Systemic Lupus Erythematosus Sera Research Articles

Increased bioactive TNF in human systemic lupus erythematosus: associations with cell death.

In systemic lupus erythematosus (SLE) serum TNF is increased and correlates with its soluble receptors and with disease activity. We therefore investigated (i) whether the TNF in SLE serum is bioactive, (ii) whether SLE cells react to TNF and (iii) whether there are associations with cell death, which is regarded as pathogenic in SLE. Sera from active SLE patients induced an increase in fibroblast CD54, which was abolished by blocking antibodies against TNF, suggesting TNF bioactivity. SLE lymphocytes had a similar surface expression of TNF-RI as healthy lymphocytes, their expression of TNF-RII was slightly increased. Recombinant TNF induced cell death in PBMC of SLE patients, suggesting functional receptors. Serum levels of sTNF-RII (as a surrogate marker for TNF activity) correlated with sTNF-RI and disease activity, as expected, and also correlated with the percentage of dying lymphocytes and with lymphocytic CD95. SLE sera contain increased amounts of biologically active TNF. Peripheral blood lymphocytes of SLE patients express functional TNF receptors. Finally, associations with cell death and CD95 receptors suggest that TNF may be pathogenic in SLE.

Autoantibodies Directed Against Ribosomal Proteins in Systemic Lupus Erythematosus and Rheumatoid Arthritis: A Comparative Study

To assess the specificity of autoantibodies (aAbs) directed against the ribosomal P-proteins (RPPaAbs) in patients with systemic lupus erythematosus (SLE) and to investigate aAbs directed to other ribosomal proteins, 100 SLE, 100 rheumatoid arthritis (RA), 25 thyroiditis and 20 blood-donors were analyzed in a comparative study using an immunoblotting technique. Forty-eight percent of SLE sera contained aAbs directed against the ribosomal proteins of the 60 S subunit compared to 9% for RA, 5% for blood donors and 0% for thyroiditis. RPPaAbs were only found in SLE (25%) and aAbs directed to a 31 kDa and/or a 28 kDa protein of the 60 S subunit were found with a statistically higher frequency for SLE compared to RA (p <0.0001). aAbs directed to proteins of the 40 S subunit were present in 63% of the SLE sera compared to 42% for RA, 4% for thyroiditis and 5% for blood donors. The number of positive sera was not statistically different between SLE and RA but a much more intense reactivity was observed for SLE sera. These data shows that the aAbs against the ribosomal proteins, especially the P-proteins along with the 28 and 31 kDa proteins of the 60 S subunit proteins, can be considered as useful biological markers for the diagnosis of SLE in clinical practice.

Rabbit anti-HMG-17 antibodies recognize similar epitopes on the HMG-17 molecule as lupus autoantibodies. Relation with histone H1 defined epitopes.

HMG-17 is a nucleosomal protein which is an immune target of autoantibodies in systemic lupus erythematosus (SLE) and other autoimmune diseases. Autoantibody production in SLE is believed to result from autoantigen specific immune stimulation and subsequently, it is expected that antigenic determinants recognized by SLE autoantibodies and induced antibodies by immunization are quite similar. To examine this issue, rabbits were immunized with purified HMG-17. The produced antiserum showed cross reactivity on blots and in inhibition ELISA with histone H1, even after its affinity purification with immobilized HMG-17. Finally, purification of the antiserum over H1 absorbed on nitrocellulose membrane produced specific anti-HMG-17 antibodies in the supernatant and anti-HMG-17/H1 antibodies that were bound to H1. SLE sera positive for HMG-17 had also cross reactivity with H1, and following the same procedure as before we received HMG-17 specific SLE autoantibodies and anti-HMG-17/H1 autoantibodies. Using the multipin epitope mapping technology, 19 overlapping 15-mer HMG-17 peptides and six 15-peptides, corresponding to known epitopes of histone H1, were synthesized. Four major epitopes were identified on the HMG-17 molecule, reactive with induced anti-HMG-17 antibodies, and these were the same as major autoepitopes In SLE. The sequence 25-51 of HMG-17, part of its DNA-binding domain, was recognized by the anti-HMG-17/H1 antibodies that were bound to H1. These antibodies recognized also defined epitopes of H1. Our results show that SLE autoantibodies can be directed against the same or similar epitopes as do IgGs evoked during the active immunization of animals, and provide additional evidence that autosensitization with an autoantigen might be operative. The possibility that the same or similar epitopes are found on different molecules (in this study HMG-17 and H1) supports the fact that there are rules by which nature selects the most dominant immunodeterminant to a given protein, which often represents functional or structural sites in the autoantigen.

