Bemisia Tabaci Research Articles

Enhanced association of whitefly-begomovirus competence with plant-mediated mutualism.

Vector-borne viruses often manipulate plant defenses against insect vectors, thereby impacting vector population dynamics and in turn virus spread. However, the factors regulating the outcome of insect vector-virus-plant tripartite interactions, such as the feature of virus-vector combinations, are understudied. Using eight whitefly (Bemisia tabaci)-begomovirus combinations exhibiting different degrees of competence, namely virus transmission efficiency, we examined the association between whitefly-begomovirus competence and plant-mediated mutualism. We found that three begomoviruses, tomato yellow leaf curl virus (TYLCV), cotton leaf curl Multan virus (CLCuMuV) and Sri Lankan cassava mosaic virus (SLCMV), can effectively infect but cause distinct symptoms in tobacco (Nicotiana tabacum) plants. Although the efficient vectors Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) whiteflies performed significantly better on TYLCV-infected plants than on control plants, the less-efficient vector Asia II 1 performed similarly on TYLCV-infected and uninfected plants. CLCuMuV infection of plants significantly enhanced the performance of the efficient vector Asia II 1, whereas the performance of the inefficient vector MEAM1 was unaffected by the virus infection status of the plants. SLCMV infection of plants significantly increased the survival and fecundity of the efficient vector Asia II 1, but did not affect the performance of the poorer vectors MEAM1 and MED. Combined analysis of our data and case studies from the literature indicates that plant-mediated mutualism between whiteflies and the begomoviruses they transmit is more likely to occur in competent combinations. Our findings shed novel light on the ecological principles governing the variations in insect vector-virus-plant tripartite interactions. © 2024 Society of Chemical Industry.

Revealing insights into Bemisia tabaci dynamics: natural enemy communities and population traits in Bt and non-Bt cotton

Revealing insights into Bemisia tabaci dynamics: natural enemy communities and population traits in Bt and non-Bt cotton

Molecular Diversity and Distribution of Whiteflies (Bemisia tabaci) in Cassava Fields Across South West and North Central, Nigeria.

Whitefly Bemisia tabaci (Gennadium, Hemiptera) causes severe damage to cassava plants through excessive feeding on leaves and transmitting viruses, such as African cassava mosaic virus (ACMV), East African cassava mosaic virus (EACMV), and ipomoviruses that cause cassava brown streak disease. Currently, little is known about the molecular diversity and distribution of whitefly species in the major cassava-growing zones of Nigeria. This study aimed to address the knowledge gap by assessing the genetic diversity, distribution, and associated cassava mosaic begomoviruses (CMBs) in whiteflies across South West and North Central, Nigeria. Whitefly samples were systematically collected from cassava plants during georeferenced epidemiological surveys in 2017, 2020, and 2022. The samples were genotyped using the mitochondrial cytochrome oxidase I (mtCOI) marker, and CMBs were detected by PCR with virus-specific primers. Phylogenetic analyses revealed four distinct genetic groups of B. tabaci: Sub-Saharan Africa 1 (SSA1; 84.8%), SSA2 (1.4%), SSA3 (13.1%), and Mediterranean (MED) (0.7%). The SSA1 group was the predominant and most widely distributed genotype across the surveyed zones, with three subgroups identified: SSA1-SG1, SSA1-SG3, and SSA1-SG5. The second most frequently identified genotype, SSA3, was restricted to the North Central zone, along with the SSA2 group, which was only identified in two North Central states (Niger and Plateau). African cassava mosaic virus (ACMV) was detected in SSA1-SG1, SSA1-SG5, and SSA3, whereas EACMV was found in only the SSA1-SG3. The findings of this study will aid in developing better whitefly management strategies to reduce the impact of CMD on cassava production in Nigeria.

Evaluation of Different Mode of Action Insecticides for the Control of Bemisia tabaci; Enhancement of Pesticide Efficacy.

