Terminal Uridylyl Transferase Research Articles

RNA editing landscape of adipose tissue in polycystic ovary syndrome provides insight into the obesity-related immune responses.

Polycystic ovary syndrome (PCOS) is the most common reproductive-endocrine disorder with wide-ranging metabolic implications, including obesity. RNA editing, a post-transcriptional modification, can fine-tune protein function and introduce heterogeneity. However, the role of RNA editing and its impact on adipose tissue function in PCOS remain poorly understood. This study aimed to comprehensively analyze RNA-editing events in abdominal and subcutaneous adipose tissue of PCOS patients and healthy controls using high-throughput whole-genome sequencing (WGS) and RNA sequencing. Our results revealed that PCOS patients exhibited more RNA-editing sites, with adenosine-to-inosine (A-to-I) editing being prevalent. The expression of ADAR genes, responsible for A-to-I editing, was also higher in PCOS. Aberrant RNA-editing sites in PCOS adipose tissue was enriched in immune responses, and interleukin-12 biosynthetic process. Tumor necrosis factor (TNF) signaling, nuclear factor kappa B (NF-κB) signaling, Notch signaling, terminal uridylyl transferase 4 (TUT4), hook microtubule tethering protein 3 (HOOK3), and forkhead box O1 (FOXO1) were identified to be of significant differences. Differentially expressed genes (DEGs) in PCOS adipose tissue were enriched in immune responses compared with controls, and the DEGs between subcutaneous and abdominal adipose tissue were also enriched in immune responses suggesting the important role of subcutaneous adipose tissue. Furthermore, we identified the correlations between RNA editing levels and RNA expression levels of specific genes, such as ataxia-telangiectasia mutated (ATM) and mucosa-associated lymphoid tissue lymphoma translocation protein 1 (MALT1) in inflammation pathways and ATM, TUT4, and YTH N6-methyladenosine RNA-binding protein C2 (YTHDC2) in oocyte development pathway. These findings suggest that RNA-editing dysregulation in PCOS adipose tissue may contribute to inflammatory dysregulations. Understanding the interplay between RNA editing and adipose tissue function may unveil potential therapeutic targets for PCOS management. However, further research and validation are required to fully elucidate the molecular mechanisms underlying these associations.

Identifying the stability of housekeeping genes to be used for the quantitative real-time PCR normalization in retinal tissue of streptozotocin-induced diabetic rats.

To investigate the stability of the seven housekeeping genes: beta-actin (ActB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18s ribosomal unit 5 (18s), cyclophilin A (CycA), hypoxanthine-guanine phosphoribosyl transferase (HPRT), ribosomal protein large P0 (36B4) and terminal uridylyl transferase 1 (U6) in the diabetic retinal tissue of rat model. The expression of these seven genes in rat retinal tissues was determined using real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) in two groups; normal control rats and streptozotocin-induced diabetic rats. The stability analysis of gene expression was investigated using geNorm, NormFinder, BestKeeper, and comparative delta-Ct (ΔCt) algorithms. The 36B4 gene was stably expressed in the retinal tissues of normal control animals; however, it was less stable in diabetic retinas. The 18s gene was expressed consistently in both normal control and diabetic rats' retinal tissue. That this gene was the best reference for data normalisation in RT-qPCR studies that used the retinal tissue of streptozotocin-induced diabetic rats. Furthermore, there was no ideal gene stably expressed for use in all experimental settings. Identifying relevant genes is a need for achieving RT-qPCR validity and reliability and must be appropriately achieved based on a specific experimental setting.