Molecular cloning of candidate antigens recognized by anti-endothelial cell antibodies

Anti-endothelial cell antibodies (AECA) have been reported in such a vast array of conditions associated with vasculitis that the related autoantigens have become extremely difficult to identify. We have, therefore, used a molecular cloning approach to define endothelial cell (EC) target structures by screening a human umbilical vein EC (HUVEC) cDNA expression library. Total RNA was extracted from HUVECs and purified by oligo-dT cellulose chromatography. A commercial kit was used to synthesize cDNA which was inserted into the EcoRI/XhoI-digested and dephosphorylated lambda ZAP Express vector. The construct was incorporated into phages and transformed with E. coli strain XL1 Blue. After the addition of AECAs, positive clones were isolated in suspending medium, purified and incorporated again into the XL1. The insert-containing phagemids were exised from recombinant phages and introduced into E. coli XLOLR strain. The restriction fragments, obtained from the cDNA inserts by EcoRI endonuclease digestion, were sequenced by the dideoxy-chain termination method with two primers, T3 (AATTAACCCTCACTAAAGGG) and T7 (CGGGATATCACTCAGCATAATG). The sequences were examined for analogy in the GenBank and EBML nucleic acid data banks. Two sera, one from a patient with systemic lupus erythematosus (SLE) and another from a patient with Wegener's granulomatosis (WG), both strongly AECA-positive in our in-house cell-ELISA, were used to screen the bank. The SLE serum recognized methyltransferase, NADH dehydrogenase and unidentified components, whereas the WG serum recognized methyltransferase, GAPDH and unidentified structures. AECAs could thus be associated with a bulk of autoantibodies targeting various enzymes, or get inside the ECs to bind to such proteins.

Patients with systemic lupus erythematosus (SLE) have a circulating inducer of interferon-alpha (IFN-α) production acting on leucocytes resembling immature dendritic cells

Patients with active SLE often have an ongoing production of IFN-alpha. We therefore searched for an endogenous IFN-alpha-inducing factor (IIF) in SLE patients and found that their sera frequently induced production of IFN-alpha in cultures of peripheral blood mononuclear cells (PBMC) from healthy blood donors, especially when the PBMC were costimulated with the cytokines IFN-alpha2b and granulocyte-macrophage colony-stimulating factor (GM-CSF). The phenotype of the IFN-alpha-producing cells (IPC) as determined by flow cytometry corresponded to that of the natural IPC, resembling immature dendritic cells. The IIF activity in SLE sera was sometimes as high as that of a virus and was present especially in patients with active disease and with measurable IFN-alpha levels in serum. The IIF had an apparent molecular weight of 300-1000 kD and appeared to consist of both immunoglobulin and DNA, possibly being immune complexes. This endogenous IFN-alpha inducer may be of pathogenic significance, since a reported occasional adverse effect of IFN-alpha therapy in patients with non-autoimmune disorders is development of anti-dsDNA antibodies and SLE.

The influence of DNA size on the binding of antibodies to DNA in the sera of normal human subjects and patients with systemic lupus erythematosus (SLE).

To elucidate antibody recognition of DNA in normal and aberrant immunity, the binding of sera of normal human subjects (NHS) and patients with SLE was tested with mammalian and bacterial DNA varying in size. Klebsiella pneumoniae (KP) and calf thymus (CT) single-stranded DNA (ssDNA) were investigated as model antigens using the restriction enzyme HinfI to generate fragments with the size range of 800-5000 base pairs. The influence of size on activity was assessed by ELISA by both titration of serum as well as coating antigen concentration. In both assay formats, SLE sera bound equivalently to intact CT and KP DNA, but had dramatically reduced reactivity to fragments of both antigens. In contrast, NHS bound similarly to intact KP DNA and its fragments but had low reactivity to CT DNA. These results suggest that SLE and NHS anti-DNA react with different antigenic determinants on DNA, as shown by cross-reactivity as well as size dependency in solid-phase assays.

