Tandem Direct Repeats Research Articles

Peptides from conserved tandem direct repeats of SHORT-LEAF regulate gametophore development in moss P. patens.

Tandem direct repeat (TDR)-containing proteins, present across all domains of life, play crucial roles in plant development and defense mechanisms. Previously, we identified that disruption of a bryophyte-specific protein family, SHORT-LEAF (SHLF), possessing the longest reported TDRs, is the cause of the shlf mutant phenotype in Physcomitrium patens. shlf exhibits reduced apical dominance, altered auxin distribution, and 2-fold shorter leaves. However, the molecular role of SHLF was unclear due to the absence of known conserved domains. Through a series of protein domain deletion analyses, here, we demonstrate the importance of the signal peptide and the conserved TDRs and report a minimal functional protein (miniSHLF) containing the N-terminal signal peptide and first two TDRs (N-TDR1-2). We also demonstrate that SHLF behaves as a secretory protein and that the TDRs contribute to a pool of secreted peptides essential for SHLF function. Further, we identified that the mutant secretome lacks SHLF peptides, which are abundant in WT and miniSHLF secretomes. Interestingly, shlf mutants supplemented with the secretome or peptidome from WT or miniSHLF showed complete or partial phenotypic recovery. Transcriptomic and metabolomic analyses revealed that shlf displays an elevated stress response, including high ROS activity and differential accumulation of genes and metabolites involved in the phenylpropanoid pathway, which may affect auxin distribution. The TDR-specific synthetic peptide SHLFpep3 (INIINAPLQGFKIA) also rescued the mutant phenotypes, including the altered auxin distribution, in a dosage-dependent manner and restored the mutant's stress levels. Our study shows that secretory SHLF peptides derived from conserved TDRs regulate moss gametophore development.

Ribosomal intergenic spacers are filled with transposon remnants.

Eukaryotic ribosomal DNA (rDNA) comprises tandem units of highly-conserved coding genes separated by rapidly-evolving spacer DNA. The spacers of all 12 species examined were filled with short direct repeats (DRs) and multiple long tandem repeats (TRs), completing the rDNA maps that previously contained unannotated and inadequately studied sequences. The external transcribed spacers also were filled with DRs and some contained TRs. We infer that the spacers arose from transposon insertion, followed by their imprecise excision, leaving short DRs characteristic of transposon visitation. The spacers provided a favored location for transposon insertion because they occupy loci containing hundreds to thousands of gene repeats. The spacers' primary cellular function may be to link one rRNA transcription unit to the next, whereas transposons flourish here because they have colonized the most frequently-used part of the genome.

Tandem repeats in giant archaeal Borg elements undergo rapid evolution and create new intrinsically disordered regions in proteins.

Borgs are huge, linear extrachromosomal elements associated with anaerobic methane-oxidizing archaea. Striking features of Borg genomes are pervasive tandem direct repeat (TR) regions. Here, we present six new Borg genomes and investigate the characteristics of TRs in all ten complete Borg genomes. We find that TR regions are rapidly evolving, recently formed, arise independently, and are virtually absent in host Methanoperedens genomes. Flanking partial repeats and A-enriched character constrain the TR formation mechanism. TRs can be in intergenic regions, where they might serve as regulatory RNAs, or in open reading frames (ORFs). TRs in ORFs are under very strong selective pressure, leading to perfect amino acid TRs (aaTRs) that are commonly intrinsically disordered regions. Proteins with aaTRs are often extracellular or membrane proteins, and functionally similar or homologous proteins often have aaTRs composed of the same amino acids. We propose that Borg aaTR-proteins functionally diversify Methanoperedens and all TRs are crucial for specific Borg-host associations and possibly cospeciation.