USP4 regulates TUT1 ubiquitination status in concert with SART3

The ubiquitin system plays pivotal roles in diverse cellular processes, including signal transduction, transcription and translation, organelle quality control, and protein degradation. Recent investigations have revealed the regulatory influence of ubiquitin systems on RNA metabolism. Previously, we reported that the deubiquitinating enzyme, ubiquitin specific peptidase 15 (USP15), promotes deubiquitination of terminal uridylyl transferase 1 (TUT1), a key regulator within the U4/U6 spliceosome, thereby instigating significant alterations in global RNA splicing [1]. In this study, we report that ubiquitin specific peptidase 4 (USP4), a homologous protein to USP15, also exerts control over the ubiquitination status of TUT1. Analogous to USP15, the expression of USP4 results in a reduction of TUT1 ubiquitination. Furthermore, squamous cell carcinoma antigen recognized by T-cells 3 (SART3) collaborates in enhancing the deubiquitinating activity of USP4 towards TUT1. A crucial revelation is that USP4 orchestrates the subnuclear relocation of TUT1 from the nucleolus to the nucleoplasm and facilitates the stability of U6 small nuclear RNA (snRNA). Notably, USP4 has a more profound effect on TUT1 redistribution compared to USP15. Our findings suggest that USP4 intricately modulates the ubiquitination status of TUT1, thereby exerting pronounced effects on the spliceosome functions.

Mechanism of U6 snRNA oligouridylation by human TUT1

U6 snRNA is a catalytic RNA responsible for pre-mRNA splicing reactions and undergoes various post-transcriptional modifications during its maturation process. The 3'-oligouridylation of U6 snRNA by the terminal uridylyltransferase, TUT1, provides the Lsm-binding site in U6 snRNA for U4/U6 di-snRNP formation and this ensures pre-mRNA splicing. Here, we present the crystal structure of human TUT1 (hTUT1) complexed with U6 snRNA, representing the post-uridylation of U6 snRNA by hTUT1. The N-terminal ZF-RRM and catalytic palm clamp the single-stranded AUA motif between the 5'-short stem and the 3'-telestem of U6 snRNA, and the ZF-RRM specifically recognizes the AUA motif. The ZF and the fingers hold the telestem, and the 3'-end of U6 snRNA is placed in the catalytic pocket of the palm for oligouridylation. The oligouridylation of U6 snRNA depends on the internal four-adenosine tract in the 5'-part of the telestem of U6 snRNA, and hTUT1 adds uridines until the internal adenosine tract can form base-pairs with the 3'-oligouridine tract. Together, the recognition of the specific structure and sequence of U6 snRNA by the multi-domain TUT1 protein and the intrinsic sequence and structure of U6 snRNA ensure the oligouridylation of U6 snRNA.

Uridylation of the histone mRNA stem-loop weakens binding interactions with SLBP while maintaining interactions with 3’hExo

ABSTRACT Histone mRNA degradation is controlled by the unique 3’ stem-loop of histone mRNA and the stem-loop binding protein (SLBP). As part of this process, the 3’ stem-loop is trimmed by the histone-specific 3’ exonuclease (3’hExo) and uridylated by the terminal uridylyl transferase 7 (TUT7), creating partially degraded intermediates with short uridylations. The role of these uridylations in degradation is not fully understood. Our work examines changes in the stability of the ternary complex created by trimming and uridylation of the stem-loop to better understand the role of this process in the histone mRNA life cycle. In this study, we used fluorescence polarization and electrophoretic mobility shift assays to demonstrate that both SLBP and 3’hExo can bind to uridylated and partially degraded stem-loop intermediates, although with lower affinity. We further characterized this complex by performing 1-µs molecular dynamics simulations using the AMBER force field and Nanoscale Molecular Dynamics (NAMD). These simulations show that while uridylation helps maintain the overall shape of the stem-loop, the combination of uridylation and dephosphorylation of the TPNK motif in SLBP disrupts key RNA–protein interactions. They also demonstrate that uridylation allows 3’hExo to maintain contact with the stem-loop after partial degradation and plays a role in disrupting key base pairs in partially degraded histone mRNA intermediates. Together, these experiments and simulations suggest that trimming by 3’hExo, uridylation, and SLBP dephosphorylation weakens both RNA–protein interactions and the stem-loop itself. Our results further elucidate the role of uridylation and SLBP dephosphorylation in the early stages of histone mRNA degradation.