Antibodies targeting extractable nuclear antigens: historical development and current knowledge.

The extractable nuclear antigens (ENA) are a heterogeneous group of ribonucleoproteins and non‐histone proteins with different functions in nuclear metabolism. The detection of antibodies targeting ENA is a well‐established tool in the diagnosis of autoimmune diseases such as lupus erythematosus (LE), progressive systemic sclerosis (PSS), polymyositis (PM), dermatomyositis (DM), mixed connective tissue disease (MCTD), Sjögren's syndrome (SS) and overlap syndromes. Descriptions of precipitin reactions between soluble tissue components and sera of patients suffering from these diseases, as well as identification of the antigen–antibody reactions, have been the subject of a large number of investigations in recent years. Most of the corresponding antigens have been identified (over 20 antigen systems) and knowledge about the clinical and genetic association of the antibodies detected has improved. Antibodies targeting ENA were first described in 1959, when Holman et al. recorded a precipitin reaction of sera from systemic LE (SLE) patients with extractable antigens isolated from crushed calf thymus.1 This observation was interpreted as an antigen–antibody reaction of autoantibodies in the SLE sera with soluble nuclear antigens. The nomenclature of an autoantibody to ENA depended on the group first describing it, and was made corresponding to the nuclear function of the antigen (RNP), the name of the patient providing the prototype serum (Ro, La, Sm, Jo, Mi) or the disease from which the serum donor suffered (SSA, SSB, SSC, Scl‐70, PM‐1, PM‐Scl).

Binding of SLE Autoantibodies to Native poly(I), ROS-poly(I) and Native DNA: A Comparative Study

Reactive oxygen species (ROS) are implicated in a variety of human diseases. The formation of pathogenic anti-DNA antibodies in systemic lupus erythematosus (SLE) has been extensively investigated. ROS-modified DNA has been found to be a better antigen for anti-DNA antibodies found in SLE sera. A comparative binding of SLE autoantibodies with native poly(I), ROS-poly(I) and nDNA has been studied. Affinity-purified SLE IgG exhibited a high degree of specificity towards the ROS-modified poly(I) in comparison to native DNA and native poly(I), reiterated visually by gel retardation assay. The data suggested that hydroxyl radical-modified nucleic acids like RNA and DNA might be agent for the induction of circulating SLE anti-DNA autoantibodies.

Autoimmunity to the p53 Protein is a Feature of Systemic Lupus Erythematosus (SLE) Related to Anti-DNA Antibodies

The induction of anti-DNA autoantibodies in systemic lupus erythematosus (SLE) patients is problematic because mammalian DNA is poorly immunogenic at best. Here we demonstrate a chain of connected antibodies in SLE patient sera that could account for the induction of anti-DNA antibody, and possibly for some of the pathogenic features of SLE. We now report that SLE patients, in addition to anti-DNA, produce antibodies to the carboxy-terminal domain of the tumour suppressor molecule p53; this p53 domain recognizes damaged DNA. Hence, these anti-p53 antibodies could mimic damaged DNA immunologically. Indeed, SLE sera do contain anti-idiotypic antibodies to a prototypic anti-p53 antibody. Moreover, SLE anti-DNA antibodies also recognize this type of anti-p53 antibody. Indeed, binding of affinity-purified anti-DNA both to DNA and to the anti-p53 antibody could be blocked by a p53 peptide derived from the DNA-binding domain. This mimicry of the p53 DNA-binding domain by the SLE anti-DNA antibodies is functional: activation of the p53 molecule could be inhibited by such anti-DNA antibodies. Thus, anti-DNA antibodies may arise in SLE patients by a chain of idiotypic autoimmunity centered around p53 autoimmunity. The SLE anti-DNA and anti-p53 antibodies can functionally block p53 activation, and so could affect apoptosis.