Bemisia tabaci (Gennadius) is a major pest worldwide, causing damage to a vast range of plants through its feeding on phloem sap and its vectoring of >100 plant viruses. Although not established in the UK, it is regularly introduced on planting material, which poses a significant plant health risk. Restrictions on pesticide use and increasing resistance to available active ingredients limit options for effective control of potential outbreaks. Alternative management options are required to mitigate this risk. There was high variability in the efficacy of the different modes of action products tested against two life stages (adults and larvae) as well as the Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) cryptic species of B. tabaci. For both adults and larvae, MEAM1 were more susceptible than MED insects, possibly due to differences in resistance developed against some active ingredients. All products tested were effective to varying degrees against MEAM1 adults with Tracer (spinosad), PREV-AM (orange oil), Sequoia (sulfoxaflor), and FLiPPER (fatty acids) having similar efficacies (59-78% mortality). In contrast, PREV-AM and FLiPPER were most effective against MED adults (74% and 65% mortalities, respectively). Both MED and MEAM1 larvae were highly susceptible to FLiPPER and PREV-AM (>95% mortality), and the efficacy of Tracer and FLiPPER can be enhanced by using in combination with PREV-AM, and this can be achieved by using low doses of each product. Synergy was measured between PREV-AM and Tracer against MEAM1 larvae, which has the potential to provide effective control with a reduced pesticide application.

Management of Yellow Mosaic Disease in Soybean

Soybean (Glycine max L.) is a valuable crop known for its high protein content of 40 % and quality oil content of 20 %. However, its production is often hampered by pests and diseases, with yellow mosaic disease being a major concern. This disease is caused by mungbean yellow mosaic virus (MYMV) and mungbean yellow mosaic India virus, transmitted by the whitefly (Bemisia tabaci), posing a significant threat to soybean cultivation globally. A study conducted at the Agricultural Research Station (ARS) in Bidar, India, in the summer of 2024 aimed to test effectiveness of chemical insectides to manage yellow mosaic disease by controlling its vectors. All treatments were significantly better than the control, with seed treatment using imidacloprid 600 FS and two foliar sprays of flonicamid 50 WG at 0.03 % at 20 and 35 days after sowing had least whitefly population of 3.0 per plant (63 % population reduction over control), minimum disease incidence of 26.00 % (72 % reduced disease incidence over control) and highest yield of 15.07 q/ha (11.83 q yield improvement over control) proving to be the most effective compared to other treatments.

A multiplex RT-qPCR assay for simultaneous detection of cucurbit viruses from individual whitefly and plant samples.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

Enabling biocontained plant virus transmission studies through establishment of an axenic whitefly (Bemisia tabaci) colony on plant tissue culture

Whiteflies (Bemisia tabaci) and the diseases they transmit are a major detriment to crop yields and a significant contributor to world hunger. The highly evolved interactions of host plant, phloem-feeding insect vector with endosymbionts and persistently transmitted virus represent a tremendous challenge for interdisciplinary study. Presented here is the establishment of a colony of axenic whiteflies on tissue-cultured plants. Efficient colony establishment was achieved by a surface sterilization of eggs laid on axenic phototrophically tissue-cultured plants. The transfer of emerging whiteflies through coupled tissue culture vessels to new axenic plants facilitates robust subculturing and produces hundreds of whitefly adults per month. Whitefly proliferation on more than two dozen plant species is shown as well as in vitro testing of whitefly preference for different plants. This novel multi-organism system provides the high-level of biocontainment required by Federal permitting to conduct virus transmission experiments. Axenic whitefly adults were able to acquire and transmit a begomovirus into tissue-cultured plants, indicating that culturable gut microorganisms are not required for virus transmission. The approach described enables a wide range of hypotheses regarding whitefly phytopathology without the expense, facilities, and contamination ambiguity associated with current approaches.

Impact of Cassava Cultivars on Stylet Penetration Behavior and Settling of Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae).

