Surface Sterilization Research Articles

Enabling biocontained plant virus transmission studies through establishment of an axenic whitefly (Bemisia tabaci) colony on plant tissue culture.

Whiteflies (Bemisia tabaci) and the diseases they transmit are a major detriment to crop yields and a significant contributor to world hunger. The highly evolved interactions of host plant, phloem-feeding insect vector with endosymbionts and persistently transmitted virus represent a tremendous challenge for interdisciplinary study. Presented here is the establishment of a colony of axenic whiteflies on tissue-cultured plants. Efficient colony establishment was achieved by a surface sterilization of eggs laid on axenic phototrophically tissue-cultured plants. The transfer of emerging whiteflies through coupled tissue culture vessels to new axenic plants facilitates robust subculturing and produces hundreds of whitefly adults per month. Whitefly proliferation on more than two dozen plant species is shown as well as in vitro testing of whitefly preference for different plants. This novel multi-organism system provides the high-level of biocontainment required by Federal permitting to conduct virus transmission experiments. Axenic whitefly adults were able to acquire and transmit a begomovirus into tissue-cultured plants, indicating that culturable gut microorganisms are not required for virus transmission. The approach described enables a wide range of hypotheses regarding whitefly phytopathology without the expense, facilities, and contamination ambiguity associated with current approaches.

Surface immobilization and properties optimization of phage hydrolase against Gram-negative bacteria

Immobilized hydrolase not only reduces the production of antibiotic-resistant bacteria, but also effectively improves the stability of hydrolase in external use. In this study, phage hydrolase LysSSE1 against Gram-negative bacteria were surface immobilized and optimized for their bactericidal activity. Different anti-pathogen surface materials were prepared, where LysSSE1 was immobilized on the glass surface with a silica-affinity peptide and into which different peptide linkers were introduced. Immobilized enzymes inserted into the natural amino acid peptide linker exhibited higher bactericidal activity, greater stability, and more consistent bactericidal performance compared to those without the peptide linker. Among these immobilized enzymes, LysSSE1-NL-SiAP1 exhibited the strongest bactericidal activity and the best repeatable bactericidal performance, which only reduced the original performance by about 5% after three bactericidal cycles. Modeling analysis suggested that the presence of peptide linker might increase the molecular flexibility of the proximal hydrolase domain to better interact with the bacterial substrate. Our surface immobilization strategy could be extended to other lytic proteins, providing support for the development of surface sterilization methods and materials.

First Report of Alternaria alternata Causing Leaf Spot of Magnolia delavayi in China

Magnolia delavayi, known as Delavay's magnolia or Chinese evergreen magnolia, is an enchanting deciduous tree native to southwestern China (Xu et al. 2020). In March 2024, leaf spots were observed on M. delavayi plants at Qujing Normal University (25.527°N, 103.744°E), Qujing, Yunnan, China. About 80% of the trees (n=92) on campus were infected, with infected leaves accounting for about 10 to 30% of all leaves. The leaf spots exhibited a round or oval shape, with a yellowish-brown center and a brown outer ring. As the spots expanded, the leaves gradually dried up and fell off. Five symptomatic leaves were collected from the middle sections of five diseased plants. Tissue samples (5 × 5 mm) were excised from the lesion margins and subjected to surface sterilization in 75% ethanol for 30 seconds and 1% sodium hypochlorite for 60 seconds. They were then rinsed three times with sterile water and dried on sterilized paper. The samples were plated on potato dextrose agar (PDA) and incubated at 28 °C for 3 days. Developing colonies were retransferred to new PDA and purified by the hyphal tip technique (Senanayake et al. 2020). Two representative isolates (SYL1 and SYL2) were selected and confirmed to be the same species based on morphological characteristics and molecular identification. On PDA, the fungal colonies initially appeared grayish-white and turned dark gray over time with cotton-like aerial hyphae on the surface. The conidia are light brown, pear-shaped or rod-shaped, with 1 to 4 transverse septa and 0 to 1 oblique septa, and measured 5.4 to 12.7 × 10.4 to 25.7 μm (n = 50). Molecular identification was performed by partial sequencing of the internal transcribed spacer (ITS: ITS4/ITS5) region, glyceraldehyde 3-phosphate dehydrogenase (GAPDH:gpd1/gpd2), translation elongation factor 1-alpha (TEF1:EF1/EF2), and Alternaria major allergen (Alt a 1:Alt-for/Alt-rev) (Woudenberg et al. 2015). The resulting sequences of ITS (PP951882, PP951883), GAPDH (PP968942, PP968943), Alt a 1(PP968940, PP968941) and TEF1 (PP968938, PP968939) were deposited in GenBank. BLAST analyses revealed that the sequences from these two isolates showed 100% identity with those from Alternaria alternata strains for each gene. Additionally, a multigene phylogenetic analysis revealed a distinct group containing SYL1, SYL2 and other A. alternata strains with a posterior probability of 100%. The morphological and phylogenetic evidence collectively suggested that the two isolates belonged to A. alternata. Strain SYL1 was used for the pathogenicity test on three 5-year-old M. delavayi plants on campus. Three healthy leaves of each plant were punctured with a sterile needle and sprayed with 20 μl of spore suspension (1 × 106 conidia/ml). Similarly, another nine wounded leaves were sprayed with 20 μl of sterile water. All inoculated leaves were enclosed in plastic bags for 48 hours. Disease symptoms were observed on leaves inoculated with spore suspension after 7 days, while control plants remained healthy. This experiment was repeated three times with same results. To fulfill Koch’s postulates, A. alternata was reisolated from the inoculated leaves and identified based on morphological characteristics and ITS sequencing. To our knowledge, this is the first report of A. alternata causing leaf spot on M. delavayi in China. This research expands the known host range of this pathogen and provides relevant information to the design of disease management strategies.

