Terminator Chemistry Research Articles

A three‐dimensional positivity‐preserving and conservative multimoment finite‐volume transport model on a cubed‐sphere grid

AbstractA three‐dimensional positivity‐preserving and conservative transport model on a cubed‐sphere grid is presented using a multimoment finite‐volume (MMFV) method. The three‐point fourth‐order MMFV method with boundary gradient switching projection is utilized to ensure nonoscillatory numerical solutions in the horizontal, while the simple and computationally efficient semi‐Lagrangian piecewise rational method is used to allow a large time step in the vertical. By means of horizontal and vertical separation, a Strang‐type splitting technique is adopted to advance the numerical solutions in time. Non‐negative corrections are made to achieve positive‐definite preservation exactly. The resulting transport model is inherently conservative, high‐accuracy, and positive‐definite, and allows a large Courant number no matter how dense the vertical grid is. Various benchmark test cases, including three representative advection tests and an idealized terminator chemistry test, are conducted to validate the performance of the model presented. The numerical results indicate that the model is quite competitive in comparison with the existing models in the literature and looks very promising in real atmospheric simulations.

Cross-Site Evaluation of Commercial Sanger Sequencing Chemistries.

Sanger sequencing remains an essential tool utilized by researchers. Despite competition from commercial sequencing providers, many academic sequencing core facilities continue to offer these services based on a model of competitive pricing, knowledgeable technical support, and rapid turnaround time. In-house Sanger sequencing remains a viable core service and, until recently, Applied Biosystems BigDye Terminator chemistry was the only commercially available solution for Sanger DNA sequencing on Applied Biosystems (ABI) instruments; however, several new products employing novel dye chemistries and reaction configurations have entered the market. As a result, there is a need to benchmark the performance of these new chemistries on various DNA templates, including difficult-to-sequence templates, and their amenability to commonly employed cost-saving measures, such as dye dilution and reaction miniaturization. To evaluate these new reagents, a study was designed to compare the quality of Sanger sequencing data produced by ABI BigDye and commercially available kits from 2 other vendors using both control and difficult-to-sequence DNA templates under various reaction conditions. This study will serve as a valuable resource to core facilities conducting Sanger sequencing that wish to evaluate the use of an alternative chemistry in their sequencing core.

Molecular characterization of exon 28 of von Willebrand's factor gene in Nigerian population.

Polymorphisms in von Willebrand factor (VWF) gene are an important contributor to the expression of VWF gene and differences in ethnic distribution of these single nucleotide polymorphisms (SNPs) exists. Our objective was to molecularly characterize the exon 28 of the VWF gene in the three major ethnic groups of Nigeria. We recruited 90 subjects, 45 had a history of bleeding. Questions included those used in the Zimmerman Program for the Molecular and Clinical Biology of von Willebrand disease (VWD), and the bleeding scores were calculated using the Molecular and Clinical Markers for the Diagnosis and Management of type 1 VWD scoring system. Full blood count, coagulation profile, VWF:antigen level and VWF:collagen-binding activities were carried out. Data were analyzed using GraphPad Prism (5.03). GraphPad Software, Inc USA. The BigDye terminator chemistry was used to determine the nucleotide sequences of VWF gene (exon 28). Eight SNPs were identified, rs 216310 (T1547), rs 1800385 (V1565L), rs1800384 (A1515), rs1800383 (D1472H), rs 1800386 (Y1584C), rs 216311 (T1381A), rs 216312 (intronic) and rs 1800381 (P1337). The SNPs rs 216311, rs 1800383 and rs 1800386 associated significantly with bleeding in study subjects. rs1800386 occurred in all with bleeding history, no ethnic variations were noted.

