28, and emm3 were the most frequent types among tetracycline susceptible isolates. Only emm118 and emm42 types (p ≤ 0.05) were significantly associated with resistance to tetracycline.

SmaI Typeability and Tetracycline Susceptibility and Resistance in Streptococcus pyogenes Isolates with Efflux-Mediated Erythromycin Resistance

In Streptococcus pyogenes, efflux-mediated macrolide resistance is encoded by the mef(A) gene and is associated with a particular resistance pattern (M phenotype) characterized by resistance, usually at a low level, only to 14- and 15-membered macrolides (10). The mef(A) gene is carried by different genetic elements, depending on whether the isolates are susceptible or resistant to tetracycline (2). In the tetracycline-susceptible isolates, mef(A) is contained in a Tn1207.1 transposon, identical to the one originally described in S. pneumoniae (9), inserted into larger genetic elements of phage origin such as Tn1207.3 (8) or Φ10394.4, a related 58.8-kb chimeric element (1). In the tetracycline-resistant isolates, mef(A) is linked to the tet(O) gene in a tet(O)-mef(A) chimeric element which, unlike the Tn1207.3-Φ10394.4 family, may contain different, defective variants of the Tn1207.1 transposon and is not integrated into the chromosome within the comEC gene (2). The most common method used to type macrolide-resistant streptococci involves restriction of genomic DNA with the SmaI endonuclease, followed by pulsed-field gel electrophoresis analysis. However, several studies have reported that some isolates with the M phenotype are nontypeable because their DNA is refractory to SmaI digestion. Since early studies, nontypeability was seen to be a characteristic of tetracycline-susceptible M-phenotype isolates (7, 11), typically carrying Tn1207.3 or Φ10394.4 (2, 6), whereas tetracycline-resistant M-phenotype isolates, typically carrying the tet(O)-mef(A) element (2), were usually restricted by SmaI (6). Subsequently, a DNA-modifying methyltransferase encoded by the Tn1207.3-Φ10394.4 family was described, which acts on the SmaI recognition sequence and renders DNA refractory to cleavage by SmaI (4). Further insights were recently gained by Euler et al. (3), who identified a type II restriction-modification (R-M) cassette on Φ10394.4—located just downstream of Tn1207.1 in the conserved region of phage origin—formed by three open reading frames (ORFs): two encoding two subunits of a restriction endonuclease and one (spyIM) encoding the methyltransferase responsible for DNA resistance to SmaI digestion. Three different strains from our collection of M-phenotype S. pyogenes strains were investigated: m46 [SmaI typeable, tetracycline resistant, carrying the tet(O)-mef(A) element] (2, 5, 6, 7), and Spy-1 and Spy-2 (both SmaI nontypeable and tetracycline susceptible, carrying Tn1207.3 and Φ10394.4, respectively) (6, 7). PCR analysis revealed the R-M cassette in strains Spy-1 and Spy-2 but not in strain m46 (nor in other tetracycline-resistant isolates containing different defective variants of the Tn1207.1 transposon [6; data not shown]). The entire region was explored by pairing primers ORF8-for (ACCGATTTGCCTCACTGCAC) and dsPOL-rev (ACCATTAGAGATGACATTCG), targeting umuC-mucB (the last ORF of Tn1207.1) and the intergenic region immediately downstream of the phage DNA polymerase gene, respectively. Whereas an amplicon of the size (10,756 bp) expected on the basis of the published sequences of Tn1207.3 (GenBank accession no. {type:entrez-nucleotide,attrs:{text:AY657002,term_id:50261575}}AY657002) and Φ10394.4 (GenBank accession no. {type:entrez-nucleotide,attrs:{text:AY445042,term_id:40218525}}AY445042) was obtained from strains Spy-1 and Spy-2, a smaller amplicon (7,380 bp) was obtained from strain m46 (Fig. ​(Fig.1).1). The 7,380-bp amplicon was sequenced (EMBL accession no. {type:entrez-nucleotide,attrs:{text:AM492531,term_id:153581897}}AM492531); sequence analysis showed that the entire R-M cassette and the adjacent ORF of Tn1207.3-Φ10394.4 were replaced by three new ORFs encoding three hypothetical proteins. Two areas of homology with Tn1207.3-Φ10394.4 were detected, upstream (93% homology, including umuC-mucB) and downstream (94% homology, including the phage DNA polymerase gene) of the three new ORFs (Fig. ​(Fig.11). FIG. 1. ORF map of a sequenced portion of the tet(O)-mef(A) element from S. pyogenes strain m46 (EMBL accession no. {type:entrez-nucleotide,attrs:{text:AM492531,term_id:153581897}}AM492531) compared with the ORF map of the corresponding sequence ... These findings contribute to conclusively clarifying why, among S. pyogenes isolates with the M phenotype, the tetracycline-resistant ones are, as a rule, SmaI typeable, while the tetracycline-susceptible ones are not. Previous studies have shown that, while the two related genetic elements (Tn1207.3 and Φ10394.4) typical of tetracycline-susceptible isolates are inserted into the same prophage, the tet(O)-mef(A) element typical of tetracycline-resistant isolates is inserted into a different prophage (6). The present results show that the R-M cassette encoding, in Tn1207.3-Φ10394.4, the methyltransferase responsible for DNA resistance to cleavage by SmaI is absent in the tet(O)-mef(A) element where, together with an adjacent ORF, it is replaced by three new ORFs flanked, both upstream and downstream, by homologous regions.