DIS3L2 knockdown impairs key oncogenic properties of colorectal cancer cells via the mTOR signaling pathway

DIS3L2 degrades different types of RNAs in an exosome-independent manner including mRNAs and several types of non-coding RNAs. DIS3L2-mediated degradation is preceded by the addition of nontemplated uridines at the 3’end of its targets by the terminal uridylyl transferases 4 and 7. Most of the literature that concerns DIS3L2 characterizes its involvement in several RNA degradation pathways, however, there is some evidence that its dysregulated activity may contribute to cancer development. In the present study, we characterize the role of DIS3L2 in human colorectal cancer (CRC). Using the public RNA datasets from The Cancer Genome Atlas (TCGA), we found higher DIS3L2 mRNA levels in CRC tissues versus normal colonic samples as well as worse prognosis in patients with high DIS3L2 expression. In addition, our RNA deep-sequencing data revealed that knockdown (KD) of DIS3L2 induces a strong transcriptomic disturbance in SW480 CRC cells. Moreover, gene ontology (GO) analysis of significant upregulated transcripts displays enrichment in mRNAs encoding proteins involved in cell cycle regulation and cancer-related pathways, which guided us to evaluate which specific hallmarks of cancer are differentially regulated by DIS3L2. To do so, we employed four CRC cell lines (HCT116, SW480, Caco-2 and HT-29) differing in their mutational background and oncogenicity. We demonstrate that depletion of DIS3L2 results in reduced cell viability of highly oncogenic SW480 and HCT116 CRC cells, but had little or no impact in the more differentiated Caco-2 and HT-29 cells. Remarkably, the mTOR signaling pathway, crucial for cell survival and growth, is downregulated after DIS3L2 KD, whereas AZGP1, an mTOR pathway inhibitor, is upregulated. Furthermore, our results indicate that depletion of DIS3L2 disturbs metastasis-associated properties, such as cell migration and invasion, only in highly oncogenic CRC cells. Our work reveals for the first time a role for DIS3L2 in sustaining CRC cell proliferation and provides evidence that this ribonuclease is required to support the viability and invasive behavior of dedifferentiated CRC cells.

An extensive survey of phytoviral RNA 3' uridylation identifies extreme variations and virus-specific patterns.

Viral RNAs can be uridylated in eukaryotic hosts. However, our knowledge of uridylation patterns and roles remains rudimentary for phytoviruses. Here, we report global 3' terminal RNA uridylation profiles for representatives of the main families of positive single-stranded RNA phytoviruses. We detected uridylation in all 47 viral RNAs investigated here, revealing its prevalence. Yet, uridylation levels of viral RNAs varied from 0.2% to 90%. Unexpectedly, most poly(A) tails of grapevine fanleaf virus (GFLV) RNAs, including encapsidated tails, were strictly monouridylated, which corresponds to an unidentified type of viral genomic RNA extremity. This monouridylation appears beneficial for GFLV because it became dominant when plants were infected with nonuridylated GFLV transcripts. We found that GFLV RNA monouridylation is independent of the known terminal uridylyltransferases (TUTases) HEN1 SUPPRESSOR 1 (HESO1) and UTP:RNA URIDYLYLTRANSFERASE 1 (URT1) in Arabidopsis (Arabidopsis thaliana). By contrast, both TUTases can uridylate other viral RNAs like turnip crinkle virus (TCV) and turnip mosaic virus (TuMV) RNAs. Interestingly, TCV and TuMV degradation intermediates were differentially uridylated by HESO1 and URT1. Although the lack of both TUTases did not prevent viral infection, we detected degradation intermediates of TCV RNA at higher levels in an Arabidopsis heso1 urt1 mutant, suggesting that uridylation participates in clearing viral RNA. Collectively, our work unveils an extreme diversity of uridylation patterns across phytoviruses and constitutes a valuable resource to further decipher pro- and antiviral roles of uridylation.

TUT4/7-mediated uridylation of a coronavirus subgenomic RNAs delays viral replication

Coronaviruses are positive-strand RNA viruses with 3′ polyadenylated genomes and subgenomic transcripts. The lengths of the viral poly(A) tails change during infection by mechanisms that remain poorly understood. Here, we use a splint-ligation method to measure the poly(A) tail length and poly(A) terminal uridylation and guanylation of the mouse hepatitis virus (MHV) RNAs. Upon infection of 17-CL1 cells with MHV, a member of the Betacoronavirus genus, we observe two populations of terminally uridylated viral transcripts, one with poly(A) tails ~44 nucleotides long and the other with poly(A) tails shorter than ~22 nucleotides. The mammalian terminal uridylyl-transferase 4 (TUT4) and terminal uridylyl-transferase 7 (TUT7), referred to as TUT4/7, add non-templated uracils to the 3′-end of endogenous transcripts with poly(A) tails shorter than ~30 nucleotides to trigger transcript decay. Here we find that depletion of the host TUT4/7 results in an increased replication capacity of the MHV virus. At late stages of infection, the population of uridylated subgenomic RNAs with tails shorter than ~22 nucleotides is reduced in the absence of TUT4/7 while the viral RNA load increases. Our findings indicate that TUT4/7 uridylation marks the MHV subgenomic RNAs for decay and delays viral replication.