This study investigates the settling preferences and feeding behavior of the Bemisia tabaci whitefly on six cassava cultivars using electrical penetration graph techniques. Six distinct electrical penetration graph waveforms-non-probing, stylet pathway, phloem salivation, phloem ingestion, intracellular puncture, and xylem feeding-were identified and analyzed. Significant differences in the frequency and duration of these waveforms were observed among the cassava cultivars. The whiteflies spent the majority of their time in the non-probing phase, particularly on the Huaybong 80, Kasetsart 50, Rayong 9, and Rayong 72 cultivars. CMR-89 cultivar exhibited higher total probe durations in the phloem salivation and ingestion waveforms, suggesting a greater potential for transmission of the Sri Lankan cassava mosaic virus. The study also examined trichome density and size across the cassava cultivars, revealing that CMR-89 had the highest density and small trichomes, while Huaybong 80 had the lowest density. Trichome characteristics significantly impacted whitefly behavior: larger trichomes were negatively correlated with whitefly settling, whereas higher trichome density was positively correlated with longer settling durations. These findings indicate that trichome-based resistance mechanisms are crucial in whitefly deterrence. Overall, the results suggest that cultivars with lower trichome density and larger trichomes are more resistant to whitefly infestation and subsequent Sri Lankan cassava mosaic virus transmission. These insights are valuable for cassava breeding programs focused on enhancing pest resistance, highlighting the importance of trichome characteristics in developing more resilient cassava varieties.

An improved DNA extraction method in okra for rapid PCR detection of Okra enation leaf curl virus from diverse Indian regions.

The extraction of DNA from okra (Abelmoschus esculentus) is challenging due to its high mucilage and polysaccharide content, which can hinder both the yield and quality of DNA.In this study, an improved DNA isolation method is described incorporating a key modification being the use of solution I (1 M NaCl and 2% Sarcosyl) as a pre-treatment before applying the CTAB buffer, resulting in high-purity genomic DNA in just 1h and 45min., making it suitable for handling large sample sizes due to its rapid processing capabilities. This enhanced DNA extraction method was crucial for the accurate and rapid molecular detection of Okra enation leaf curl virus (OELCuV), a monopartitebegomovirus that has spread across various regions of India. Transmitted by the whitefly (Bemisia tabaci), OELCuV causes leaf curling, enations, and stunted growth in okra, leading to significant yield losses. The surveys conducted during the 2020-21 and 2021-22 sowing seasons revealed disease incidence ranging from 14.03 to 67.57%. The extracted DNA via the improved DNA extraction method enhanced the speed of PCR based molecular identification of OELCuV, using virus-specific coat protein primers. The amplified CP genes were cloned and sequenced to study the CP gene based diversity among OELCuV isolates from different states of India. The CP gene nucleotide identity among the studied OELCuV isolates ranged from 95.57 to 99.27%, while comparison with previously reported Indian OELCuV CP sequences, the nucleotide identity ranged from 89.35 to 98.83%.The successful application of this optimized DNA extraction method sped up the detection process but also holds promise for broader use in the molecular study of okra and other mucilaginous crops, particularly in the rapid and reliable identification ofbegomoviruses. The optimized DNA extraction method significantly accelerated the detection of OELCuV, demonstrating its efficiency and reliability. This method shows strong potential for broader applications in the molecular study of okra and other mucilaginous crops, making it a valuable tool for future research and disease management.

First report of paprika as a natural host plant for tomato chlorosis virus in Korea.