Borgs are giant genetic elements with potential to expand metabolic capacity

Anaerobic methane oxidation exerts a key control on greenhouse gas emissions1, yet factors that modulate the activity of microorganisms performing this function remain poorly understood. Here we discovered extraordinarily large, diverse DNA sequences that primarily encode hypothetical proteins through studying groundwater, sediments and wetland soil where methane production and oxidation occur. Four curated, complete genomes are linear, up to approximately 1 Mb in length and share genome organization, including replichore structure, long inverted terminal repeats and genome-wide unique perfect tandem direct repeats that are intergenic or generate amino acid repeats. We infer that these are highly divergent archaeal extrachromosomal elements with a distinct evolutionary origin. Gene sequence similarity, phylogeny and local divergence of sequence composition indicate that many of their genes were assimilated from methane-oxidizing Methanoperedens archaea. We refer to these elements as ‘Borgs’. We identified at least 19 different Borg types coexisting with Methanoperedens spp. in four distinct ecosystems. Borgs provide methane-oxidizing Methanoperedens archaea access to genes encoding proteins involved in redox reactions and energy conservation (for example, clusters of multihaem cytochromes and methyl coenzyme M reductase). These data suggest that Borgs might have previously unrecognized roles in the metabolism of this group of archaea, which are known to modulate greenhouse gas emissions, but further studies are now needed to establish their functional relevance.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

The unique bryophyte-specific repeat-containing protein SHORT-LEAF regulates gametophore development in moss.

Convergent evolution of shoot development across plant lineages has prompted numerous comparative genetic studies. Though functional conservation of gene networks governing flowering plant shoot development has been explored in bryophyte gametophore development, the role of bryophyte-specific genes remains unknown. Previously, we have reported Tnt1 insertional mutants of moss defective in gametophore development. Here, we report a mutant (short-leaf; shlf) having two-fold shorter leaves, reduced apical dominance, and low plasmodesmata frequency. UHPLC-MS/MS-based auxin quantification and analysis of soybean (Glycine max) auxin-responsive promoter (GH3:GUS) lines exhibited a striking differential auxin distribution pattern in the mutant gametophore. Whole-genome sequencing and functional characterization of candidate genes revealed that a novel bryophyte-specific gene (SHORT-LEAF; SHLF) is responsible for the shlf phenotype. SHLF represents a unique family of near-perfect tandem direct repeat (TDR)-containing proteins conserved only among mosses and liverworts, as evident from our phylogenetic analysis. Cross-complementation with a Marchantia homolog partially recovered the shlf phenotype, indicating possible functional specialization. The distinctive structure (longest known TDRs), absence of any known conserved domain, localization in the endoplasmic reticulum, and proteolytic cleavage pattern of SHLF imply its function in bryophyte-specific cellular mechanisms. This makes SHLF a potential candidate to study gametophore development and evolutionary adaptations of early land plants.

Fanconi Anemia and Ataxia Telangiectasia in Siblings who Inherited Unique Combinations of Novel FANCA and ATM Null Mutations.

A unique consanguineous family with 2 genomic instability disorders, Fanconi anemia and ataxia telangiectasia, revealed exceptional combinations of null mutations in the FANCA and ATM genes. Two siblings with Fanconi anemia had novel homozygous consecutive microdeletions (c.1361-1370delCCTCCTTTGG, c.1374delC) adjoined to upstream 65 nucleotide direct tandem repeats and deletion hotspot motifs in the FANCA gene. The sibling with ataxia telangiectasia revealed a homozygous p.Arg2993Stop (c.8977C>T) null mutation in the ATM gene. All patients were also heterozygous for the opposite mutations without any additional clinical or laboratory manifestations. Double heterozygote parents did not present any clinical symptoms suggestive of the 2 disorders.

Plasticity in oligomerization, operator architecture, and DNA binding in the mode of action of a bacterial B12-based photoreceptor

Newly discovered bacterial photoreceptors called CarH sense light by using 5'-deoxyadenosylcobalamin (AdoCbl). They repress their own expression and that of genes for carotenoid synthesis by binding in the dark to operator DNA as AdoCbl-bound tetramers, whose light-induced disassembly relieves repression. High-resolution structures of Thermus thermophilus CarHTt have provided snapshots of the dark and light states and have revealed a unique DNA-binding mode whereby only three of four DNA-binding domains contact an operator comprising three tandem direct repeats. To gain further insights into CarH photoreceptors and employing biochemical, spectroscopic, mutational, and computational analyses, here we investigated CarHBm from Bacillus megaterium We found that apoCarHBm, unlike monomeric apoCarHTt, is an oligomeric molten globule that forms DNA-binding tetramers in the dark only upon AdoCbl binding, which requires a conserved W-X9-EH motif. Light relieved DNA binding by disrupting CarHBm tetramers to dimers, rather than to monomers as with CarHTt CarHBm operators resembled that of CarHTt, but were larger by one repeat and overlapped with the -35 or -10 promoter elements. This design persisted in a six-repeat, multipartite operator we discovered upstream of a gene encoding an Spx global redox-response regulator whose photoregulated expression links photooxidative and general redox responses in B. megaterium Interestingly, CarHBm recognized the smaller CarHTt operator, revealing an adaptability possibly related to the linker bridging the DNA- and AdoCbl-binding domains. Our findings highlight a remarkable plasticity in the mode of action of B12-based CarH photoreceptors, important for their biological functions and development as optogenetic tools.