Terminal Uridylyltransferases TUT4/7 Regulate microRNA and mRNA Homeostasis.

The terminal nucleotidyltransferases TUT4 and TUT7 (TUT4/7) regulate miRNA and mRNA stability by 3' end uridylation. In humans, TUT4/7 polyuridylates both mRNA and pre-miRNA, leading to degradation by the U-specific exonuclease DIS3L2. We investigate the role of uridylation-dependent decay in maintaining the transcriptome by transcriptionally profiling TUT4/7 deleted cells. We found that while the disruption of TUT4/7 expression increases the abundance of a variety of miRNAs, the let-7 family of miRNAs is the most impacted. Eight let-7 family miRNAs were increased in abundance in TUT4/7 deleted cells, and many let-7 mRNA targets are decreased in abundance. The mRNAs with increased abundance in the deletion strain are potential direct targets of TUT4/7, with transcripts coding for proteins involved in cellular stress response, rRNA processing, ribonucleoprotein complex biogenesis, cell-cell signaling, and regulation of metabolic processes most affected in the TUT4/7 knockout cells. We found that TUT4/7 indirectly control oncogenic signaling via the miRNA let-7a, which regulates AKT phosphorylation status. Finally, we find that, similar to fission yeast, the disruption of uridylation-dependent decay leads to major rearrangements of the transcriptome and reduces cell proliferation and adhesion.

An miRISC-initiated DNA nanomachine for monitoring MicroRNA activity in living cells

MicroRNAs (miRNAs) play an important role in post-transcriptional regulation of gene expression. However, methods to accurately detect miRNA activity in living cells are still limited. Here we developed a DNA nanomachine initiated by a miRNA-induced silencing complex (miRISC) for imaging miRNA activity in living cells. miRISC-mediated RNA cleavage reaction activated the DNA nanomachine by the specific cleavage of an RNA strand on the machine, resulting in autonomous movement of the walking leg around the AuNP surface with the release of a large number of fluorescently labeled DNA strands. The DNA nanomachine was successfully applied to detect miR-21 activity in three cell lines with different miR-21 expression profiles. We also demonstrated that terminal uridylyltransferase Tut4 knockdown by siRNA significantly increased the activity of let-7b miRNA, which further verifies the versatility of our DNA nanomachine. This new nanomachine has distinct advantages compared with reported methods for detecting miRNA activity, including simple operating procedures, short analysis time and sensitive signal output. Collectively, this work not only expands the application of the DNA nanomachine in the detection of miRNA activity, but also provides a promising tool for basic research in cell biology and development of clinical biomedicine.

Uridylation and the SKI complex orchestrate the Calvin cycle of photosynthesis through RNA surveillance of TKL1 in Arabidopsis.

RNA uridylation, catalyzed by terminal uridylyl transferases (TUTases), represents a conserved and widespread posttranscriptional RNA modification in eukaryotes that affects RNA metabolism. In plants, several TUTases, including HEN1 SUPPRESSOR 1 (HESO1) and UTP: RNA URIDYLYLTRANSFERASE (URT1), have been characterized through genetic and biochemical approaches. However, little is known about their physiological significance during plant development. Here, we show that HESO1 and URT1 act cooperatively with the cytoplasmic 3'-5' exoribonucleolytic machinery component SUPERKILLER 2 (SKI2) to regulate photosynthesis through RNA surveillance of the Calvin cycle gene TRANSKETOLASE1 (TKL1) in Arabidopsis. Simultaneous dysfunction of HESO1, URT1, and SKI2 resulted in leaf etiolation and reduced photosynthetic efficiency. In addition, we detected massive illegitimate short interfering RNAs (siRNAs) from the TKL1 locus in heso1 urt1 ski2, accompanied by reduced TKL1/2 expression and attenuated TKL activities. Consequently, the metabolic analysis revealed that the abundance of many Calvin cycle intermediates is dramatically disturbed in heso1 urt1 ski2. Importantly, all these molecular and physiological defects were largely rescued by the loss-of-function mutation in RNA-DEPENDENT RNA POLYMERASE 6 (RDR6), demonstrating illegitimate siRNA-mediated TKL silencing. Taken together, our results suggest that HESO1- and URT1-mediated RNA uridylation connects to the cytoplasmic RNA degradation pathway for RNA surveillance, which is crucial for TKL expression and photosynthesis in Arabidopsis.

Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

Uridylation: a vital way for cellular RNA surveillance.

RNA uridylation is an efficient posttranscriptional regulator of gene expression conserved in almost all eukaryotes. Terminal uridylyltransferase (TUTase) are responsible for monouridylation and oligouridylation of various RNA substrates, including snRNA, miRNA, mRNA and other ncRNAs. Studies have demonstrated that monouridylation on ncRNA intermediates alters their ultimate products and processing rates, whereas oligouridylation is often employed to degrade particular RNAs with spatio-temporal specificity and responsible for clearance of the aberrant RNAs and viral RNAs. Uridylation regulates gene expression by these two ways, therefore affects several important biological processes including organismal reproduction and early development, apoptosis, tumorigenesis, as well as virus infection. In this review, we provide the summarization of current researches on uridylation, introduce several techniques widely used for RNA 3' terminus detection, put more emphases on describing the mechanisms of how uridylation controls gene expression, and summarize the key roles of uridylation in RNA surveillance and several biological processes. Furthermore, we discuss other unsolved issues and crucial aspects of future research as well, with the aim of providing new ideas for anti-tumor and anti-virus therapies.

Computational and Biophysical Analysis of RNA/Protein Complexes in Histone mRNA Degradation

Histone mRNA is the only known metazoan mRNA that is not polyadenylated at its 3’ end; instead, it ends in a highly conserved stem‐loop. This stem‐loop and its protein binding partner, the stem‐loop binding protein (SLBP), control every aspect of histone mRNA metabolism. As the cell prepares to degrade histone mRNA in the cytoplasm towards the end of S‐phase, both of these elements are modified; the mRNA is trimmed by 3’ human exonuclease (3’hExo) and uridylated by a terminal uridylyl transferase, while SLBP is dephosphorylated. The trimming and uridylation process creates uridylated intermediates that differ in length as the histone mRNA begins to undergo degradation, while the dephosphorylation of SLBP destabilizes the protein. Both of these events are associated with histone mRNA degradation, their exact roles in histone mRNA metabolism are not fully understood. In this study, we seek to characterize how these changes to SLBP and histone mRNA affect the stability of the ternary SLBP/3’hEXO/mRNA complex using both computational and experimental methods. To computationally characterize the effects of uridylation on stability of the ternary complex, we performed molecular dynamics simulations (1 µs) using AMBER force fields and Nanoscale Molecular Dynamics (NAMD). To experimentally characterize these observations, we used a fluorescence‐based EMSA competition assay to measure the proteins’ difference in affinity for the wild‐type stem‐loop and uridylated intermediates. Through these experiments, we have gained valuable insight into the role of both the uridylation of histone mRNA and the dephosphorylation of SLBP at the beginning of histone mRNA degradation.