Paprika (Capsicum annuum var. grossum (L.) Sendtn.), also called bell pepper or sweet pepper, is a valuable greenhouse crop that is mostly consumed as fresh fruit in Korea. In 2022, it was cultivated on 726 ha in Korea and 82,042 tons were produced (KOSIS, 2023). In April 2023, interveinal chlorosis and yellowing were observed on the lower and middle leaves of greenhouse paprika in Jinju and Haman, South Korea, and many whiteflies (Bemisia tabaci) were present. The disease incidence was 30-40% on five farms (approximately 4.5 ha) in the two areas. The typical symptoms and presence of whiteflies in greenhouses indicated potential infection by the whitefly-transmitted crinivirus, tomato chlorosis virus (ToCV). Six samples collected from symptomatic plants were examined by leaf dip using transmission electron microscopy (TEM) and revealed filamentous virus particles about 800 nm long. To confirm the TEM results, six symptomatic paprika leaf samples were subject to RT-PCR using the specific primers ToCV-M-4F and ToCV-M-4R to detect ToCV (Choi, 2023). All tested samples were positive for ToCV. To confirm the presence of other viruses and obtain the complete genome sequences, one of the six ToCV-positive samples (ToCV-PAP-JJ6) was subject to high-throughput sequencing (HTS). Total RNA was extracted from symptomatic leaves using the RNeasy Plant Mini Kit (QIAGEN, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to standard protocols. HTS was performed on an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo transcriptome assembly of the 85,668,854 reads with Trinity software (r20140717) yielded 817,303 contigs of 201 to 38,987 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that three large contigs were virus sequences, two of which were homologous to ToCV-RNA1 and -RNA2 and one to bell pepper alphaendornavirus (BPEV). The ToCV-RNA1 (genome 8,594 nt, 11,212 mapped reads, mean read coverage 196.2 times) and ToCV-RNA2 (genome 8,242 nt, 40,122 mapped reads, mean read coverage 734.9 times) contigs showed 100% coverage and 99% base pair matching (8,583/8,594 and 8,233/8,242, respectively) with known genome sequences of ToCV-RNA1 (MG813908) and ToCV-RNA2 (KP114534) isolated from tomato in Korea (Lee et al. 2018). The sequences were deposited in GenBank as isolates ToCV-PAP-JJ6 RNA1 (OR865222) and ToCV-PAP-JJ6 RNA2 (OR865223). The BPEV contig (genome 14,728 nt, 2,928,519 mapped reads, mean read coverage 15,012.4 times) was detected at very high read depth and RT-PCR for BPEV confirmed that all six samples were coinfected with ToCV. BPEV was recently reported in paprika and red pepper in Korea (Jo et al., 2022). The BPEV-infected pepper cultivars have been reported not to produce any symptoms (Escalante & Valverde 2019). ToCV was first reported in tomato greenhouses in Korea in 2013 and is a problematic virus in tomato crops, along with tomato yellow leaf curl virus (Jo et al. 2023; Lee et al. 2018). Due to the continuous presence of ToCV, whiteflies, and natural weed hosts (Kil et al. 2015) in tomato greenhouses, ToCV has spread to other crops, including paprika. To the best of our knowledge, this is the first report of ToCV infecting paprika in Korea. A nationwide study is needed to prevent the spread of ToCV, a new threat to paprika farms.

Efficacy of Biopesticides against Sucking Pests Infesting Moth Bean [Vigna aconitifolia (Jacq.) Marechal

A field experiment was conducted at College of Agriculture, NAU, Bharuch (Gujarat) to study the efficacy of biopesticides against sucking pests of moth bean during kharif -2023. Results revealed that among the different biopesticides tested against sucking pests of moth bean, Beauveria bassiana(1 x 108 cfu g-1), neem oil 0.5% and NSKE 5% was found most effective whereas, treatments of Lecanicillium lecanii (1x 108 cfu g-1) , Metarhizium anisopliae (1 x 108 cfu g-1) and azadirachtin 0.15 EC found moderately effective against jassid, Empoasca motti (Pruthi.) and whitefly, Bemisia tabaci (Genn.) populations. Treatments of neem oil 0.5% and azadirachtin 0.15 EC was found most effective whereas, Beauveria bassiana(1 x 108 cfu g-1) and NSKE 5% found moderately effective against thrips, Caliothrips indicus (Bagnall).

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

The SA-WRKY70-PR-Callose Axis Mediates Plant Defense Against Whitefly Eggs.

The molecular mechanisms of plant responses to phytophagous insect eggs are poorly understood, despite their importance in insect-plant interactions. This study investigates the plant defense mechanisms triggered by the eggs of whitefly Bemisia tabaci, a globally significant agricultural pest. A transcriptome comparison of tobacco plants with and without eggs revealed that whitefly eggs may activate the response of defense-related genes, including those involved in the salicylic acid (SA) signaling pathway. SA levels are induced by eggs, resulting in a reduction in egg hatching, which suggests that SA plays a key role in plant resistance to whitefly eggs. Employing Agrobacterium-mediated transient expression, virus-induced gene silencing assays, DNA-protein interaction studies, and bioassays, we elucidate the regulatory mechanisms involved. Pathogenesis-related proteins NtPR1-L1 and NtPR5-L2, downstream of the SA pathway, also affect whitefly egg hatching. The SA-regulated transcription factor NtWRKY70a directly binds to the NtPR1-L1 promoter, enhancing its expression. Moreover, NtPR1-L1 promotes callose deposition, which may impede the eggs' access to water and nutrients. This study establishes the SA-WRKY70-PR-callose axis as a key mechanism linking plant responses and defenses against whitefly eggs, providing new insights into the molecular interactions between plants and insect eggs.