Serum interleukin-15 is elevated in systemic lupus erythematosus.

To investigate if interleukin-15 (IL-15) (rather than IL-2) is increased in systemic lupus erythematosus (SLE) and might be responsible for immunological abnormalities of SLE such as the increased lymphocytic expression of Bcl-2 and CD25. Serum IL-15, IL-2 and tumour necrosis factor (TNF) levels of 65 SLE patients, 20 healthy persons and 10 rheumatoid arthritis (RA) patients were measured by enzyme-linked immunosorbent assay (ELISA). For 25 SLE patients, the percentage of CD25 + lymphocytes and the lymphocytic Bcl-2 levels were simultaneously determined by fluorocytometry. Peripheral blood mononuclear cells (PBMC) of 15 SLE patients were incubated with or without recombinant IL-15 and the influence on Bcl-2 and CD25 was determined. IL-15 was found to be elevated in 25 SLE sera (38%), but in none of the 20 healthy sera (P = 0.0005) and none of the 10 RA sera. Both lymphocyte CD25 and Bcl-2 expression significantly correlated with serum IL-15 and were increased by recombinant IL-15. Serum IL-15 may in part be responsible for the immunological abnormalities seen in active SLE.

Reactivity of thyrotropin receptor autoantibodies with the thyrotropin receptor on western blots.

Affinity purified recombinant human thyrotropin receptor (TSHR) was run on sodium dodecyl sulfate (SDS) gels and subjected to a renaturing and blotting procedure. Twenty sera from thyrotropin receptor autoantibodies (TRAb)-positive patients with a history of hyperthyroidism and 20 sera with high levels of TSH blocking activity were analyzed. Four of 20 sera with blocking-type of TRAb (i.e., TSH antagonist activity) were able to recognize the mature, fully glycosylated 120-kd form of the receptor on blots of gels run under reducing conditions. No sera recognized the 100-kd high mannose precursor form of the TSHR. Three of the four recognized a 74-kd band and 2 of the 4 recognized a 50-kd band. These bands are probably proteolytic cleavage fragments of the mature 120-kd TSHR. In the absence of reducing agent the same 4 of 20 sera described above together with a further serum sample (i.e., 5/20 in total) reacted with the 120-kd form of the receptor. No specific reaction with the TSHR was observed on Western blots with the remaining 15 sera with TSH blocking activity, nor with 20 sera from patients with a history of hyperthyroidism, nor with sera from 10 healthy blood donors, 10 Hashimoto sera (negative for TRAb) and 10 systemic lupus erythematosus sera. No clear differences were observed in the TRAb positive sera that were reactive and nonreactive on Western blots in terms of their ability to inhibit TSH binding or to immunoprecipitate 125I-labeled TSHR. Overall, our results indicate that the mature 120-kd form of the TSHR that is principally responsible for binding TSH is also responsible for binding TRAb (when this binding can be detected). These observations together with immunoprecipitation and TSH binding inhibition studies, emphasize the close relationship between the receptor's binding sites for TSH and TRAb.

Peptide mimicking antigenic and immunogenic epitope of double-stranded DNA in systemic lupus erythematosus.

Autoantibodies to double-stranded (ds) DNA are an important diagnostic marker and pathogenic factor for systemic lupus erythematosus (SLE). Identifying dsDNA mimotopes is a way to discover diagnostic and therapeutic candidates for SLE. 'Mono-specific' SLE anti-dsDNA antibodies were obtained by affinity purification using dsDNA-coupled Sepharose column. Using the anti-dsDNA antibodies to screen a phage peptide library, we were able to identify a mimotope that has a motif peptide sequence of RLTSSLRYNP. This chemically synthesized peptide could be recognized by 88% (37 out of 42) of anti-dsDNA antibody-positive SLE sera with a cut-off point at mean + 3 SD of the negative control sera at OD(492). The reaction of the peptide with SLE sera in ELISA was highly correlated with that of dsDNA (r = 0.809, P < 0.0001). Of particular interest, not only dsDNA but also single-stranded (ss) DNA and native RNA could inhibit the binding of the peptide with SLE sera, suggesting that the mimotope is shared by ds and ssDNAs as well as native RNA, whereas denatured RNA was not observed to inhibit the binding. The peptide was also able to elicit an immune response in rabbits and the anti-peptide rabbit serum was observed to cross-react with the peptide, ss and dsDNAs, and ss and dsDNAs could inhibit the binding of the anti-peptide serum and the peptide. However, the inhibition was not obtained with RNA. Our findings demonstrate the potential of the peptide mimic in diagnostic tests of SLE, and in the investigation of anti-DNA antibody origin and of DNA-anti-DNA antibody interaction.