Asaia spp. accelerate development of the yellow fever mosquito, Aedes aegypti, via interactions with the vertically transmitted larval microbiome.

A wide range of vector control programmes rely on the efficient production and release of male mosquito. Asaia bacteria are described as potential symbionts of several mosquito species but their relationship with Aedes aegypti has never been rigorously tested. Here, we aimed to quantify the benefits of three Asaia species on host development in Ae. aegypti, and the ability of these bacteria to form a stable symbiotic association with growing larvae. In order to disentangle direct and indirect effects of Asaia inoculation on host development, experiments used insects with an intact microbiome and those reared in near-aseptic conditions, while we characterized bacterial communities and Asaia densities with culture dependent and independent methods (16S rRNA amplicon sequencing). Neonate larvae were inoculated with Asaia spp. for 24 h, or left as uninoculated controls, all were reared on sterile food. Aseptic larvae were produced by surface sterilization of eggs. Although all Asaia were transient members of the gut community, two species accelerated larval development relative to controls. The two mutualistic species had lasting impacts on the larval microbiome, largely by altering the relative abundance of dominant bacteria, namely Klebsiella and Pseudomonas. Axenic larvae were dominated by Asaia when inoculated with this species but showed slower development than conventionally reared insects, indicating that Asaia alone could not restore normal development. Our results reveal Asaia as a poor mutualist for Ae. aegypti, but with a species-specific positive effect on improving host performance mediated by interactions with other bacteria.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Surface sterilization and moist storage conditions for recalcitrant seeds of three Asian tree species

Ex situ storage of recalcitrant seeds is challenging, due to seed-desiccation sensitivity. Various moist storage techniques have been used to store seeds, but moist conditions also promote fungal infection. This study determined suitable sterilizing agents for surface cleaning and suitable moist storage conditions for three tree species: Heynea trijuga Roxb. ex Sims, Neocinnamomum caudatum (Nees) Merr., and Phoebe lanceolata (Nees) Nees. We used a factorial design with three factors: sterilizing agents, storage temperature and storage media. There were four surface-sterilization treatments: no sterilization (control), 70% ethanol, 3% NaOCl, and 25% metalaxyl. Seeds were stored with two storage media (moist sand and moist filter paper) and at two storage temperatures (room temperature and 4 °C). Percentage fungal infection and seed germination were recorded. For H. trijuga and P. lanceolata, 3% NaOCl (five-minute soaking) was the best sterilizing agent, whilst N. caudatum had no optimal sterilizing agent. We recommend storing seeds with moist storage media at 4 °C. The best storage media for H. trijuga was moist filter paper, while for P. lanceolata either moist sand or filter paper was suitable. However, N. caudatum seeds should be sown immediately after collection. Our findings emphasize the importance of testing individual species to determine optimal techniques for surface sterilization and storage.