Molecular characterisation of contagious ecthyma (ORF) virus from small ruminants

Contagious ecthyma (CE) or contagious pustular dermatitis (CPD) is an acute, contagious, debilitating and economically important zoonotic viral skin disease that affects domesticated as well as wild ruminants. In the present study, three different polymerase chain reaction (PCR) assays and nucleotide sequence analysis were employed successfully for the identification and characterisation of CE/CPD virus from nine [scabs (n = 8) and cell-culture adapted (n = 1)] field samples. PCR assays based on B2L gene encoding major envelope glycoprotein (based on the full length and partial length amplification) and GIF/IL-2 gene (GM-CSF and interleukin-2 inhibitory factors) were standardised. The B2L specific assays yielded amplicons of 1, 137 and 235 bp, whereas the IL-2 PCR yielded 408 bp products. The PCR amplicons were gel purified and sequenced using BigDye terminator chemistry to confirm specific amplification and to study the genetic variability among field isolates of ORF viruses. Sequencing studies demonstrated that both B2L and GIF/IL-2 genes were highly conserved with > 96 and 98% nt sequence identity, respectively. The ORF virus isolates in the present study demonstrated high relatedness with other Indian strains. Further, these studies have also shown that sequencing studies can be reliably used to identify the ORF virus isolates in clinical samples along with their genetic relatedness.

Screening analysis of candidate gene mutations in a kindred with polycystic liver disease.

To find potential mutable sites by detecting mutations of the candidate gene in a kindred with polycystic liver disease (PCLD). First, we chose a kindred with PCLD and obtained five venous blood samples of this kindred after the family members signed the informed consent form. In the kindred two cases were diagnosed with PCLD, and the left three cases were normal individuals. All the blood samples were preserved at -85 °C. Second, we extracted the genomic DNA from the venous blood samples of the kindred using a QIAamp DNA Mini Kit and then performed long-range polymerase chain reaction (PCR) with different primers. The exons of PKD1 were all sequenced with the forward and reverse primers to ensure the accuracy of the results. Next, we purified the PCR products and directly sequenced them using Big Dye Terminator Chemistry version 3.1. The sequencing reaction was conducted with BiomekFX (Beckman). Finally, we analyzed the results. A total of 42 normal exons were identified in detecting mutations of the PKD1 gene. A synonymous mutation occurred in exon 5. The mutation was a homozygous T in the proband and was C in the reference sequence. This mutation was located in the third codon and did not change the amino acid encoded by the codon. Missense mutations occurred in exons 11 and 35. These mutations were located in the second codon; they changed the amino acid sequence and existed in the dbSNP library. A nonsense mutation occurred in exon 15. The mutation was a heterozygous CT in the proband and was C in the reference sequence. This mutation was located in the first codon and resulted in a termination codon. This mutation had an obvious influence on the encoded protein and changed the length of the protein from 4303 to 2246 amino acids. This was a new mutation that was not present in the dbSNP library. The nonsense mutation of exon 15 existed in the proband and in the third individual. Additionally, the proband was heterozygous for this mutation, so the mutable site was a pathogenic mutation.

Sequencing analysis of insulin receptor defects and detection of two novel mutations in INSR gene

Mutations in the insulin receptor gene cause the inherited insulin resistant syndromes Leprechaunism and Rabson–Mendenhall syndrome. These recessive conditions are characterized by intrauterine and post-natal growth restrictions, dysmorphic features, altered glucose homeostasis, and early demise. The insulin receptor gene (INSR) maps to the short arm of chromosome 19 and is composed of 22 exons. Here we optimize the conditions for sequencing this gene and report novel mutations in patients with severe insulin resistance. MethodsPCR amplification of the 22 coding exons of the INSR gene was performed using M13-tailed primers. Bidirectional DNA sequencing was performed with BigDye Terminator chemistry and M13 primers and the product was analyzed on the ABI 3100 genetic analyzer. Data analysis was performed using Mutation Surveyor software comparing the sequence to a reference INSR sequence (Genbank NC_000019). ResultsWe sequenced four patients with Leprechaunism or Rabson–Mendenhall syndromes as well as seven samples from normal individuals and confirmed previously identified mutations in the affected patients. Three of the four mutations identified in this group caused premature insertion of a stop codon. In addition, the INSR gene was sequenced in 14 clinical samples from patients with suspected insulin resistance and one novel mutation was found in an infant with a suspected diagnosis of Leprechaunism. DiscussionLeprechaunism and Rabson–Mendenhall syndrome are very rare and difficult to diagnose. Diagnosis is currently based mostly on clinical criteria. Clinical availability of DNA sequencing can provide an objective way of confirming or excluding the diagnosis.