Genetic Elements Carrying erm (B) in Streptococcus pyogenes and Association with tet (M) Tetracycline Resistance Gene

This study was directed at characterizing the genetic elements carrying the methylase gene erm(B), encoding ribosome modification-mediated resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics, in Streptococcus pyogenes. In this species, erm(B) is responsible for MLS resistance in constitutively resistant isolates (cMLS phenotype) and in a subset (iMLS-A) of inducibly resistant isolates. A total of 125 erm(B)-positive strains were investigated, 81 iMLS-A (uniformly tetracycline susceptible) and 44 cMLS (29 tetracycline resistant and 15 tetracycline susceptible). Whereas all tetracycline-resistant isolates carried the tet(M) gene, tet(M) sequences were also detected in most tetracycline-susceptible isolates (81/81 iMLS-A and 7/15 cMLS). In 2 of the 8 tet(M)-negative cMLS isolates, erm(B) was carried by a plasmid-located Tn917-like transposon. erm(B)- and tet(M)-positive isolates were tested by PCR for the presence of genes int (integrase), xis (excisase), and tndX (resolvase), associated with conjugative transposons of the Tn916 family. In mating experiments using representatives of different combinations of phenotypic and genotypic characteristics as donors, erm(B) and tet(M) were consistently cotransferred, suggesting their linkage in individual genetic elements. The linkage was confirmed by pulsed-field gel electrophoresis and hybridization studies, and different elements, variably associated with the different phenotypes/genotypes, were detected and characterized by amplification and sequencing experiments. A previously unreported genetic organization, observed in all iMLS-A and some cMLS isolates, featured an erm(B)-containing DNA insertion into the tet(M) gene of a defective Tn5397, a Tn916-related transposon. This new element was designated Tn1116. Genetic elements not previously described in S. pyogenes also included Tn6002, an unpublished transposon whose complete sequence is available in GenBank, and Tn3872, a composite element resulting from the insertion of the Tn917 transposon into Tn916 [associated with a tet(M) gene expressed in some cMLS isolates and silent in others]. The high frequency of association between a tetracycline-susceptible phenotype and tet(M) genes suggests that transposons of the Tn916 family, so far typically associated solely with a tetracycline-resistant phenotype, may be more widespread in S. pyogenes than currently believed.

The mef (E)-Carrying Genetic Element (mega) of Streptococcus pneumoniae : Insertion Sites and Association with Other Genetic Elements

The structure of the macrolide efflux genetic assembly (mega) element, its genomic locations, and its association with other resistance determinants and genetic elements were investigated in 16 Streptococcus pneumoniae isolates carrying mef(E), of which 1 isolate also carried tet(M) and 4 isolates also carried tet(M) and erm(B). All isolates carried a mega element of similar size and structure that included the operon mef(E)-msr(D) encoding the efflux transport system. Among tetracycline-susceptible isolates, six different integration sites were identified, five of which were recognized inside open reading frames present in the R6 genome. In the five isolates also carrying tet(M), mega was inserted in different genetic contexts. In one isolate, it was part of previously described Tn916-like element Tn2009. In another isolate, mega was inserted in a transposon similar to Tn2009 that also included an erm(B) element. This new composite transposon was designated Tn2010. Neither Tn2009 nor Tn2010 could be transferred by conjugation to pneumococcal or enterococcal recipients. In the three isolates in which mega was not physically linked with tet(M), this gene was associated with erm(B) in transposon Tn3872, a Tn916-like element. Homologies between the chromosomal insertions of these composite transposons and sequences of multidrug-resistant pneumococcal genomes in the databases indicate the presence of preferential sites for the integration of composite Tn916-like elements carrying multiple resistance determinants in S. pneumoniae.