Comparative analysis of anti-histone and anti-chromatin antibody specificity in lupus erythematosus cell-positive and -negative sera and their relation to disease activity

Anti-histone and anti-chromatin antibody responses play a central role in the autoimmune response of systemic lupus erythematosus (SLE). Furthermore, anti-histone H1 antibodies are essential for the formation of the lupus erythematosus cell (LEC) phenomenon. In this study, the binding properties of LEC+ and LEC- SLE sera to chromatin-associated nuclear antigens (histones H1, H2A, H2B, H3, H4; complexes of H2A-H2B, [H2A-H2B]-DNA, H1-DNA; total and H1-stripped chromatin; native and denatured DNA) were investigated. In addition, sera from patients with drug-induced lupus (by procainamide, hydralazine, or quinidine), as well as from patients with rheumatoid arthritis and osteoarthritis, were assessed. Enzyme-linked immunosorbent assay was used to detect specific antibody binding. Mirroring the important role of histone H1 in the formation of LE cells, anti-histone H1 reactivity was 8-fold higher in LEC+ sera than in LEC- sera. In addition, reactivities to most of the other antigens tested, i.e., other histones and histone-DNA complexes as well as chromatin and DNA, were significantly higher in LEC+ sera than in LEC- sera. All but 1 serum sample from the patients with drug-induced lupus were negative for LE cell formation as well as for anti-histone H1 reactivity, but displayed high antibody reactivities to histone-DNA complexes, including chromatin. Sera from patients with rheumatoid arthritis and osteoarthritis did not show significant binding to these antigens. When comparing the clinical features of LEC+ and LEC-SLE patients, severe organ involvement, including nephritis and central nervous system involvement, was common in the LEC+ group, but rare in the LEC- group. A positive LE cell phenomenon not only correlated with the presence of high anti-histone H1 antibody levels in SLE, but also indicated serologically and clinically active disease with major organ involvement.

Aberrant Processing of Oxidative DNA Damage in Systemic Lupus Erythematosus

Defective DNA damage processing has been reported in systemic lupus erythematosus (SLE). Vitamin C may modulate formation/removal of the oxidative DNA lesion 8-oxo-2′-deoxyguanosine (8-oxodG). Baseline levels of 8-oxodG measured in SLE serum, urine and PBMC DNA did not differ significantly from healthy subjects. In contrast to healthy subjects, no significant decrease in PBMC 8-oxodG or increase in urinary 8-oxodG was noted in vitamin C supplemented SLE patients. A significant, although attenuated, increase in serum 8-oxodG was detected in SLE patients, compared to healthy subjects. These data support putative abnormalities in the repair/processing of 8-oxodG in SLE.

Use of anion exchange resin-packed capillary column for rapid detection of anti-double-stranded DNA antibody in systemic lupus erythematosus serum.

An anti-double-stranded (ds) DNA antibodies in serum-detection system was developed based on flow immunoassay with packed-capillary column. Alkaline phosphatase conjugated DNA (ALP-DNA) and anti-dsDNA antibody were separated from unreacted ALP-DNA on the basis of the difference in isoelectric point. A linear anti-dsDNA antibody dose-response curve was obtained between luminescence intensity and concentration of anti-dsDNA antibody in the range 25-200 IU/mL. This simple technique permits the assay of anti-dsDNA autoimmune antibodies within 7 minutes. These results give reduced detection times compared with those previously reported (Lim et al., 1999) through the use of capillary columns.