Molecular phylogenetic characterization of L-asparaginase-producing endophytic fungi inhabiting Prunus africana and Periploca linearifolia: Effect of incubation time and pH on enzyme production

The therapeutic use of L-asparaginase derived from bacterial sources has been constrained by various challenges, including toxicity and repression. This has prompted the exploration of alternative sources, particularly eukaryotic microorganisms like fungi, to enhance the safety and effectiveness of the L-asparaginase enzyme. This study aims to investigate the fungal endophytes inhabiting Periploca linearifolia and Prunus africana as a potential source of novel L-asparaginase. Additionally, the study seeks to examine the impact of incubation time and pH on L-asparaginase production. Standard surface sterilization techniques were used for isolation of endophytic fungi. Based on the research findings, 24 % of the fungal endophytes demonstrated a positive reaction for L-ASNase activity and were identified as Colletotrichum sydowii, Fusarium sporotrichioides, Fusarium solani, Cercospora canescens, Penicillium crustosum, Penicillium pancosmium, Phoma sp, Penicillium ubiquetum, septoria sp and Penicillium commune. A significant variation in the production of L-asparaginase based on the time of incubation and pH was observed. Most endophytic fungal isolates exhibit optimal enzyme activity on the 6th day of incubation. However, both Septoria sp and Colletotrichum sydowii recorded the highest L-asparaginase activity on the 9th day of incubation. Fusarium solani demonstrated peak activity of 12.4 ± 1.12 UI/mL on the 12th day of incubation. The optimal pH for L-asparaginase production by fungal endophytes was found to be between 5 and 6. The fungal endophytes isolated from medicinal plants have the potential to serve as sources of novel L-asparaginase. Furthermore, it is evident that fungal endophytes display considerable variation in L-asparaginase production, influenced by the duration of incubation and pH conditions.

Assessment of Surface Sterilisation Approaches for the Removal of Pollen DNA from Philaenus spumarius.

Dietary analysis of herbivorous insects relies on successfully eliminating surface contamination. If this cannot be performed reliably, then it will not be possible to differentiate between plants that the insect is feeding on and plants the insect has been in contact with, either directly or via pollen. Methods in the literature often use bleach and alcohol washes to remove contamination. We perform a controlled metabarcoding baseline study on a herbivorous, xylem-feeding insect, the Meadow Spittlebug (Philaenus spumarius), using Oxford Nanopore Technologies (ONT) sequencing, and identify possible contamination that persists after washes. Despite the reported success of methods in the literature, we find that contamination is still present, leading to possible false-positive results. We hypothesise that pollen is the main source of contamination, its robust nature making it difficult to remove, and conduct a further three experiments with the goal of removing pollen from the surface of Philaenus spumarius. This study investigates the effectiveness of robust bleach/Tween/alcohol washes, sterile gut excision (including combined with Distel application), and ultraviolet light as alternative sterilisation approaches. Overall, our findings indicate that we are unable to remove surface contamination and still detect signals that may originate in the gut. In no experiment did we unequivocally detect plant DNA that originated in the P. spumarius gut.

Efficient Surface Sterilant for Establishment of Dendrobium in vitro Culture

Background: Most orchid species in the Dendrobium genus are epiphytic. Dendrobium orchid (Dendrobium nobile L.) var. Sonia is a non-woody epiphytic orchid that bears a beautiful purple-coloured flower and grows in soilless medium. Dendrobium can be propagated vegetatively through divisions or Keikis. But this propagation method is extremely slow. Micropropagation is most suitable method for multiplication of dendrobium orchids. Surface sterilization is an important step in the preparation of vigorous and viable explants in micropropagation. Most of the surface contaminants can be abolished by surface sterilization with a suitable sterilizing agent. The aim of the investigation is to present an effective disinfection method for the aseptic culture of Dendrobium var. Sonia by using nodal segments. Methods: In the present investigation, two sterilant were employed namely mercuric chloride (HgCl2) and sodium hypochlorite (NaOCl) at different concentrations and durations. A total of nine combinations were tried for treating nodal explants in this investigation during 2022-2023. Explants were surface sterilized with 70% ethanol for 5 minutes followed by 3 to 4 washes with sterile distilled water. Thereafter, the explants were subjected to different surface sterilization treatments to establish contamination free cultures. Result: The study revealed that among the 9 treatments, minimum contamination (30.40%) was recorded in 0.1% HgCl2 for 10 minutes which helps in the maximum establishment of healthy culture (69.60%). Whereas, the lowest result for establishment was found in autoclaved distilled water with maximum contamination (100%). Maximum explant mortality (20.80%) due to sterilant was observed in NaOCl (2%) for 20 minutes.