Glycoprotein B genotyping in congenital/perinatal cytomegalovirus infection in symptomatic infants

Molecular epidemiological studies on circulating strains of CMV in cogenital/perinatal infections have not been done earlier in this region. To study the glycoprotein B genotypes in babies with symptomatic congenital/perinatal CMV infection and to assess the possible influence of genotype on the outcome of the infection. Clinical samples (blood and urine) of symptomatic babies are sent to the Virology Department of NCDC, Delhi for the diagnosis of congenital infections. 375 clinical samples of infants (newborn - 6 months old) were included for the study. Serum samples were subjected to ELISA for detection of IgM antibodies against CMV. DNA isolation and amplification of CMV genomic DNA targeting gB gene fragment by nested PCR, was carried out in the samples. The amplified fragment including the cleavage site was subjected to RFLP using restriction enzymes Rsal and Hinf1. They were also verified by sequencing using Big Dye Terminator chemistry. 75 samples out of 375 tested were confirmed positive for CMV infection by serology and PCR. Both RFLP and sequencing of gB gene fragment showed that gB 1, 2 and 3 genotypes were in circulation. gB 3 was the most prevalent genotype in symptomatic infants. Hepatosplenomegaly was the most common feature in gB-3 genotype of CMV. gB2 congenital CMV infection was more commonly associated with long term sequelae.

ParticleCall: A particle filter for base calling in next-generation sequencing systems

BackgroundNext-generation sequencing systems are capable of rapid and cost-effective DNA sequencing, thus enabling routine sequencing tasks and taking us one step closer to personalized medicine. Accuracy and lengths of their reads, however, are yet to surpass those provided by the conventional Sanger sequencing method. This motivates the search for computationally efficient algorithms capable of reliable and accurate detection of the order of nucleotides in short DNA fragments from the acquired data.ResultsIn this paper, we consider Illumina’s sequencing-by-synthesis platform which relies on reversible terminator chemistry and describe the acquired signal by reformulating its mathematical model as a Hidden Markov Model. Relying on this model and sequential Monte Carlo methods, we develop a parameter estimation and base calling scheme called ParticleCall. ParticleCall is tested on a data set obtained by sequencing phiX174 bacteriophage using Illumina’s Genome Analyzer II. The results show that the developed base calling scheme is significantly more computationally efficient than the best performing unsupervised method currently available, while achieving the same accuracy.ConclusionsThe proposed ParticleCall provides more accurate calls than the Illumina’s base calling algorithm, Bustard. At the same time, ParticleCall is significantly more computationally efficient than other recent schemes with similar performance, rendering it more feasible for high-throughput sequencing data analysis. Improvement of base calling accuracy will have immediate beneficial effects on the performance of downstream applications such as SNP and genotype calling.ParticleCall is freely available at https://sourceforge.net/projects/particlecall.

Microcephaly with Simplified Gyration, Epilepsy, and Infantile Diabetes Linked to Inappropriate Apoptosis of Neural Progenitors

We describe a syndrome of primary microcephaly with simplified gyral pattern in combination with severe infantile epileptic encephalopathy and early-onset permanent diabetes in two unrelated consanguineous families with at least three affected children. Linkage analysis revealed a region on chromosome 18 with a significant LOD score of 4.3. In this area, two homozygous nonconserved missense mutations in immediate early response 3 interacting protein 1 (IER3IP1) were found in patients from both families. IER3IP1 is highly expressed in the fetal brain cortex and fetal pancreas and is thought to be involved in endoplasmic reticulum stress response. We reported one of these families previously in a paper on Wolcott-Rallison syndrome (WRS). WRS is characterized by increased apoptotic cell death as part of an uncontrolled unfolded protein response. Increased apoptosis has been shown to be a cause of microcephaly inanimal models. An autopsy specimen from one patient showed increased apoptosis in the cerebral cortex and pancreas beta cells, implicating premature cell death as the pathogenetic mechanism. Both patient fibroblasts and control fibroblasts treated with siRNA specific for IER3IP1 showed an increased susceptibility to apoptotic cell death under stress conditions in comparison to controls. This directly implicates IER3IP1 in the regulation of cell survival. Identification of IER3IP1 mutations sheds light on the mechanisms of brain development and on the pathogenesis of infantile epilepsy and early-onset permanent diabetes.