Toxic effects of SLE serum on normal monocytes in vitro: cell death induced by apoptosis related to complement dysfunction.

The aim of this study was to assess toxic effects of systemic lupus erythematosus (SLE) serum on blood peripheral mononuclear cells from healthy donors and to evaluate if complement activation was involved. Monocytes from a healthy donor were incubated with 20 sera from ten SLE patients in both high and low disease activity states. After incubation non-adherent cells were analysed by flow cytometry. Serum from six SLE patients induced an increased cell death, four in active disease only, one in the inactive state and one in the active and the inactive state. Five of these sera, three with high and two with low disease activity, induced an increased apoptosis in the monocytes. Proportion of apoptotic cells correlated inversely with C1q and C3 concentration in the active disease sera, but not with disease activity as evaluated by SLEDAI. Apoptosis could be induced by addition of active C1s or antigen/antibody complexes to normal serum before incubation. Serum with complexes added induced increased tumour necrosis factor-alpha secretion from mononuclear cells, but SLE patient sera did not. The results demonstrate that the toxic effect of serum from SLE patients on healthy monocytes is explained by induction of apoptosis. The induction process is suggested to be connected with complement activation in the serum.

Anti-Double-Stranded DNA Antibodies and Immunostimulatory Plasmid DNA in Combination Mimic the Endogenous IFN-α Inducer in Systemic Lupus Erythematosus

AbstractPatients with systemic lupus erythematosus (SLE) have increased blood levels of IFN-α, which correlate to disease activity. We previously identified an IFN-α-inducing factor (IIF) in the blood of SLE patients that activated the natural IFN-α-producing cells in cultures of normal PBMC. The SLE-IIF contained DNA and IgG, possibly as small immune complexes. In our study, we demonstrated that SLE-IIF correlated to the presence of anti-dsDNA Abs in patients and contained anti-dsDNA Abs as an essential component. Purified anti-DNA Abs or SLE-IgG caused only a weak IFN-α production in cultures of normal PBMC in the presence of costimulatory IFN-α2b. However, they converted the plasmid pcDNA3, which itself induced no IFN-α production in PBMC, into an efficient IFN-α inducer. A human monoclonal anti-ss/dsDNA Ab had the same effect. This IFN-α-inducing activity of the plasmid was abolished by methylation, suggesting that unmethylated CpG DNA motifs were important. Like IIF in SLE serum, the combination of SLE-IgG and pcDNA3 appeared to stimulate IFN-α production in natural IFN-α-producing cells, a unique cell population resembling immature dendritic cells. The IFN-α production was greatly enhanced by IFN-α2b and IFN-β, and for SLE-IIF it was also enhanced by GM-CSF but inhibited by IL-10. We have therefore identified a new function of DNA-anti-DNA Ab complexes, IFN-α induction, that might be important in the pathogenesis of SLE.

B cells lacking RP105, a novel B cell antigen, in systemic lupus erythematosus.

RP105 is a leucine-rich repeat (LRR) protein found on all mature mouse B cells. Its function is poorly defined, although it has been suggested that RP105 activates B cells to make them resistant to apoptosis. The human homolog of RP105 has been reported, but knowledge of its function is limited. We explored the expression and the function of the human homolog of murine RP105 on B cells in patients with systemic lupus erythematosus (SLE). The expression of RP105 and various markers on B cells in patients with SLE was analyzed using monoclonal antibodies and flow cytometry. Susceptibility to corticosteroid-induced apoptosis was examined by annexin V binding, and the production of immunoglobulin by RP105-negative B cells was examined by intracellular staining of IgG. As in mice, virtually all B cells in the peripheral blood of normal humans expressed the RP105 molecule. However, a significant proportion of circulating B cells (15.9%) in SLE patients were RP105 negative. Serial analyses of B cells in 7 SLE patients revealed that RP105-negative B cells markedly decreased in parallel with a reduction in disease activity (from 35.2% to 3.3%; P = 0.000003). The SLE Disease Activity Index and serum levels of IgG also correlated with the percentage of RP105-negative B cells. The phenotype of RP105-negative B cells was defined as CD95-positive, CD86-positive, CD38-bright, IgD-negative, IgM-dull, indicating that the cells were highly activated, as further suggested by the detection of intracellular IgG. RP105-negative B cells were clearly distinct from CD5-positive B1 cells. In vitro experiments indicated that RP105-negative B cells were susceptible to corticosteroid-induced apoptosis. These findings suggest that loss of RP105 is associated with B cell activation and increased disease activity in SLE patients.