Whitefly‐Pathogenic Beauveria bassiana JEF‐507 as a Competitive Biopesticide, Chongchae‐Stop

ABSTRACTSilverleaf whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae), is a destructive insect pest damaging to diverse crops by vectoring several plant pathogenic viruses, which consequently causes economic losses in crop production. As the resistance of whiteflies to chemical insecticides is increasing, this study aimed to investigate the potential of entomopathogenic fungi as an alternative. A total of 72 entomopathogenic fungal isolates, collected from soils using Tenebrio molitor larvae as an insect baiting method, were assessed for their virulence against 2nd nymphs of whitefly. Their virulence was assayed by dipping whitefly‐infested tomato leaves in fungal conidia suspensions at 1.0 × 107 conidia/mL. Among the tested isolates, two isolates of Beauveria bassiana JEF‐462 and JEF‐507 showed high virulence. In the assessment of virulence depending on conidia concentrations, the estimated LC50 values for JEF‐462 and JEF‐507 were similarly 8.7–14.0 × 107 conidia/mL. However, B. bassiana JEF‐507 showed higher conidial productivity and thermotolerance on most of tested 12 grain substrates than B. bassiana JEF‐462, and millet was the most suitable grain substrate. Additionally, siloxane as a surfactant was able to sufficiently exhibit the insecticidal activity of JEF‐507 against whitefly nymphs compared with other surfactants. In a pot‐based greenhouse trial, JEF‐507 showed higher control efficacy than chemical insecticides, dinotefuran and spinetoram. This work suggests that B. bassiana JEF‐507 could be competitively used as a biopesticide to control silverleaf whiteflies while overcoming current resistance issues. The JEF‐507 isolate has been registered in Korea, 2022 and successfully commercialised as the name of Chongchae‐Stop in this local market to control whitefly and thrips.

Population fluctuation of the whitefly Bemisia tabaci Gennadius, 1889 (Homoptera - Aleyrodidae) on vegetable crops and effect of two entomopathogenic fungi Verticillium sp. and Paecilomyces sp.

The cotton or sweet potato whitefly, Bemisia tabaci, is a major pest in Algeria, affecting various greenhouse-grown crops. This study aimed to monitor B. tabaci population dynamics on tomatoes, peppers, zucchinis, and strawberries to understand its infestation patterns. The methodology involved regular monitoring of pest activity on these crops and a laboratory bioassay to assess the efficacy of two entomopathogenic fungi, Verticillium sp. and Paecilomyces sp., in controlling the whitefly. Results revealed that B. tabaci was most prevalent on tomatoes, with a 43.73% infestation rate, followed by peppers at 24%, zucchinis at 19.14%, and strawberries at 13.11%. In addition, laboratory trials were conducted to evaluate the efficacy of two entomopathogenic fungi, Verticillium sp. and Paecilomyces sp., in controlling the whitefly. Verticillium sp. showed higher efficacy, achieving a 73% mortality rate, while Paecilomyces sp. resulted in a significantly lower mortality of 23%. These findings suggest that Verticillium sp. holds promise as a biological control agent for managing B. tabaci in Algeria, particularly on tomato crops.

Direct and indirect effects of selective insecticides on 2 generalist predators of Bemisia tabaci (Hemiptera: Aleyrodidae).