Agrobacterium-Mediated Transformation in the Evolution of Plants.

In most cases, the genetic engineering of plants uses Agrobacterium-mediated transformation to introduce novel genes. In nature, insertion of T-DNA into the plant genome and its subsequent transfer via sexual reproduction have been shown for several species in the genera Nicotiana, Ipomoea , and Linaria . A sequence homologous to T-DNA of the Ri plasmid of Agrobacterium rhizogenes was found in the genome of wild-type Nicotiana glauca (section Noctiflorae) more than 30years ago and was named "cellular T-DNA" (cT-DNA). It comprises an imperfect inverted repeat and contains homologs of several T-DNA oncogenes (NgrolB, NgrolC, Ngorf13, Ngorf14) and an opine synthesis gene (Ngmis). Multiple cT-DNAs have also been found in species of the sections Tomentosae and Nicotiana of the genus Nicotiana. These ancient cT-DNA genes are still expressed, indicating that they may play a role in the evolution of these plants. In 2012-2013, cT-DNA was detected and characterized in Linaria vulgaris and L. genistifolia ssp. dalmatica. Their cT-DNA is present in two copies and organized as an imperfect direct tandem repeat, containing LvORF2, LvORF3, LvORF8, LvrolA, LvrolB, LvrolC, LvORF13, LvORF14, and the Lvmis genes. In 2015, cT-DNA was found in Ipomoea. Two types of T-DNA-like sequences were described within this genera, and their distribution varied among cultured hexaploid, tetraploid, and wild diploid forms. Thus, several independent T-DNA integration events occurred in the genomes of these three plant genera. We propose that the events of T-DNA insertion in the plant genome might have affected their evolution, resulting in the creation of new plant species. In this chapter, we focus on the structure and functions of cT-DNA in Linaria, Nicotiana, and Ipomoea and discuss their possible evolutionary role.

Application of Graph Entropy in CRISPR and Repeats Detection in DNA Sequences

We analyzed DNA sequences using a new measure of entropy. The general aim was to analyze DNA sequences and find interesting sections of a genome using a new formulation of Shannon like entropy. We developed this new measure of entropy for any non-trivial graph or, more broadly, for any square matrix whose non-zero elements represent probabilistic weights assigned to connections or transitions between pairs of vertices. The new measure is called the graph entropy and it quantifies the aggregate indeterminacy effected by the variety of unique walks that exist between each pair of vertices. The new tool is shown to be uniquely capable of revealing CRISPR regions in bacterial genomes and to identify Tandem repeats and Direct repeats of genome. We have done experiment on 26 species and found many tandem repeats and direct repeats (CRISPR for bacteria or archaea). There are several existing separate CRISPR or Tandem finder tools but our entropy can find both of these features if present in genome.

Identification of Colored Dyes that are Resistant to Fading on Exposure to Ethylene Oxide; Use with Indicating FTA™ Sample Collection Cards

Regulatory Standards and Forensic Communities are expressing an expectation for HID products to be certified as “DNA-free.” Recently, “DNA-free” status was described for HID-related products using ethylene oxide (EtO); this gas reduces the presence of amplifiable DNA and causes minimal interference to downstream HID-analytical methods. During sample collection, indicating cards, for example, Indicating FTA™ (GE Healthcare Life Sciences, UK), are used to collect and store buccal cell DNA. These cards contain a dye which changes color on application of a colorless sample. Generating “DNA-free” indicating cards using EtO should not impact the dyes' ability to indicate sample location or the efficacy of the card in downstream HID-analytical methods. This study was initiated to identify alternative dyes to those currently used with sample indicating collection cards. The most promising, dyes when applied to cellulose papers exhibited a uniform color distribution and excellent sample indicating properties even when mixed with chemicals associated with FTA™. When dyed cellulose papers were exposed to EtO, ultraviolet radiation, elevated temperature, and humidity, negligible fading or discoloration was observed. The presence of these dyes on cellulose papers did not interfere with direct short tandem repeat (STR) profiling. Allelic concordance, first pass success rate, and mean peak heights were comparable to samples applied to Indicating FTA. Biological samples applied to EtO-treated dyed cellulose papers and stored >1 month produced full STR profiles of sufficient quality to allow submission to DNA databases, confirming negligible interference from EtO treatment. These alternative sample indicating dyes resist EtO-mediated fading while fulfilling the Forensic Community's expectation for “DNA-free” with negligible impact on collection card performance.