B cells lacking RP105, a novel B cell antigen, in systemic lupus erythematosus

Objective RP105 is a leucine-rich repeat (LRR) protein found on all mature mouse B cells. Its function is poorly defined, although it has been suggested that RP105 activates B cells to make them resistant to apoptosis. The human homolog of RP105 has been reported, but knowledge of its function is limited. We explored the expression and the function of the human homolog of murine RP105 on B cells in patients with systemic lupus erythematosus (SLE). Methods The expression of RP105 and various markers on B cells in patients with SLE was analyzed using monoclonal antibodies and flow cytometry. Susceptibility to corticosteroid-induced apoptosis was examined by annexin V binding, and the production of immunoglobulin by RP105-negative B cells was examined by intracellular staining of IgG. Results As in mice, virtually all B cells in the peripheral blood of normal humans expressed the RP105 molecule. However, a significant proportion of circulating B cells (15.9%) in SLE patients were RP105 negative. Serial analyses of B cells in 7 SLE patients revealed that RP105-negative B cells markedly decreased in parallel with a reduction in disease activity (from 35.2% to 3.3%; P = 0.000003). The SLE Disease Activity Index and serum levels of IgG also correlated with the percentage of RP105-negative B cells. The phenotype of RP105-negative B cells was defined as CD95-positive, CD86-positive, CD38-bright, IgD-negative, IgM-dull, indicating that the cells were highly activated, as further suggested by the detection of intracellular IgG. RP105-negative B cells were clearly distinct from CD5-positive B1 cells. In vitro experiments indicated that RP105-negative B cells were susceptible to corticosteroid-induced apoptosis. Conclusion These findings suggest that loss of RP105 is associated with B cell activation and increased disease activity in SLE patients.

Presence of circulating antibodies to a disease-specific antigen on cultured human dermal microvascular endothelial cells in patients with Behçet's disease.

Behçet's disease is a chronic, multisystem disorder characterized by a recurrent inflammatory reaction. Antiendothelial cell antibodies have been detected in the serum from patients with autoimmune diseases with presenting vasculitis and it is assumed that they can induce damage to the endothelial cells. In this study, we detected antiendothelial cell antibodies in the serum from patients with Behçet's disease using an enzyme-linked immunosorbent assay, electrophoresis and immunoblotting. The cytolysis of human dermal microvascular endothelial cells (HDMEC) was measured using a cytotoxicity assay. The serum from 37.4% of Behçet's disease patients showed IgM antibodies against unstimulated HDMEC while the serum from 18.4% of patients showed an increase in IgM antibody titer after IFN-gamma pretreatment. The frequency of vasculitis was higher in the IgM-positive Behçet's disease patients than in the IgM-negative patients. In Western blotting, IgM-positive Behçet's disease serum reacted with the 44 kDa HDMEC surface antigen, whereas IgM-positive systemic lupus erythematosus serum reacted with the 81 kDa HDMEC surface antigen. The reactivity to the 44 kDa protein band was also observed in cultured human umbilical vein endothelial cells but not in fibroblasts, A431 cells or SK-MEL-2 cells. Serum from Behçet's disease patients incubated with human complement or mononuclear cells produced no significant lysis of HDMEC, and cultured HDMEC were resistant to antibody-dependent cell-mediated cytotoxicity. The results suggest that antibodies against antigens on the surface of endothelial cells may play a role in inducing vasculitis in Behçet's disease, not through a direct toxic effect of an antiendothelial cell antibody but by an indirect effect involving the activation of endothelial cells to produce cytokines.