Generalist arthropod predators have historically contributed to the suppression of arthropod pests in many agroecosystems. The successful implementation of integrated pest management (IPM) programs hinges on the incorporation of insecticides that are compatible with the biological attributes of natural enemies of pests. A potentially promising pathway is improving biological control by natural enemies through the timely application of selective insecticides. In our study, adult predators were exposed to commercially available insecticides (cyantraniliprole and pyriproxyfen) using a combined laboratory and field approach to assess their effects on survivorship and predation. We isolated 2 predators, Hippodamia convergens Guérin-Méneville and Geocoris punctipes (Say), in the laboratory to estimate the survivorship and consumption of whitefly nymphs, Bemisia tabaci (Gennadius). In the field, we deployed whitefly nymph-infested potted cotton plants in replicated cotton plots with both insecticide treatments. We enumerated whitefly nymph populations on enclosed (predator-exclusion) and open (predator-accessible) potted plants. While pyriproxyfen had a negligible effect on the predators, cyantraniliprole exposure directly affected H. convergence by reducing survivorship duration and indirectly influenced both predators by reducing prey consumption and altering the consumption of alternative prey. In field conditions, regardless of pesticide exposure, whitefly-infested potted plants that excluded predators had more whiteflies than predator-accessible potted plants. Overall, pyriproxyfen demonstrated minimal impact on the predators in the laboratory or field, while cyantraniliprole adversely influenced mortality and indirect foraging under controlled laboratory conditions but did not have a significant impact in the field.

Commodity risk assessment of Petunia spp. and Calibrachoa spp. unrooted cuttings from Costa Rica.

The European Commission requested the EFSA Panel on Plant Health to evaluate the probability of entry of pests (likelihood of pest freedom at entry), including both regulated and non-regulated pests, associated with unrooted cuttings of the genera Petunia and Calibrachoa produced under physical isolation in Costa Rica. The relevance of any pest for this opinion was based on evidence collected according to specific criteria, following the methodology used for high-risk plants adapted for the specificity of this assessment. Twenty-two EU regulated pests (beet curly top virus, Bemisia tabaci, Chloridea virescens, Eotetranychus lewisi, Epitrix cucumeris, Epitrix tuberis, euphorbia mosaic virus, Helicoverpa zea, Liriomyza huidobrensis, Liriomyza sativae, Liriomyza trifolii, pepper golden mosaic virus, potato spindle tuber viroid, Ralstonia pseudosolanacearum, Ralstonia solanacearum, Spodoptera ornithogalli, squash leaf curl virus, Thrips palmi, tomato golden mosaic virus, tomato leaf curl Sinaloa virus, tomato spotted wilt virus, tomato yellow leaf curl virus) and one pest that is not regulated in the EU (Aleurodicus dispersus) fulfilled all relevant criteria and were selected for further evaluation. For these pests, the risk mitigation measures proposed in the technical dossier from Costa Rica were evaluated taking into account possible factors limiting their efficacies. Additionally, an expert judgement is given on the likelihood of pest freedom taking into consideration the risk mitigation measures acting on the pest, including uncertainties associated with the assessment. The estimated degree of pest freedom varies among the pests evaluated, with tomato spotted wilt virus being the pest most frequently expected on the imported cuttings. The expert knowledge elicitation indicated, with 95% certainty that between 9927 and 10,000 bags containing unrooted cuttings of Petunia spp. and Calibrachoa spp. per 10,000 would be free of tomato spotted wilt virus.

Impact of transinfection of Wolbachia from the planthopper Laodelphax striatellus on reproductive fitness and transcriptome of the whitefly Bemisia tabaci

The whitefly Bemisia tabaci is critical global pest threatening crops and leading to agricultural losses. Wolbachia is an intracellular symbiotic bacterium in insects, which can regulate the growth and development of the host through various ways. In a prior study, Wolbachia was found to be transferred to whitefly and induce fitness changes. However, little is known about the underlying mechanisms of host-Wolbachia interactions in B. tabaci. In this study, a Wolbachia strain wStri was isolated from the small brown planthopper, Laodelphex striatellus, and transferred to B. tabaci. The distribution of Wolbachia in whiteflies was determined using fluorescence in situ hybridization. Reciprocal crossing experiments demonstrated that wStri did not induce cytoplasmic incompatibility phenotypes in B. tabaci, but prolonged the developmental duration of the offspring. We performed transcriptomic analysis of Wolbachia-infected female and male adults using Illumina-based RNA-Seq. A total of 843 differentially expressed genes (DEGs) were identified in infected females, among them 141 were significantly up-regulated and 702 were down-regulated by Wolbachia infection. In infected males, of 511 gene sets, 279 host genes were significantly up-regulated, and 232 were down-regulated by Wolbachia infection. KEGG analysis of DEGs demonstrated significant differences in gene pathway distribution between up-regulated and down-regulated genes. These genes are involved in various biological processes, including, but not limited to, detoxification, oxidation–reduction, metabolic processes, and immunity. The transcriptomic profiling of this study offers valuable information on the differential expression of genes in whiteflies following Wolbachia infection, and enhances our understanding of this host-symbiotic interaction.