3097 – RNA EDITOR-EXONUCLEASE AXIS SCULPTS THE TRANSCRIPTOME DURING TERMINAL ERYTHROID DIFFERENTIATION

Erythropoiesis is a committed process by which erythroid progenitors become mature red blood cells (RBCs). Reticulocytes are terminal-staged, immature RBCs which contain selected residual RNA after enucleation. Normally, reticulocytes are efficiently processed and typically represent a small percentage of cells in human peripheral blood. In contrast, when differentiated from iPS or CD34+ hematopoietic stem/progenitor cells in vitro, erythroid cells tend to arrest at the reticulocyte stage. This is the major bottleneck for the complete recapitulation of erythropoiesis in vitro, and a hindrance to modeling hemoglobinopathies in cell cultures. Recent studies have highlighted that uridylation by Terminal Uridylyl Transferases (TUTases 7/4, official names are ZCCHC6/11) occurs on a broad spectrum of RNA classes in mammalian cells. Oligo-uridylated RNA is then recognized by exoribonucleases and targeted for decay. We posited that this is the machinery behind RNA degradation that accompanies terminal erythropoiesis. Utilizing both constitutional and erythroid-specific conditional murine knockout models, we found that blood from TUTase Zcchc6 RNA editor knockout embryos indeed exhibit reticulocytosis with a terminal maturation defect, as documented by FACS, histology, and hematological profiling. Murine strains deficient in the downstream exonuclease, Dis3l2, phenocopied the RNA decay defect of the Zcchc6 KO. Furthermore, knockout models did not show signs of hemolysis suggesting a cell intrinsic and niche-independent role for the TUTase7-Dis3l2 axis in promoting red blood cell maturation. Modulating the expression of this axis holds promise for enhancing in vitro erythropoiesis and modeling of hemoglobinopathies. Future mechanism studies will also reveal a post-transcriptional regulatory machinery governing maturation from reticulocytes to erythrocytes.

Nuclear poly(A) binding protein 1 (PABPN1) mediates zygotic genome activation-dependent maternal mRNA clearance during mouse early embryonic development.

An embryo starts its life with maternal mRNA clearance, which is crucial for embryonic development. The elimination of maternal transcripts occurs by the joint action of two pathways: the maternally encoded mRNA decay pathway (M-decay) and the zygotic genome activation (ZGA)-dependent pathway (Z-decay). However, zygotic factors triggering maternal mRNA decay in early mammalian embryos remain largely unknown. In this study, we identified the zygotically encoded nuclear poly(A) binding protein 1 (PABPN1) as a factor required for maternal mRNA turnover, with a previously undescribed cytoplasmic function. Cytoplasmic PABPN1 docks on 3′-uridylated transcripts, downstream of terminal uridylyl transferases TUT4 and TUT7, and recruits 3′-5′ exoribonuclease DIS3L2 to its targets, facilitating maternal mRNA decay. Pabpn1-knockout in mice resulted in preimplantation stage mortality due to early developmental arrest at the morula stage. Maternal mRNAs to be eliminated via the Z-decay pathway failed to be removed from Pabpn1-depleted embryos. Furthermore, PABPN1-mediated Z-decay is essential for major ZGA and regulates the expression of cell fate-determining factors in mouse preimplantation embryos. This study revealed an unforeseen cytoplasmic function of PABPN1 coupled with early embryonic development, characterized the presence of a zygotic destabilizer of maternal mRNA, and elucidated the Z-decay process mechanisms, which potentially contribute to human fertility.

The EIF4E1-4EIP cap-binding complex of Trypanosoma brucei interacts with the terminal uridylyl transferase TUT3.

Most transcription in Trypanosoma brucei is constitutive and polycistronic. Consequently, the parasite relies on post-transcriptional mechanisms, especially affecting translation initiation and mRNA decay, to control gene expression both at steady-state and for adaptation to different environments. The parasite has six isoforms of the cap-binding protein EIF4E as well as five EIF4Gs. EIF4E1 does not bind to any EIF4G, instead being associated with a 4E-binding protein, 4EIP. 4EIP represses translation and reduces the stability of a reporter mRNA when artificially tethered to the 3’-UTR, whether or not EIF4E1 is present. 4EIP is essential during the transition from the mammalian bloodstream form to the procyclic form that lives in the Tsetse vector. In contrast, EIF4E1 is dispensable during differentiation, but is required for establishment of growing procyclic forms. In Leishmania, there is some evidence that EIF4E1 might be active in translation initiation, via direct recruitment of EIF3. However in T. brucei, EIF4E1 showed no detectable association with other translation initiation factors, even in the complete absence of 4EIP. There was some evidence for interactions with NOT complex components, but if these occur they must be weak and transient. We found that EIF4E1is less abundant in the absence of 4EIP, and RNA pull-down results suggested this might occur through co-translational complex assembly. We also report that 4EIP directly recruits the cytosolic terminal uridylyl transferase TUT3 to EIF4E1/4EIP complexes. There was, however, no evidence that TUT3 is essential for 4EIP function.