Microwave Plasma Pencil for Surface Treatment: Numerical Study of Electromagnetic Radiation and Experimental Verification.

An atmospheric pressure plasma source of the microwave plasma pencil type utilizing a coaxial line is presented. The generated plasma takes the form of a cylinder up to about 30 mm long and up to 5 mm in diameter. It is suitable for surface sterilization, surface treatment, and material processing. This study numerically analyzes the electromagnetic radiation emitted by the plasma pencil, which compromises performance and poses safety risks. Electric field distributions, radiation patterns, the ratio of the power entering the discharge to the incident wave power, and the ratio of radiated power to entering power were numerically investigated for different plasma parameters and pencil lengths. Results indicate that increasing electron density, gas temperature, plasma length, and pencil length increases the radiated power by up to more than 60% of the entering power, and the radiation patterns can be highly non-uniform with strong backward lobe. The numerical finding were qualitatively confirmed experimentally. It was also found that it is possible to reduce radiation from the device by using appropriately designed cones, the presence of which does not impede its performance.

Comprehensive study on explant surface sterilisation of in vitro culture of bamboo species (Bambusa balcooa)

Comprehensive study on explant surface sterilisation of in vitro culture of bamboo species (Bambusa balcooa)

CuO/ZnO heterojunction nanofilm for effective photocatalytic disinfection

Pathogenic bacteria can spread rapidly from contaminated surfaces to human skin once humans touch such surfaces, resulting in contact infection and subsequent bacterial infectious diseases. In addition to the bacterial drug resistance induced by overuse of antibiotics, the commonly used antibiotic bacteria-killing strategy is unsuitable for surface sterilization of facilities. Herein, a heterojunction CuO/ZnO nanofilm was constructed on glass plates by calcination and atomic layer deposition. This film exhibited excellent photocatalytic antibacterial activity under visible light. The heterostructure between CuO and ZnO at the interface accelerated the separation of photogenerated electrons and holes, resulting in increased yield of reactive oxygen species, which effectively kill bacteria. After 5 min of simulated sunlight irradiation, the antibacterial efficiencies of CuO/ZnO against Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli) were 99.68 ± 0.31 % and 96.49 ± 0.78 %, respectively. The photocatalytic antimicrobial nanofilm synthesized in this study can potentially be used for rapid and safe disinfection of contact surfaces in public facilities.

Assessment of Sterilants and their Combined Effect on Surface Sterilization of <i>Musa Spp</i>

Assessment of Sterilants and their Combined Effect on Surface Sterilization of <i>Musa Spp</i>

Comprehensive phytochemical analysis of Salvia hispanica L. callus extracts using LC-MS/MS.

In this research, the study utilized the root, leaf, and petiole parts of in vitro grown Salvia hispanica plants as explants. Following UV-C treatment applied to developing callus, methanol extracts were obtained and analyzed using liquid chromatography-mass spectrometry (LC/MS) to investigate their anticancer properties. First, the seeds of S. hispanica were soaked in commercial bleach for 6 min to ensure surface sterilization. The most effective antimicrobial activity on Gram-negative bacteria, with a zone diameter (11 ± 0.82 mm), was noticed in callus extracts obtained from the petiole explant in the second protocol against Klebsiella pneumoniae EMCS bacteria. Anticancer activities on SH-SY5Y human neuroblastoma cells were investigated by using 1000, 500, 250, 125, 62.5, 31.25, 15.62, and 78.12 μg/mL doses of the extracts, and the most effective cytotoxic activity was determined at the 1000 μg/mL dose of the extracts obtained from both protocols. The extracts were determined to inhibit hCAI, hCAII, AChE, and BChE enzymes. The content of 53 different phytochemical components of the extracts was analyzed by liquid chromatography with tandem mass spectrometry (LC-MS/MS). Rosmarinic acid, quinic acid, and caffeic acid were found in the highest concentration. The comprehensive LC-MS/MS analysis of S. hispanica extracts revealed a diverse array of phytochemical compounds, highlighting its potential for therapeutic applications.

First Report of Colletotrichum gloeosporioides Causing Leaf Blight on Cercis chinensis Bunge in China.