Primer reporte de Bemisia tabaci (Gennadius, 1889) (Hemiptera: Aleyrodidae), biotipos B y Q, en soja Glycine max (L.) Merrill (Fabales: Fabaceae) en Paraguay

Whiteflies (Hemiptera: Aleyrodidae) are significant agricultural pests worldwide, primarily because they act as vectors for various plant viruses, including geminiviruses. Additionally, whitefly activity fosters the development of fungal colonies, such as sooty mold (Capnodium spp.), which grows on the sugary secretions (honeydew) produced by these insects. The presence of sooty mold reduces the plant’s photosynthetic capacity, further worsening the negative impact on its growth and development. Together, these factors make whitefly control a challenge for farmers, who must implement integrated pest management strategies to mitigate both the direct damage and the associated diseases that whiteflies can spread. Although approximately 1,200 species of whiteflies have been described, fewer than 40 are considered primary pests, with Bemisia tabaci (Gennadius, 1889) and Trialeurodes vaporariorum (Westwood, 1889) responsible for the greatest agricultural losses worldwide. The emergence of B. tabaci biotypes has prompted significant research, as these biotypes have been linked to economic damage to crops in several nations of the Americas, including Argentina and Brazil. In Paraguay, there is a need to identify local biotypes of B. tabaci led to the collection of whitefly samples from soybean plots in Capitán Miranda and Natalio, Itapúa, Paraguay. DNA was extracted using the Wizard genomic purification kit, followed by PCR amplification of the mitochondrial cytochrome oxidase I (mtCOI) region using specific primers for B. tabaci and T. vaporariorum. Agarose gel electrophoresis confirmed the presence of B and Q biotypes of B. tabaci in both Paraguayan locations, with no detection of T. vaporariorum. Sequencing of the PCR products revealed a 100% match with known sequences for B. tabaci and its biotypes, as confirmed by GenBank BLAST analysis. This research highlights the critical importance of continuously monitoring the population dynamics and geographical distribution of different biotypes. While the expansion of a polyphagous and dynamic pest like the whitefly cannot always be prevented, constant monitoring enables early detection of its spread and allows for the adjustment of management strategies tailored to each region. These measures will not eliminate the pest but will help mitigate damage and manage the problem sustainably and efficiently. The study also emphasizes the need to the effectiveness of insecticides, as resistance has been reported in other countries—an issue not yet explored in Paraguay.

Occurrence of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Middle East–Asia Minor 1 (MEAM1) and Mediterranean (MED) in Commercial Fields of Solanum lycopersicum in Brazil

The tomato (Solanum lycopersicum) is an important crop to the economy of Brazil, and the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is one of the limiting factors responsible for reducing its yields. These insects are part of a cryptic species group present across almost the entire globe. The most relevant cryptic species in the world are B. tabaci MEAM1 and MED due to their capability to adapt and cause damage to vegetables, grain, and ornamental crops. The arrival of MED in Brazil through the state of São Paulo represents risks to farmers in the region due to the difficulty in managing these insects. This study assessed the occurrence of both species in tomato crops in the southeastern region of Brazil in 2020 and 2021. An amount of 79 samples containing 767 insects were collected throughout the study period, and in the cities of Sumaré (SP) and Monte Mor (SP), several samples were collected from the same location throughout the year. The insects were stored and sent for molecular analysis. The results showed an increase in MED compared to MEAM1. The presence of MED in the Minas Gerais samples was not recorded. However, a higher percentage of MED was observed in the state of São Paulo, which was detected in the municipalities of Sumaré and Monte Mor. These results possibly indicate that MED could be starting to stabilize in open tomato fields in Brazil.