Engineering Toolkit Research Articles

Estimation of Reservoir Storage Capacity Using the Gould-Dincer Formula with the Aid of Possibility Theory

This paper presents a method for estimating reservoir storage capacity using the Gould–Dincer normal formula (G-DN), enhanced by the possibility theory. The G-DN equation is valuable for regional studies of reservoir reliability, particularly under climate change scenarios, using regional statistics. However, because the G-DN formula deals with measured data, it introduces a degree of uncertainty and fuzziness that traditional probability theory struggles to address. Possibility theory, an extension of fuzzy set theory, offers a suitable framework for managing this uncertainty and fuzziness. In this study, the G-DN formula is adapted to incorporate fuzzy logic, and the possibilistic nature of reservoir capacity is translated into a probabilistic framework using α-cuts from the possibility theory. These α-cuts approximate probability confidence intervals with high confidence. Applying the proposed methodology, in the present crisp case with the storage capacity D = 0.75, the value of the capacity C was found to be 1271×106 m3, and that for D = 0.5 was 634.5×106 m3. On the other hand, in the fuzzy case using the possibility theory, the value of the capacity for D = 0.75 is the internal [315,5679]×106 m3 and for D = 0.5 the value is interval [158,2839]×106 m3, with a probability of ≥95% and a risk level of α = 5% for both cases. The proposed approach could be used as a robust tool in the toolkit of engineers working on irrigation, drainage, and water resource projects, supporting informed and effective engineering decisions.

Quantitative and spatially resolved detection of multiplexed microRNA from plant tissue via hybridization to hydrogel-bound DNA probes in nanoliter well arrays

Understanding complex regulatory networks in plant systems requires elucidating the roles of various gene regulators under a spatial landscape. MicroRNA are key regulators that impart high information value through their tissue specificity and stability when using expression patterns for evaluating network outcomes. However, current techniques that utilize spatial multiplexing and quantitation of microRNA are limited to primarily mammalian systems. Here, we present a method to spatially resolve and quantify multiple endogenous microRNA in situ using ethanol fixed, paraffin embedded model plant species. This method utilizes target-specific microRNA capture along with universal ligating and labelling, all within functionalized hydrogel posts containing DNA probes in nanoliter well arrays. We demonstrate the platform’s multiplexing capabilities through analyzing three endogenous microRNA in Arabidopsis thaliana rosettes which provide useful answers to fundamental plant growth and development from the unique expression patterns. The spatial tissue technique is also validated using non-spatial small RNA assays to demonstrate the versatility of the well array platform. Our new platform expands the toolkit of spatial omics technologies for plants.

Key performance indicators and benchmarks in MCI prehospital response using technological tools: a qualitative study assessing the perception of practitioners and tool developers.

The aim of this study is to investigate the opinions and perspectives of The Novel Integrated Toolkit for Enhanced Prehospital Life Support and Triage in Challenging and Large Emergencies (NIGHTINGALE) end-users and tool developers regarding Key Performance Indicators (KPIs) and benchmarks that assess the prehospital response to Mass Casualty Incidents (MCIs) enhanced by the NIT-MR. A qualitative study employing focus group discussions was conducted to collect opinions and perspectives of end-users and tool developers regarding KPIs and benchmarks in MCI response using the NIT-MR. The criteria considered for the selection and distribution of participants within the groups was the nature of their involvement within the NIGHTINGALE project and their familiarity with the tools to be discussed. Thirty-one participants from different countries were included. Four themes emerged during data analysis which are: definition/explanation is the personal understanding of participants of the term KPI, process of KPI development and relationship with User Requirements is the decision process for assigning KPIs to user requirements, benchmarking is the mental process of associating a benchmark to a KPI or for developing a benchmark, and technical/medical gap is the gap of understanding between each sides' fields. This study emphasized the need for a structured approach to using KPIs and bridging the gap between technological and medical worlds, taking the NIGHTINGALE project, funded by the European Union, which aims to develop a technological toolkit for first responders in mass casualty incidents as an example. These insights are crucial for enhancing disaster response.