Cercis chinensis Bunge, commonly used as an ornamental plant, is native to southeastern China and extensively cultivated in gardens across major cities in the country. In August 2023, a new high-incidence disease was discovered at Huangshan University in Huangshan, Anhui Province, China. The symptoms initially began as small brown spots, which gradually expanded into large irregular brown spots with black-brown edges. The disease was investigated at both Jilingshan Park and Huangshan University, where C. chinensis Bunge was planted, revealing an average incidence rate of was 85 % at these sites. Seventy two leaf tissue samples (3 to 4 mm²) were collected from the margins of the lesion and subjected to surface sterilization with 75% ethanol for 30 seconds followed by 1% sodium hypochlorite for 90 seconds. Subsequently, the tissues were rinsed with sterile H2O, placed on potato dextrose agar (PDA) medium, and incubated at 25℃ for 5 days. The same fungus was isolated from 90% of the tissues, and pure cultures were obtained by monosporic isolation. Representative isolates ZJ 2-1, ZJ 2-2 and ZJ 2-3 were selected for morphological and molecular characterization. The colonies displayed a color range from white to gray, with white margins and aerial hyphae, while the reverse side of the colonies appeared gray to brown. Conidia were cylindrical, aseptate, with obtuse to slightly rounded ends, measuring 15.8±1.8×4.7±0.56 μm (n = 50). The morphological characteristics were generally consistent with those of Colletotrichum gloeosporioides species complex (Weir et al. 2012). Five conserved regions of isolates (ZJ 2-1, ZJ 2-2 and ZJ 2-3), including the internal transcribed spacer (ITS), glutamine synthase (GS), calmodulin (CAL), actin (ACT), and chitin synthase 1(CHS1) gene regions, were amplified using specific primers ITS1/ITS4 (Gardes et al. 1993), GSR1/GSF1 (Guerber et al. 2003), CL1C/CL2C (Li et al. 2018), ACT-512F/ACT-783R, and CHS-79F/CHS-345R (Zhu et al. 2019), respectively. Using the BLAST, ITS, GS, CAL, ACT and CHS1 gene sequences (GenBank accession nos. PP514751, PP448025, PP448026, PP448027 and PP448028, respectively) were 100% (594 out of 594 bp), 100% (864 out of 864 bp), 100% (299 out of 299 bp), 100% (732 out of 732 bp) and 100% (282 out of 282 bp) identical to C. gloeosporioides (GenBank accession nos. JX010152, JX010085, JX009818, JX009731 and JX009531, respectively). A Maximum Likelihood phylogenetic tree, constructed by combining all sequenced loci in MEGA7, showed that the isolates ZJ 2-1, ZJ 2-2 and ZJ 2-3 clustered within the C. gloeosporioides clade with 99% bootstrap support (Fig. S1). To fulfill Koch's postulates, five C. chinensis Bunge plants were tested for pathogenicity in the field with isolates ZJ 2-1, ZJ 2-2 and ZJ 2-3 at Huangshan University. Twelve leaves from each tree were wounded and inoculated with mycelial plugs (approximately 4 mm in diameter) and 10 μl of a spore suspension (1.0 × 106 conidia/ml) of C. gloeosporioides. Inoculation with sterile PDA plugs and pure water on leaves of each tree served as negative controls. Plastic bags were used to wrap the leaves, and sterile H2O was sprayed into the bags to maintain moisture conditions (Zhang et al.2020). The experiment was repeated two times, and within 5 days, all inoculated points displayed lesions similar to those observed in the field, whereas controls remained asymptomatic (Fig. S2). The same fungus was reisolated from these lesions with a frequency of 100%. Consequently, the pathogen responsible the disease in C. chinensis Bunge was identified as C. gloeosporioides. To the best of our knowledge, this is the first report of C. gloeosporioides causing leaf blight on C. chinensis Bunge in China. This study provides valuable insights for implementing targeted measures to control leaf blight on C. chinensis Bunge and lays a foundation for the prevention and treatment of the disease.