Prophage association of mef(A) elements encoding efflux-mediated erythromycin resistance in Streptococcus pyogenes

To compare different mef(A) elements of Streptococcus pyogenes for a possible chimeric genetic nature, i.e. a transposon inserted into a prophage. Eleven S. pyogenes isolates with efflux-mediated erythromycin resistance were used. The isolates were typed using several genotypic approaches. Gene detection was performed by PCR using specific primer pairs. The mef(A) elements of the test strains were induced with mitomycin C and phage DNA was extracted. Induction was monitored by PCR using primers targeting mef(A). Six tetracycline-susceptible isolates had PCR evidence of all of the eight open reading frames (ORFs) of the Tn1207.1 element; their mef(A) element was consistent with the Tn1207.3 element in four isolates and with the 58.8 kb chimeric element in two. Five tetracycline-resistant isolates had no PCR evidence of orf1 and orf2 and showed variable patterns as to orf3, orf7, and orf8. Three ORFs placed along the conserved region downstream of Tn1207.1 in the 58.8 kb mef(A) chimeric element were detected in the six tetracycline-susceptible, but not in the five tetracycline-resistant isolates. Induction assays with mitomycin C demonstrated that the mef(A) elements of all strains tested were present in culture supernatants in a DNAse-resistant form, such as a phage capsid. All recognized mef(A) elements of S. pyogenes appear to be prophage-associated. Whereas the two elements detected in tetracycline-susceptible isolates (Tn1207.3 and the 58.8 kb one) were apparently inserted into the same prophage, the tet(O)-mef(A) element was inserted into a different prophage. Phage transfer is likely to play a critical role in the dissemination of erythromycin resistance in S. pyogenes populations.

Presence of Tetracycline Resistance Determinants and Susceptibility to Tigecycline and Minocycline

No relation between the presence of tetracycline resistance determinants tet(A) to tet(E) and the MICs of tigecycline was observed for Enterobacteriaceae, although tetracycline-susceptible isolates were more susceptible overall to tigecycline, whereas the presence of tet(M) in Staphylococcus aureus was associated with higher MICs of minocycline.

Distribution and molecular analysis of mef(A)-containing elements in tetracycline-susceptible and -resistant Streptococcus pyogenes clinical isolates with efflux-mediated erythromycin resistance

To analyse the distribution and molecular features of mef(A)-containing elements in a large collection of different Streptococcus pyogenes clinical isolates with efflux-mediated erythromycin resistance. To further characterize a tet(O)-mef(A) element. Gene detection was carried out by PCR using primers designed from established sequences or from sequences in this study. From a tet(O)-mef(A) element (approximately 60 kb), an 11 972 bp region including the tet(O) and mef(A) genes was sequenced. In the tetracycline-susceptible isolates (n =28), the mef(A) gene was contained in a regular Tn1207.1 transposon (7.2 kb), which was inserted into one of two previously described elements, Tn1207.3 (approximately 52 kb) or a 58.8 kb chimeric element, both flanked by the comEC gene. In the tetracycline-resistant isolates (n =61), all of which carried the tet(O) gene, the mef(A) gene was part of a variable Tn1207.1-related transposon inserted into unique elements which contained the tet(O) gene approximately 2.3 to 5.5 kb upstream of the mef(A) gene and were not flanked by the comEC gene. In the Tn1207.1-like transposon of these tet(O)-mef(A) elements, only msr(D) (orf5) and a modified orf6, in addition to mef(A), were detected by PCR in all isolates tested; while orf1 and orf2 were always undetectable, orf3, orf7 and orf8 were found in variable percentages. In an orf3-positive element, sequencing identified four new open reading frames downstream of the tet(O) gene, followed by three short sequences with homology to sequences of the pneumococcal mega element. The mef(A) gene is carried on different chromosomal genetic elements depending on whether the isolates are susceptible or resistant to tetracycline.

Detection of the tetM determinant in Neisseria gonorrhoeae using a non-radioactively labelled oligonucleotide probe

Three oligonucleotide probes, complementary to tetM sequences, were labelled non-radiometrically using the DIG-oligonucleotide tailing kit and evaluated for their specificity for the detection of plasmid mediated tetracycline resistance in Neisseria gonorrhoeae. Only Probe 3, 5′-GCT CAA CAA TTC TGT TCC AGC-3′, was specific for tetM. It hybridized with the tetM-containing 25·2-MDa plasmids from all of the 232 TRNG and the 130 PP/TRNG isolates used in the study. Its sensitivity, determined by dot-blot hybridization, was 0·1 pg of pJ13 plasmid DNA 10 4 cells. It did not hypbridize with the DNA from non-PPNG, CMRNG and tetracycline susceptible isolates from seven other Neisseria species ( N. meningitidis, N. subflava, N. cinerea, N. lactamica, N. sicca, N. mucosa, and N. flavescens), Moraxella spp. and Haemophilus influenzae. Probe 3 also hybridized to DNA of three tetracycline resistant P. magnus (OMIC = 16 μg ml -1) isolates which presumptively carried the tetM determinant. Therefore, probe 3 can be used by reference laboratories as a confirmatory test for TRNG, as well isolates from the other genera containing the tetM determinant.