Advances in Engineering Toolkits for Construction of Ultralow Disordered Van der Waals Heterostructures

AbstractThe exploration of emerging quantum phenomena by stacking dissimilar atomic layered materials into van der Waals (vdW) heterostructures has driven the development of layer assembly techniques. Achieving ultralow disorder within these heterostructures is crucial for unlocking their novel physical properties. However, current fabrication methods for designer heterostructures have limitations in throughput, yield, and scalability. Over the past decade, engineering toolkits have evolved to address some of these challenges, but their adoption for fabricating designer heterostructures remains limited. In this review, an overview of these emerging engineering toolkits is provided, and examine their utility and limitations in achieving ultralow disordered heterostructures. It is hoped that the insights from this review article can help guide future research directions on advancing the fabrication process of designer heterostructures.

Modular Multiwell Viscoelastic Hydrogel Platform for Two- and Three-Dimensional Cell Culture Applications.

Hydrogels have gained significant popularity as model platforms to study reciprocal interactions between cells and their microenvironment. While hydrogel tools to probe many characteristics of the extracellular space have been developed, fabrication approaches remain challenging and time-consuming, limiting multiplexing or widespread adoption. Thus, we have developed a modular fabrication approach to generate distinct hydrogel microenvironments within the same 96-well plate for increased throughput of fabrication as well as integration with existing high-throughput assay technologies. This approach enables in situ hydrogel mechanical characterization and is used to generate both elastic and viscoelastic hydrogels across a range of stiffnesses. Additionally, this fabrication method enabled a 3-fold reduction in polymer and up to an 8-fold reduction in fabrication time required per hydrogel replicate. The feasibility of this platform for two-dimensional (2D) cell culture applications was demonstrated by measuring both population-level and single-cell-level metrics via microplate reader and high-content imaging. Finally, a 96-well hydrogel array was utilized for three-dimensional (3D) cell culture, demonstrating the ability to support high cell viability. Together, this work demonstrates a versatile and easily adaptable fabrication approach that can support the ever-expanding tool kit of hydrogel technologies for cell culture applications.

Abstract 6773: Tissue engineered colorectal cancer microspheres for drug screening

Abstract Three-dimensional (3D) disease models have garnered widespread interest for use in later stages of the drug discovery process, such as preclinical efficacy and toxicology studies, due to their pathophysiologically relevant properties. However, there is a need and opportunity for 3D cancer models to be used earlier in the drug screening process. To meet this need, the 3D models must strike a balance between throughput, which includes scalability and uniformity, and physiological relevance, such as the ability to modulate key attribute of the tumor microenvironment. Here we report the creation of 3D colorectal cancer (CRC) tissue models, referred to as VivoSpheres, and demonstrated their relevance to cancer drug screening. The VivoSphere production platform couples tissue engineering toolkits with microfluidics, enabling the scalable production of engineered cancer microspheres. The model supports the long-term maintenance of the cancer cell phenotype. In a preliminary study, we were able to generate more physiologically relevant drug responses. We formed CRC VivoSpheres by encapsulating HT-29 CRC cells within poly(ethylene glycol)-fibrinogen hydrogel microspheres using our previously developed microfluidic platform. CRC VivoSpheres were rapidly produced with high cell densities (20 × 106 cells/ml) and high uniformity on day 0 with a coefficient of variation (COV) < 7%. This high uniformity was maintained for 15 days (COV ≤ 10%), which is critical for long-term dose studies. The cells maintained high viability and showed high proliferative capability with a significant increase in colony size and expression of Ki67 up to day 29. The encapsulated cells maintained the CRC phenotype over time with the expression of CD44 (cancer stem cell marker) and CK20 (CRC marker). After establishing shipping conditions that maintained cell viability for remote use, the HT-29 VivoSpheres were shipped to the oncology team at Southern Research for drug testing. The CRC VivoSpheres were treated with DMSO, GANT61, and SRI-38832, the latter two of which are GLI1 inhibitors. Phase contrast images and western blot were used to assess the response of CRC VivoSpheres to the treatments. Oncogenic GLI1 transcription activity and NBS1 overexpression have been found to contribute to chemotherapeutic resistance, negating the anti-tumor effects of 5-fluorouracil. While 2D cultured HT-29s responded to treatment with GANT61, HT-29 VivoSpheres continued to express NBS1 following GANT1 treatment, but downregulated NBS1 in response to the GLI1 inhibitor SRI-38832, which is the same response Southern Research has seen in in vivo tumor models. In conclusion, we have developed tissue-engineered 3D CRC models that hold promise for use in drug screening. These models have demonstrated an initial capability to reproduce the CRC phenotype and mimic in vivo drug response. Citation Format: Yuan Tian, Mohammadjafar Hashemi, Benjamin Anbiah, Ruowen Zhang, Iman Hassani, Rebecca Boohaker, Elizabeth Lipke. Tissue engineered colorectal cancer microspheres for drug screening [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6773.