Leishmania : Probable genetic hybrids between species in Sudanese isolates

The horn of Africa bears the prunt of Leishmaniasis in the world where both Phlebotomus orientalis, the vector of Leishmania donovani and Phlebotomus papatasi, the vector ofLeishmania major, exist. Visceral leishmaniasis (VL) caused by L. donovani is a major cause of morbidity and mortality in east Africa. The populations of east Africa are very dynamic in continuous movements between endemic areas of different leishmaniasis clinical forms. Molecular epidemiological studies have provided indirect evidence for genetic exchange between different strains of one Leishmania species. Only recently, genetic exchange between different Leishmania strains of one species was definitively demonstrated in vitro. Genetic exchange between different Leishmania species is probably an even rarer event. In this study, one hundred and seven L. donovani isolates were collected from lymph nodes/bone marrow aspirates, from patients from Sudan and Ethiopia. DNA was isolated from leishmania parasites using the High Pure PCR Template Preparation Kit. PCR products were sequenced using BigDye Terminator chemistry and analyzed using the ABI 3100 or 3730 Genetic Analyzers. Sequences were analyzed using CodonCode program (CodonCode Corporation) and MEGA. Sequences were submitted to Genbank and are accessible under accession numbers HM117696-HM117699. Our data showed hybridization between two divergent Leishmaniaspecies, L. donovani and L. major, possibly due to migration. Such hybridization may have clinical implications with respect to parasite fitness, vector adaptation and response to treatment. Key words: Leishmania donovani, Leishmania major, Leishmania infantum, Visceral leishmaniasis (VL), leishmaniasis, Phlebotomus orientalis, Phlebotomus papatasi.

A Bioinformatics Workflow for Variant Peptide Detection in Shotgun Proteomics

Shotgun proteomics data analysis usually relies on database search. However, commonly used protein sequence databases do not contain information on protein variants and thus prevent variant peptides and proteins from been identified. Including known coding variations into protein sequence databases could help alleviate this problem. Based on our recently published human Cancer Proteome Variation Database, we have created a protein sequence database that comprehensively annotates thousands of cancer-related coding variants collected in the Cancer Proteome Variation Database as well as noncancer-specific ones from the Single Nucleotide Polymorphism Database (dbSNP). Using this database, we then developed a data analysis workflow for variant peptide identification in shotgun proteomics. The high risk of false positive variant identifications was addressed by a modified false discovery rate estimation method. Analysis of colorectal cancer cell lines SW480, RKO, and HCT-116 revealed a total of 81 peptides that contain either noncancer-specific or cancer-related variations. Twenty-three out of 26 variants randomly selected from the 81 were confirmed by genomic sequencing. We further applied the workflow on data sets from three individual colorectal tumor specimens. A total of 204 distinct variant peptides were detected, and five carried known cancer-related mutations. Each individual showed a specific pattern of cancer-related mutations, suggesting potential use of this type of information for personalized medicine. Compatibility of the workflow has been tested with four popular database search engines including Sequest, Mascot, X!Tandem, and MyriMatch. In summary, we have developed a workflow that effectively uses existing genomic data to enable variant peptide detection in proteomics.

Use of direct sequencing for detection of mutations in the BCR-ABL kinase domain in Slovak patients with chronic myeloid leukemia

The presence of BCR-ABL oncogene mutations in patients with chronic myeloid leukemia (CML) may be responsible for the failure of tyrosine kinase inhibitor (TKI) treatment. The aim of the study was to evaluate the frequency of BCR-ABL gene mutations in patients with CML treated with tyrosine kinase inhibitors. Our lab received 64 samples (34 women, 30 men) from patients with CML who failed or had suboptimal response to TKI treatment. The mutation analysis was performed in 61 patients with CML, 3 patients could not be tested because of inadequate RNA quality. An 866 base pair fragment containing the ABL kinase domain was amplified in a seminested RT (reverse transcriptase)-PCR and then sequenced using Applied Biosystems BigDye Terminator chemistry with two pairs of primers. We analyzed 61 patients with CML, 11 mutations were detected in 13 (21%) patients and SNP (single nucleotide polymorphism) in 6 patients (10%). In addition to 9 point mutations (G250E / F317L, F359V, L387M, Y253H, M388L, M244V, T315I, D276G), 35 bp insertion between exons 8 and 9 and deletion exon 7 were detected. Our results demonstrate that direct sequencing is suitable for routine clinical monitoring patients with CML and may be useful for optimizing therapy.