Biophysical Characterization and Computational Modeling of Histone mRNA Degradation Intermediates

Histone mRNA is the only known metazoan mRNA that is not polyadenylated at its 3′ end; instead, it ends in a highly conserved stem-loop formed by Watson-Crick base pairing. In histone mRNA degradation, the stem-loop is trimmed by 3′ human exonuclease (3′hExo) and uridylated by terminal uridylyl transferase 7. This process creates uridylated intermediates—some of which are more common in the cell than expected. It is unknown how this trimming and uridylation affects the binding interactions between the stem-loop and its protein binding partners, the stem-loop binding protein (SLBP) and 3′hExo. In this work, we characterized the binding interactions of a wild-type stem-loop, a uridylated intermediate, and a truncated stem-loop using a combination of experimental and computational biophysical techniques. The uridylated intermediate represents one of the most prominent degradation intermediates identified in the cell, and the truncated stem-loop represents the stem-loop post-trimming and pre-uridylation. Through native electrophoretic mobility shift assays, we show that SLBP and 3′hExo are able to bind both the uridylated intermediate and the truncated stem-loop despite 3′ end modification. We also performed molecular dynamics simulations (1 µs) to evaluate structural changes induced by stem-loop modification and to understand how these changes impact SLBP and 3′hExo binding. RNA-protein systems were generated by applying AMBER force fields to modified versions of the histone mRNA ternary complex crystal structures (PDB 4QOZ and 4L8R). This work shows that modification of the stem-loop through trimming and uridylation does not interfere with the tertiary structure of the ternary complex.

An Essential Role for the RNA Editor-Exonuclease Axis in Terminal Erythroid Differentiation

Erythropoiesis is an intricate process by which lineage-committed erythroid progenitors become mature red blood cells. Reticulocytes are terminal-staged, immature red blood cells with residual RNA after enucleation. In the absence of pathology, reticulocytes are efficiently processed into mature red blood cells and typically represent a small percentage of cells in human peripheral blood. In contrast, when differentiated in vitro from pluripotent stem cells or CD34+ progenitor cells, red cells tend to arrest at the reticulocyte stage. Recent studies have highlighted that uridylation by Terminal Uridylyl Transferases (TUTases) occurs on a broad spectrum of RNA classes in mammalian cells. Oligo-uridylated RNA is recognized by exoribonucleases and targeted for decay. We posited that the machinery behind RNA degradation that accompanies terminal erythropoiesis might involve RNA tail editors coupled to exonuclease activity. Utilizing constitutional murine knockout models, we observed that blood from the TUTase Zcchc6 RNA editor knockout embryos exhibited reticulocytosis and a terminal maturation defect, as documented by FACS, histology, and hematological profiling. Murine strains deficient in the downstream exonuclease Dis3l2 phenocopied the RNA decay defect of the Zcchc6 KO. Conditional knockout murine models of the TUTase-Dis3l2 axis driven by the red cell specific Erythropoietin Receptor-Cre exhibited comparable phenotypes, suggesting a cell intrinsic and niche-independent role for the TUTase-Dis3l2 axis in promoting red blood cell maturation. We are modulating the expression of this axis by various methods to optimize modeling of hemoglobinopathies such as sickle cell anemia. Disclosures No relevant conflicts of interest to declare.

USP15 Deubiquitinates TUT1 Associated with RNA Metabolism and Maintains Cerebellar Homeostasis.

Precise regulation of RNA metabolism is crucial for dynamic gene expression and controlling cellular functions. In the nervous system, defects in RNA metabolism are implicated in the disturbance of brain homeostasis and development. Here, we report that deubiquitinating enzyme, ubiquitin specific peptidase 15 (USP15), deubiquitinates terminal uridylyl transferase 1 (TUT1) and changes global RNA metabolism. We found that the expression of USP15 redistributes TUT1 from the nucleolus to nucleoplasm, resulting in the stabilization of U6 snRNA. We also found that lack of the Usp15 gene induces an impairment in motor ability with an unconventional cerebellar formation. Moreover, inhibition of the USP15-TUT1 cascade triggered mild and chronic endoplasmic reticulum (ER) stress. Therefore, our results suggest that USP15 is crucial for mRNA metabolism and maintains a healthy brain. These findings provide a possibility that disturbance of the USP15-TUT1 cascade induces chronic and mild ER stress, leading to an acceleration of the neurodegenerative phenotype.