Facile construction of dual-response super-resolution probes for tracking organelles dynamics.

Super-resolution imaging techniques, such as structured illumination microscopy (SIM), have enabled researchers to obtain nanoscale organelle-level outputs in living systems, but they impose additional stringent requirements on fluorescence probes. However, high-performance, custom-designed SIM probes that can explain underlying biological processes remain unavailable. Herein, a customizable engineering toolkit is developed for the facile assembly of SIM probes suitable for subcellular component detection. This toolkit is used to customize a fluorescent molecule, CPC (coumarin-phenylhydrazine-carboxyl), capable of simultaneously monitoring peroxynitrite (ONOO-) and polarity distribution in mitochondria and lipid droplets (LDs), respectively, through functional ON-OFF mechanisms. The customized CPC molecule demonstrated excellent imaging capabilities under SIM, enabled the successful localization of multiple organelles, and reliably tracked the distribution of different components, thus facilitating the study of the interplay between organelles. Using CPC, the physical transition of intracellular LDs is demonstrated from heterogeneity to homogeneity. This was specifically observed during ferroptosis where the polarity of the LDs increased and their morphology became more contracted. Furthermore, the loss of LDs functionality could not counteract the accumulation of ONOO- within the mitochondria, leading to the decoupling of mitochondrial LDs during ferroptosis. These results confirmed the potential mechanism of LDs dysfunction and decoupling triggered via cumulative mitochondrial oxidative stress during ferroptosis. To summarize, this toolkit will be a powerful tool for examining subtle variations among components during the interplay between different organelles, thus offering novel avenues for understanding and treating related diseases.

GMOCU: Digital Documentation, Management, and Biological Risk Assessment of Genetic Parts.

The continuous evolution of molecular biology and gene synthesis methods paired with an ever-increasing potential of synthetic biology approaches and genome engineering toolkits enables the rapid design of genetic bioparts and genetically modified organisms. Although various software solutions assist with specific design tasks and challenges, lab internal documentation and ensuring compliance with governmental regulations on biosafety assessment of the generated organisms remain the responsibility of individual academic researchers. This results in inconsistent and redundant documentation regimes and a significant time and labor burden. GMOCU (GMO documentation) is a standardized semi-automatic user-oriented software approach -written in Python and freely available- that unifies lab internal data documentation on genetic parts and genetically modified organisms (GMOs). It automatizes biological risk evaluations and maintains a shared up-to-date inventory of bioparts for team-wide data navigation and sharing. GMOCU further enables data export into customizable formats suitable for scientific publications, official biosafety documents, and the research community.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Safety assessment of five candidate probiotic lactobacilli using comparative genome analysis.

Micro-organisms belonging to the Lactobacillus genus complex are often used for oral consumption and are generally considered safe but can exhibit pathogenicity in rare and specific cases. Therefore, screening and understanding genetic factors that may contribute to pathogenicity can yield valuable insights regarding probiotic safety. Limosilactobacillus mucosae LM1, Lactiplantibacillus plantarum SK151, Lactiplantibacillus plantarum BS25, Limosilactobacillus fermentum SK152 and Lactobacillus johnsonii PF01 are current probiotics of interest; however, their safety profiles have not been explored. The genome sequences of LM1, SK151, SK152 and PF01 were downloaded from the NCBI GenBank, while that of L. plantarum BS25 was newly sequenced. These genomes were then annotated using the Rapid Annotation using Subsystem Technology tool kit pipeline. Subsequently, a command line blast was performed against the Virulence Factor Database (VFDB) and the Comprehensive Antibiotic Resistance Database (CARD) to identify potential virulence factors and antibiotic resistance (AR) genes. Furthermore, ResFinder was used to detect acquired AR genes. The query against the VFDB identified genes that have a role in bacterial survivability, platelet aggregation, surface adhesion, biofilm formation and immunoregulation; and no acquired AR genes were detected using CARD and ResFinder. The study shows that the query strains exhibit genes identical to those present in pathogenic bacteria with the genes matched primarily having roles related to survival and surface adherence. Our results contribute to the overall strategies that can be employed in pre-clinical safety assessments of potential probiotics. Gene mining using whole-genome data, coupled with experimental validation, can be implemented in future probiotic safety assessment strategies.