Molecular analysis of phenylalanine hydroxylase (PAH) gene from dried blood spots from Libyan phenylketonuria patients

Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism due to deficiency in the phenylalanine hydroxylase gene (PAH). This study describes the distribution of PAH mutations in nine probands from Libya with the diagnosis of phenylketonuria and hyperphenylalaninemia. Molecular genetics screening was done at the Shafallah Medical Genetics Center laboratory by resequencing and analysis of the entire coding sequences, exon flanking regions and splice sites of PAH. Genomic DNA was isolated from dry blood spots (n=9) by organic extraction technique and purified using centrifugal column filter device. The 13 exons , exon-intron boundaries and splice sites of the PAH were amplified by polymerase chain reaction using in-house designed primers and optimized conditions. The DNA sequencing reactions were carried out by automated sequencer using BigDye Terminator chemistry. Two homologous PAH mutations were found in 7/9 probands and were c.838G>A/p.E280K (missense) and c.1055delG (frame shift). The frame shift mutation produces a truncated protein of 399 amino acid length. Two Probands were homozygous for the missense mutation, three were homozygous for the frame shift mutation and two were compound heterozygous for both mutations. This initial study should be followed by an analysis of phenotype – genotype correlation pattern to better understand the disease process.

Gene identification in Mendelian forms of familial epilepsy

Abstract Epilepsy encompasses a heterogeneous group of recurrent seizure disorders affecting 1% of the world's population. Idiopathic generalized epilepsy accounts for 40% of all epilepsy disorders. Genetic factors contribute significantly to the etiology of idiopathic generalized epilepsies. Complex non-Mendelian forms of familial epilepsies comprise the majority of idiopathic generalized epilepsies, where susceptibility genes remain largely unknown. However, rare Mendelian or monogenic familial epilepsies have contributed to our understanding of the genetic heterogeneity and complexity of epilepsy disorders. Recent advances in the genetics of epilepsy have identified most monogenic idiopathic generalized epilepsies as being caused by various channelopathies of which the majority show an autosomal dominant pattern of inheritance. In this study we aim to identify gene(s) responsible for autosomal recessive forms of familial idiopathic generalized epilepsy. We identified one consanguineous family with idiopathic generalized epilepsy showing an autosomal recessive pattern of inheritance. Age of onset of epilepsy in affected family members was in early adolescence. The majority manifest generalized tonic-clonic seizures and abnormal EEG findings. We performed whole-genome single nucleotide polymorphism genotyping for the five family members using Illumina platform (200,000 single nucleotide polymorphisms). Linkage analysis by homozygosity mapping (Homozygosity Mapper) was performed. We identified one region spanning approximately10 Mb on the long arm of chromosome 11. The region contains 279 protein-coding genes. Candidate genes were prioritized in-silico based on brain expression and conservation through evolution. The identified candidate genes are re-sequenced (Sanger sequencing, big dye terminator chemistry) and one gene has been excluded up to date. We are currently re-sequencing and pre-forming mutation analysis on the remaining ten candidate genes.

Live Cell Fluorescence Resonance Energy Transfer Predicts an Altered Molecular Association of Heterologous PrPSc with PrPC

Prion diseases result from the accumulation of a misfolded isoform (PrP(Sc)) of the normal host prion protein (PrP(C)). PrP(Sc) propagates by templating its conformation onto resident PrP(C) to generate new PrP(Sc). Although the nature of the PrP(Sc)-PrP(C) complex is unresolved, certain segments or specific residues are thought to feature critically in its formation. The polymorphic residue 129 is one such site under considerable study. We combined transmission studies with a novel live cell yeast-based fluorescence resonance energy transfer (FRET) system that models the molecular association of PrP in a PrP(Sc)-like state, as a way to explore the role of residue 129 in this process. We show that a reduction in efficiency of prion transmission between donor PrP(Sc) and recipient PrP(C) that are mismatched at residue 129 correlates with a reduction in FRET between PrP-129M and PrP-129V in our yeast model. We further show that this effect depends on the different secondary structure propensities of Met and Val, rather than the specific amino acids. Finally, introduction of the disease-associated P101L mutation (mouse- equivalent) abolished FRET with wild-type mouse PrP, whereas mutant PrP-P101L displayed high FRET with homologous PrP-P101L, as long as residue 129 matched. These studies provide the first evidence for a physical alteration in the molecular association of PrP molecules differing in one or more residues, and they further predict that the different secondary structure propensities of Met and Val define the impaired association observed between PrP(Sc) and PrP(C) mismatched at residue 129.

SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus)

Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi) on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.

Mutations in LTBP4 Cause a Syndrome of Impaired Pulmonary, Gastrointestinal, Genitourinary, Musculoskeletal, and Dermal Development

We report recessive mutations in the gene for the latent transforming growth factor-beta binding protein 4 (LTBP4) in four unrelated patients with a human syndrome disrupting pulmonary, gastrointestinal, urinary, musculoskeletal, craniofacial, and dermal development. All patients had severe respiratory distress, with cystic and atelectatic changes in the lungs complicated by tracheomalacia and diaphragmatic hernia. Three of the four patients died of respiratory failure. Cardiovascular lesions were mild, limited to pulmonary artery stenosis and patent foramen ovale. Gastrointestinal malformations included diverticulosis, enlargement, tortuosity, and stenosis at various levels of the intestinal tract. The urinary tract was affected by diverticulosis and hydronephrosis. Joint laxity and low muscle tone contributed to musculoskeletal problems compounded by postnatal growth delay. Craniofacial features included microretrognathia, flat midface, receding forehead, and wide fontanelles. All patients had cutis laxa. Four of the five identified LTBP4 mutations led to premature termination of translation and destabilization of the LTBP4 mRNA. Impaired synthesis and lack of deposition of LTBP4 into the extracellular matrix (ECM) caused increased transforming growth factor-beta (TGF-beta) activity in cultured fibroblasts and defective elastic fiber assembly in all tissues affected by the disease. These molecular defects were associated with blocked alveolarization and airway collapse in the lung. Our results show that coupling of TGF-beta signaling and ECM assembly is essential for proper development and is achieved in multiple human organ systems by multifunctional proteins such as LTBP4.

Application of full mitochondrial genome sequencing using 454 GS FLX pyrosequencing

The GS FLX pyrosequencing platform using parallel tagged sequencing was tested on 10 Somali individuals for sequencing of the complete mitochondrial genome. The amplicons were sequenced twice with increasing coverage to establish the minimum of coverage needed to produce reliable sequence reads. The genome sequences were compared to previously obtained control regions sequences with Sanger sequencing and 49 SNPs in coding regions of the mitochondrial genome. No discrepancy was found with the three methods except in a poly-C stretch that was estimated to be 16193.1C by sequencing with terminator chemistry and no insert was observed with pyrosequencing. The sequence lengths of both pyrosequencing runs were between 225 and 235 nucleotides. The coverage for the first pyrosequencing run was between 0 and 159 and 10–577 for the second one.

Novel FAM83H mutations in Turkish families with autosomal dominant hypocalcified amelogenesis imperfecta

Novel <i>FAM83H </i>mutations in Turkish families with autosomal dominant hypocalcified amelogenesis imperfecta

The nucleotide sequence of Shigella flexneri 1A: A common Indian isolate

We report complete sequences of 2 genes of S.flexneri 1a an Indian isolate for the first time. Shigella is causative agent of shigellosis or bacillary dysentery. Genomic library was constructed by shotgun approach. Sequencing was carried out using Big Dye terminator chemistry using ABI 3730 48 capillary DNA analyzer. 170 recombinants were subjected to nucleotide sequencing. Sequence data was analyzed, of these 2 clones showed presence of complete genes out of the total clones sequenced. Annotations were done using various bioinformatics tools. Gene Sfo676 on contig SF21B11, 513 bp long codes for a protein 170 aa long with molecular weight of 18836.5 daltons. The protein is 99 % identical to S. flexneri 2a 301 and not with any other strain of Shigella. It has 7 different sites for phosphorylation, myristoylation and glycosylation. Predicted cellular localization is cytoplasmic membrane. SF0368 is another full-length gene SF0368 on contig SF69C1 is a 312 nucleotide long. It is 103 aa long with molecular weight 11394.0 daltons. Protein is 100% identical to S. flexneri 2a 301 and 99% with S. sonnei strain 046. The gene shows difference when compared with S.sonnei in mono and dinucleotide frequency as well as amino acid composition.