Heterologous Expression and Purification of a 238 kDa Large Biofilm Associated Surface Protein (Bap) in Escherichia coli

Biofilm-associated protein (Bap) is a large surface protein (~238 kDa) that plays a significant role in the development of Staphylococcus biofilms. Surface proteins in S. aureus are functionally redundant, which implies that a null mutant that affects one surface protein might only be partially defective in the studied function. Therefore, the objective of this study was to clone, overexpress and purify the full Bap protein in E. coli to enable us to characterize the protein in detail for future experiments. The challenging part of this study was to resolve the problem of plasmid instability of recombinant construct, which is speculated to be due the large size of the gene and the presence of 13 direct tandem repeats, when conventional E. coli strains such as DH5-α and XL1-Blue were used as a cloning host and optimizing the parameters for overexpression of the gene. The full bap gene (~6.8 kb) was amplified by long-range Taq polymerase and cloned in an expression vector pET21b in E. coli stbl2 and in BL21(DE3)-pLysS for over expression. DNA sequencing of the cloned gene confirms 100% identity with bap gene in-situ (S. aureus V329). Successful expression of the full length of Bap protein in E. coli BL21(DE3)-pLysS was confirmed by the SDS-PAGE and Western blotting using Anti-His tag antibody. To the best of our knowledge, it is first attempt to clone and overexpress full-length Bap protein in E. coli. The use of recombinant Bap gene will allow us to study and aid in its biophysical characterization.

Trinucleotide Repeat Expansion in theTCF4Gene in Fuchs' Endothelial Corneal Dystrophy in Japanese

The purpose of this study was to evaluate the association between the intronic expansion of a trinucleotide repeat (TNR) in the TCF4 gene and Fuchs' endothelial corneal dystrophy (FECD) in a Japanese population. Forty-seven Japanese FECD patients and 96 age-matched controls were recruited. FECD patients and controls were examined by slit-lamp and noncontact specular microscopy. The repeat length was determined by direct sequencing and short tandem repeat assay of PCR-amplified DNA and Southern blotting of unamplified DNA. A TNR expansion, defined as >50 CTG repeats in the TCF4 gene was identified in 12 of 47 FECD cases (26%) and 0 of 96 controls (0%; P < 0.001). Sensitivity and specificity in this study were 26% and 100%, respectively. The clinical characteristics of FECD patients with TNR expansion were not distinct from those without TNR expansion. These findings show for the first time in a Japanese population the association of the TNR expansion in TCF4 with FECD. In contrast to Caucasian cohorts in whom the TNR expansion is present in most patients with FECD, a CTG expansion is present in a minority of Japanese subjects, indicating other genetic variants as common causes of phenotypically identical disease in this population.

Molecular characterization of plasmid pMoma1of Moraxella macacae, a newly described bacterial pathogen of macaques.

We report the complete nucleotide sequence and characterization of a small cryptic plasmid of Moraxella macacae 0408225, a newly described bacterial species within the family Moraxellaceae and a causative agent of epistaxis in macaques. The complete nucleotide sequence of the plasmid pMoma1 was determined and found to be 5,375 bp in size with a GC content of 37.4 %. Computer analysis of the sequence data revealed five open reading frames encoding putative proteins of 54.4 kDa (ORF1), 17.6 kDa (ORF2), 13.3 kDa (ORF3), 51.6 kDa (ORF4), and 25.0 kDa (ORF5). ORF1, ORF2, and ORF3 encode putative proteins with high identity (72, 42, and 55 %, respectively) to mobilization proteins of plasmids found in other Moraxella species. ORF3 encodes a putative protein with similarity (about 40 %) to several plasmid replicase (RepA) proteins. The fifth open reading frames (ORF) was most similar to hypothetical proteins with unknown functions, although domain analysis of this sequence suggests it belongs to the Abi-like protein family. Upstream of the repA gene, a 470-bp intergenic region, was identified that contained an AT-rich section and two sets of tandem direct and indirect repeats, consistent with a putative origin of replication site. In contrast to other plasmids of Moraxella, the occurrence of pMoma1 in M. macacae isolates appears to be common as PCR testing of 14 clinical isolates from two different research institutions all contained the plasmid.