Artificial intelligence in the food industry

The growth of the planet’s population requires the application of innovative technological solutions for its nutrition. Artificial intelligence, as part of the technological toolkit of Industry 4.0, having a strong transforming effect in modern society, is perceived as a strategic factor for increasing productivity, efficiency and innovation in a number of sectors, including the food industry. The global food and beverage artificial intelligence market in 2021 is valued at USD 4.49 billion. It is expected to grow at a CAGR (average annual rate) of 45.4% to reach US$ 83.4 billion by 2029. The main goal of every industrial enterprise in the food industry is to produce high-quality products at the lowest possible cost. The application of AI can contribute to maintaining a higher quality of the manufactured product, through rapid quality control and visualization of the result. AI can aggregate and analyze data in real-time making recommendations to improve operational activities, can analyze data, uncover trends and recommend actions to increase efficiency. The result of the implementation of artificial intelligence in the food industry contributes to driving the growth of the market.

Leveraging the Features of Multimedia Technologies in Enhancing Vocabulary Learning

Nowadays, the use of technology has become essentially important in language learning. In addition, language teachers must possess a technological toolkit of applications, websites, and multimedia applications that can help save time and provide variability and flexibility to engage learners with any material that they study. This study aims to provide innovative methods for learning English vocabulary by leveraging the features and advantages of multimedia technologies. The different tools and technologies will be presented to enable effective vocabulary development for learners and equip teachers with high-level assistive technologies.

The effectiveness of the use of a technology toolkit on activities and mother-child interactions: children with complex care needs

Purpose Meaningful interactions with significant others are crucial for children’s well-being, including those with severe to profound intellectual and multiple disabilities. This study aimed to gain more insight into the potential of an ICT-Toolkit in enhancing or contributing to the interaction between parents and their children with complex care needs. Methods A multiple case study with an AB experimental design was conducted. Four mother-child dyads were observed during eight two-and-a-half-hour home visits. Children between 6 and 16 years with severe to profound intellectual and multiple disabilities were included. A participatory research observation approach was used. Results Using the ICT-Toolkit compared to the baseline phase stimulated a decrease in the repetitive activities of two of the four dyads. Overall, the activity repertoire of the children and the length of time being engaged in individual activities increased, and the activities together increased in three of the dyads. There were more turn-taking interactions; the children took more initiative to engage their mother in their activity, and the children exhibited more affection when engaging with the ICT-Toolkit items. Three mothers followed their children more in their play, and all mothers were more verbally and physically active in instructing and/or motivating their children. Discussion All mothers noticed their child’s “new” behaviour when interacting with an ICT-Toolkit item. The mothers followed the child’s lead when engaged with the ICT-Toolkit. The ICT-Toolkit’s added effect may be due to the predictability, uncomplicated and highly perceivable stimuli it provides with minimal effort and maximum effect.

Overexpression of the F116V allele of CYP9A186 in transgenic Helicoverpa armigera confers high-level resistance to emamectin benzoate

Insect cytochrome P450s play important roles in the detoxification of xenobiotics and the metabolic resistance to insecticides. However, the approach for in vivo validation of the contribution of specific candidate P450s to resistance is still limited in most non-model insect species. Previous studies with heterologous expression and in vitro functional assays have confirmed that a natural substitution (F116V) in the substrate recognition site 1 (SRS1) of the CYP9A186 of Spodoptera exigua is a gain-of-function mutation, which results in detoxification capability of and thus high-level resistance to both emamectin benzoate (EB) and abamectin. In this study, we established an effective piggyBac-based transformation system in the serious agricultural pest Helicoverpa armigera and overexpressed in vivo a resistance P450 allele, CYP9A186-F116V, from another lepidopteran pest Spodoptera exigua. Bioassays showed that transgenic H. armigera larvae expressing CYP9A186-F116V obtained 358-fold and 38.6-fold resistance to EB and abamectin, respectively. In contrast, a transgenic line of Drosophila melanogaster overexpressing this P450 variant only confers ∼20-fold resistance to the two insecticides. This bias towards the resistance level revealed that closely related species might provide a more appropriate cellular environment for gene expression and subsequent toxicokinetics of insecticides. These results not only present an alternative method for in vivo functional characterization of P450s in H. armigera and other phylogenetically close species but also provide a valuable genetic engineering toolkit for the genetic manipulation of H. armigera.

Development of a counterselectable system for rapid and efficient CRISPR-based genome engineering in Zymomonas mobilis

BackgroundZymomonas mobilis is an important industrial bacterium ideal for biorefinery and synthetic biology studies. High-throughput CRISPR-based genome editing technologies have been developed to enable targeted engineering of genes and hence metabolic pathways in the model ZM4 strain, expediting the exploitation of this biofuel-producing strain as a cell factory for sustainable chemicals, proteins and biofuels production. As these technologies mainly take plasmid-based strategies, their applications would be impeded due to the fact that curing of the extremely stable plasmids is laborious and inefficient. Whilst counterselection markers have been proven to be efficient for plasmid curing, hitherto only very few counterselection markers have been available for Z. mobilis.ResultsWe constructed a conditional lethal mutant of the pheS gene of Z. mobilis ZM4, clmPheS, containing T263A and A318G substitutions and coding for a mutated alpha-subunit of phenylalanyl-tRNA synthetase to allow for the incorporation of a toxic analog of phenylalanine, p-chloro-phenylalanine (4-CP), into proteins, and hence leading to inhibition of cell growth. We demonstrated that expression of clmPheS driven by a strong Pgap promoter from a plasmid could render the Z. mobilis ZM4 cells sufficient sensitivity to 4-CP. The clmPheS-expressing cells were assayed to be extremely sensitive to 0.2 mM 4-CP. Subsequently, the clmPheS-assisted counterselection endowed fast curing of genome engineering plasmids immediately after obtaining the desired mutants, shortening the time of every two rounds of multiplex chromosome editing by at least 9 days, and enabled the development of a strategy for scarless modification of the native Z. mobilis ZM4 plasmids.ConclusionsThis study developed a strategy, coupling an endogenous CRISPR-based genome editing toolkit with a counterselection marker created here, for rapid and efficient multi-round multiplex editing of the chromosome, as well as scarless modification of the native plasmids, providing an improved genome engineering toolkit for Z. mobilis and an important reference to develope similar genetic manipulation systems in other non-model organisms.

Rebooting simulation

Computer simulation has been in the toolkit of industrial engineers for over 50 years and its value has been enhanced by advances in research, including both modeling and analysis, and in application software, both commercial and open source. However, “advances” are different from paradigm shifts. Motivated by big data, big computing and the big consequences of model-based decisions, it is time to reboot simulation for industrial engineering.

The development of a Modular Accessible Musical Instrument Technology Toolkit using action research

Within the field of digital musical instruments, there have been a growing number of technological developments aimed at addressing the issue of accessibility to music-making for disabled people. This study summarizes the development of one such technological system—The Modular Accessible Musical Instrument Technology Toolkit (MAMI Tech Toolkit). The four tools in the toolkit and accompanying software were developed over 5 years using an action research methodology. A range of stakeholders across four research sites were involved in the development. This study outlines the methodological process, the stakeholder involvement, and how the data were used to inform the design of the toolkit. The accessibility of the toolkit is also discussed alongside findings that have emerged from the process. This study adds to the established canon of research around accessible digital musical instruments by documenting the creation of an accessible toolkit grounded in both theory and practical application of third-wave human–computer interaction methods. This study contributes to the discourse around the use of participatory and iterative methods to explore issues with, and barriers to, active music-making with music technology. Outlined is the development of each of the novel tools in the toolkit, the functionality they offer, as well as the accessibility issues they address. The study advances knowledge around active music-making using music technology, as well as in working with diverse users to create these new types of systems.

How to Engineer eLearning: An evidence-based human-centered design process for modern times

This review highlights Learning Engineering Toolkit: Evidenced-based Practices from The Learning Sciences, Instructional Design, and Beyond edited by Jim Goodell and Janet Kolodner. Learning Engineering Toolkit serves as a detailed field guide to the collaborative and interdisciplinary aspects of learning engineering. Using an e-Learning and instructional design perspective, this review critically examines the core of the book's message; a foundational definition for learning engineering; and associated themes, strategies, and tools used to illuminate this promising field.