Horizontal gene transfer from Agrobacterium to plants.

Most genetic engineering of plants uses Agrobacterium mediated transformation to introduce novel gene content. In nature, insertion of T-DNA in the plant genome and its subsequent transfer via sexual reproduction has been shown in several species in the genera Nicotiana and Linaria. In these natural examples of horizontal gene transfer from Agrobacterium to plants, the T-DNA donor is assumed to be a mikimopine strain of A. rhizogenes. A sequence homologous to the T-DNA of the Ri plasmid of Agrobacterium rhizogenes was found in the genome of untransformed Nicotiana glauca about 30 years ago, and was named “cellular T-DNA” (cT-DNA). It represents an imperfect inverted repeat and contains homologs of several T-DNA oncogenes (NgrolB, NgrolC, NgORF13, NgORF14) and an opine synthesis gene (Ngmis). A similar cT-DNA has also been found in other species of the genus Nicotiana. These presumably ancient homologs of T-DNA genes are still expressed, indicating that they may play a role in the evolution of these plants. Recently T-DNA has been detected and characterized in Linaria vulgaris and L. dalmatica. In Linaria vulgaris the cT-DNA is present in two copies and organized as a tandem imperfect direct repeat, containing LvORF2, LvORF3, LvORF8, LvrolA, LvrolB, LvrolC, LvORF13, LvORF14, and the Lvmis genes. All L. vulgaris and L. dalmatica plants screened contained the same T-DNA oncogenes and the mis gene. Evidence suggests that there were several independent T-DNA integration events into the genomes of these plant genera. We speculate that ancient plants transformed by A. rhizogenes might have acquired a selective advantage in competition with the parental species. Thus, the events of T-DNA insertion in the plant genome might have affected their evolution, resulting in the creation of new plant species. In this review we focus on the structure and functions of cT-DNA in Linaria and Nicotiana and discuss their possible evolutionary role.

Genomic Plasticity Enables Phenotypic Variation of Pseudomonas syringae pv. tomato DC3000

Whole genome sequencing revealed the presence of a genomic anomaly in the region of 4.7 to 4.9 Mb of the Pseudomonas syringae pv. tomato (Pst) DC3000 genome. The average read depth coverage of Pst DC3000 whole genome sequencing results suggested that a 165 kb segment of the chromosome had doubled in copy number. Further analysis confirmed the 165 kb duplication and that the two copies were arranged as a direct tandem repeat. Examination of the corresponding locus in Pst NCPPB1106, the parent strain of Pst DC3000, suggested that the 165 kb duplication most likely formed after the two strains diverged via transposition of an ISPsy5 insertion sequence (IS) followed by unequal crossing over between ISPsy5 elements at each end of the duplicated region. Deletion of one copy of the 165 kb region demonstrated that the duplication facilitated enhanced growth in some culture conditions, but did not affect pathogenic growth in host tomato plants. These types of chromosomal structures are predicted to be unstable and we have observed resolution of the 165 kb duplication to single copy and its subsequent re-duplication. These data demonstrate the role of IS elements in recombination events that facilitate genomic reorganization in P. syringae.

The complete mitochondrial genome of the critically endangered Vietnamese three-striped box turtle (Testudines: Geoemydidae)

The complete mitochondrial genome of the Vietnamese three-striped box turtle (Cuora cyclornata) was first determined in this study. It was a circular molecule of 16,594 bp in length, consisting of 37 genes typically found in other vertebrates. The AT content of the overall base composition of the whole mitogenome was 60.39%, while the control region was 70.23%. Two ETAS and 4 CSBs were identified, while a remarkable feature was found in the control region: a large number of (TTATTATA)10 direct tandem repeats followed by (TTATA)n (n = 10, 8 and 1), which were spaced into three domains by (TA)n (n = 1, 1 and 2). The sequence information could play an important role in the study of phylogenetic relationships in turtles and preservation of genetic resources for helping conservation of the endangered species.

Roles of XRCC2, RAD51B and RAD51D in RAD51-Independent SSA Recombination

The repair of DNA double-strand breaks by recombination is key to the maintenance of genome integrity in all living organisms. Recombination can however generate mutations and chromosomal rearrangements, making the regulation and the choice of specific pathways of great importance. In addition to end-joining through non-homologous recombination pathways, DNA breaks are repaired by two homology-dependent pathways that can be distinguished by their dependence or not on strand invasion catalysed by the RAD51 recombinase. Working with the plant Arabidopsis thaliana, we present here an unexpected role in recombination for the Arabidopsis RAD51 paralogues XRCC2, RAD51B and RAD51D in the RAD51-independent single-strand annealing pathway. The roles of these proteins are seen in spontaneous and in DSB-induced recombination at a tandem direct repeat recombination tester locus, both of which are unaffected by the absence of RAD51. Individual roles of these proteins are suggested by the strikingly different severities of the phenotypes of the individual mutants, with the xrcc2 mutant being the most affected, and this is confirmed by epistasis analyses using multiple knockouts. Notwithstanding their clearly established importance for RAD51-dependent homologous recombination, XRCC2, RAD51B and RAD51D thus also participate in Single-Strand Annealing recombination.

A pthA homolog from a variant of Xanthomonas axonopodis pv. citri enhances virulence without inducing canker symptom

Three novel atypical symptom-producing types of Xanthomonas axonopodis pv. citri were described recently. The variants designated as Xac-Ap type produce large flat necrotic with water-soaked margin lesions instead of canker lesions on leaves of Mexican lime (Citrus aurantifolia) and grapefruit (C. paradisi). Random mutagenesis using transposon Tn5 in Xac-Ap type strain XL38 was used to isolate a virulence-deficient mutant T38, which induced small flat necrotic with water-soaked margin lesions on leaves. PthAp being inactivated by the transposon was cloned and characterized. Our result demonstrated that pthAp is responsible for XL38 to cause large flat necrotic with water-soaked margin lesions and bacterial multiplication but fails to confer the ability of inducing canker lesions. Sequence analysis reveled pthAp is a new member belong to the pthA homologs. The sequence is almost identical to the other homologs except for the number of direct tandem repeats in the central region of the gene. The pthAp contained an intact promoter and a full-length reading frame but with 18.5 direct repeats. Moreover, the amino acid at position 3rd in 1st, 2nd, 3rd repeats and at 13th position in 11th, 12th, 13th, 14th repeats were varied. Mutant T38 is fully complemented by pthA carried 17.5 direct repeats for the pathogenicity of X. axonopodis pv. citri to elicit canker lesions. The pthAp affected in planta bacterial growth and lesions in size but no ability of inducing canker symptom. These results suggested that pthAp is a new distinct virulence effector responsible for the enhancement of virulence.

Characterization of a Streptococcus mutans Intergenic Region Containing a Small Toxic Peptide and Its cis-Encoded Antisense Small RNA Antitoxin

Toxin-antitoxin (TA) modules consist of a pair of genes that encode two components: a protein toxin and an antitoxin, which may be in the form of either a labile protein or an antisense small RNA. Here we describe, to the best of our knowledge, the first functional chromosomal type I TA system in streptococci. Our model organism is the oral pathogen Streptococcus mutans. Our results showed that the genome of S. mutans UA159 reference strain harbors a previously unannotated Fst-like toxin (Fst-Sm) and its cis-encoded small RNA antitoxin (srSm) converging towards the end of the toxin gene in IGR176, a small intergenic region of 318 nt. Fst-Sm is a small hydrophobic peptide of 32 amino acid residues with homology to the Fst toxin family. Transcripts of ∼200 nt and ∼70 nt specific to fst-Sm mRNA and srSm RNA, respectively, were detected by Northern blot analysis throughout S. mutans growth. The toxin mRNA was considerably more stable than its cognate antitoxin. The half-life of srSm RNA was determined to be ∼30 min, while fst-Sm mRNA had a half-life of ∼90 min. Both fst-Sm and srSm RNAs were transcribed across direct tandem repeats providing a region of complementarity for inhibition of toxin translation. Overproduction of Fst-Sm had a toxic effect on E. coli and S. mutans cells which can be neutralized by coexpression of srSm RNA. Deletion of fst-Sm/srSm locus or overexpression of Fst-Sm/srSm had no effect on S. mutans cell growth in liquid medium and no differences in the total biofilm biomass were noted. In contrast, mild-overproduction of Fst-Sm/srSm type I TA system decreases the levels of persister cells tolerant to bacterial cell wall synthesis inhibitors.