Accessing marginalized musics through adaptable, culturally sustaining music technology modules

Black music technology has innovated across genres such as dub, hip hop, techno and Afrobeats, redefining music as we know it. Music research subfields (performance, composition, musicology, technology) have historically excluded black musics but music education has begun to include them. Critical Sonic Practice Lab created a culturally-sustaining music technology toolkit and modules in Accra, Ghana. We exploit music technology’s constant evolution, engaging critical sonic practice’s intersectional approaches to the continuum of improvisation and composition, and music theory. Adjusting teaching resources for students with less finances and internet access can give access to STEAM (science, technology, arts and mathematics) and music creation. We recenter Black, Latinx and Indigenous musics and participatory music practices to expand music creation. Therefore, this research design offers a series of decolonizing music technology and creation prompts to adapt with local music practitioners as teaching-artists for community-specific teaching and learning.

(Invited) Using the Model Bacterium Geobacter Sulfurreducens to Understand Microbial Electrochemical Conversion of Nitrogen Gas into Ammonium

There is a growing need to decrease reliance on the Haber-Bosch process. To convert nitrogen gas (N2) into ammonia (NH3) for fertilizers, this temperature- and pressure-intensive process consumes roughly 2–3% of global energy and releases over 740 million tons of CO2 each year. Many microorganisms naturally convert or “fix” N2 into ammonium (NH4 +) at room temperature and pressure using an enzyme called the nitrogenase. Attempts to increase NH4 + yields from microorganisms through genetic engineering are seeing signs of success, but we lack methods to increase NH4 + generation rates and overcome one of the largest challenges: O2 gas. Increasing O2 gas concentrations typically increases metabolic rates of aerobic microorganisms; however, in the case of microorganisms that fix N2 (called diazotrophs), O2 can shut down the nitrogenase and stop cell growth. To overcome these challenges, we are using electricity to drive N2 fixation in exoelectrogenic bacteria. These bacteria have the unique ability to naturally transfer electrons to anode electrodes in microbial electrochemical technologies (METs). Increasing the voltage applied to METs increases the metabolic rates of exoelectrogens. The anode chamber is kept anaerobic, which eliminates O2-driven inhibition of the nitrogenase. We previously showed that the N2 fixation rates of a mixed microbial community in a MET increased more than three times when the applied whole-cell potential increased from 0.7 V to 1.0 V. By adding a chemical inhibitor that prevented the incorporation of NH4 + into larger biomolecules, NH4 + was excreted by the cells and into the medium. Based on the acetylene reduction assay (a proxy for N2 fixation), we estimated that we recovered about 10% of the theoretical NH4 +generated by the cells. If close to 100% of the theoretical NH4 + could be excreted from the cells and recovered, we predicted an energy demand of around 3 MJ/mol-NH4 +, which is close to the range of value reported for the Haber-Bosch process. To develop METs that generate NH4 + at competitive production rates and energy demands, we are now focusing on the model exoelectrogenic diazotroph Geobacter sulfurreducens. Using a single organism with a fully sequenced genome allows us to understand how the N2 fixation process responds to electrochemical variables. Towards these efforts, we conducted a transcriptomic analysis of G. sulfurreducens at two fixed anode potentials: +0.15 V and −0.15 V. This approach revealed which genes are turned on and off in response to these potentials. The presence of NH4 + decreased the expression of genes associated with N2 fixation which was expected due to the known sensitivity of nitrogenases to NH4 +. On the other hand, the two anode potentials had a dramatic and unexpected impact on the expression levels of N2 fixation genes. At −0.15 V, nitrogenase genes were significantly up-regulated, as were genes associated with NH4 + uptake and transport, such as glutamine and glutamate synthetases. Considering that −0.15 V provides less energy to the cells relative to +0.15 V (based on thermodynamic predictions), the results suggest that the cells responded to this highly energy-constrained environment by increasing expression of N2 fixation pathways. Based on our new knowledge of how G. sulfurredcuens regulates N2 fixation and NH4 + production, we have developed new strains of G. sulfurreducens that can excrete NH4 + during N2 fixation. The new engineering toolkit that we have created in this bacterium can now be leveraged to maximize NH4 + production in METs.