Physical and chemical characteristics of plasma-activated water generated by hybrid dielectric barrier discharge and gliding arc discharge

This research explores the synergistic application of Dielectric Barrier Discharge (DBD) and Gliding Arc Plasma Jet (GAPJ) in a Hybrid Plasma Discharge (HPD) setup for enhanced water activation. The HPD system demonstrated balanced and sustained generation of reactive oxygen and nitrogen species (RONS), maintaining efficiency at higher specific input energy (SIE) values. Comparative analyses with DBD and GAPJ systems highlighted the superior performance of the HPD system in generating RONS and modifying water’s molecular structure. Key observations included a decrease in water’s pH and an increase in oxidation-reduction potential, total dissolved solids, and conductivity, stabilizing beyond 5 l min−1 airflow and 10 min of treatment. UV−Vis spectroscopy identified nitrites, nitrates, hydrogen peroxide, and nitrous acid, while Raman spectroscopy captured shifts in vibrational modes, particularly in librational and O–H stretching bands. These changes correlated with alterations in reactive species concentrations and pH levels. Overall, the HPD system emerged as a versatile and efficient approach for generating plasma-activated water, suitable for applications in microbial deactivation, surface sterilization, and electrocatalytic process optimization, offering stable and continuous production of reactive species across a range of SIE values.

First Report of Agroathelia rolfsii Causing Southern Blight on Lippia (Phyla canescens) in Guangzhou, China.

Lippia (Phyla canescens) is a fast-growing, mat-forming, and prostrate perennial plant well adapted to infertile, high-saline, and drought environments (Leigh, et al. 2004). It arrived in China from Japan as a flowering ground cover in 2001 (Cai, et al. 2004). In June 2022, southern blight appeared in our nursery of the Floriculture Research Institute of Guangdong Academy of Agricultural Sciences. High temperature and damp environment are major factors for this disease. The symptoms of top-layer plants were not easily detected, but they were slightly yellowed. A yellowish-brown water-soak lesion appeared on the stems and lowest leaves exposed to soil. White mycelium appeared in the middle stage. Finally, the surface plants showed water-soak decay, and a mass of beige to black-brown rapeseed-shaped sclerotia appeared on the residue and surrounding soil; these plants died. Sclerotia and mycelia were collected from disease tissue, and after surface sterilization, sclerotia was cultured on potato dextrose agar (PDA) at 28±2°C in an incubator without light. Eight fungal isolates with similar colony morphologies were consistently isolated by purifying from different sampling areas. The isolates exhibited obvious septa and a clamp connection structure within the white mycelium. The average growth rate was 26.86±0.06 mm/day. Numerous white granular sclerotia were produced on the mycelium 6 days later. The sclerotia with a diameter of 1.24±0.07mm (n=189) gradually changed from diage to yellow to brown. A typical strain B1 was selected for further identification, targeting its 18S rRNA and LSU rRNA sequences (Yang, et al. 2011; Xue, et al. 2019). Its 18S rRNA sequence (GenBank Accession No. OR517233, 1626 bp) is 99.63% and 99.57% identical to Athelia rolfsii (AY665774, 1179bp; KC670714, 1775bp; JF819726, 1781bp). Its LSU rRNA sequence (OR539570, 757 bp) is 99.87% identical to Agroathelia rolfsii (OR526537, 904 bp). For Athelia rolfsii, a synonym of Agroathelia rolfsii, by combining the morphological characteristics and molecular identification, the isolate pathogen B1 was confirmed to be Agroathelia rolfsii (the teleomorph of Sclerotium rolfsii). To fullfill Koch's postulates, we inoculated the mycelial plugs to healthy lippia stems and leaves which has grown for one year, with PDA plugs free of mycelium as the control. All the plants were kept in a greenhouse at 28±2°C with a 14-h photoperiod and 80% relative humidity. Each treatment was repeated thrice and vaccinated with 6 points. At 7 d following inoculation, all plants inoculated with B1 showed typical symptoms, but the control group was asymptomatic, and sclerotia appeared 17d after inoculation. Using the same protocol mentioned above, pathogenic fungal was reisolated only from treated groups, but not from the control group. Chose three of the pathogens for 18S rRNA and LSU rRNA sequencing, the results showed 100% identity to B1, the same as its microstructure. There are few reports about the disease on P. canescens. Sosa (2007) investigated the pathogens on P. canescens in Argentina, 16 fungi were found but no A. rolfsii. Sclerotium rolfsii were identified on P. nodiflora or P. lanceolata (Michaux) Greene in America (Farr, et al. 1989). To our knowledge, this is the first report in China. Because this pathogen has wide-ranging hosts and causes serious damage, the results from this study will offer guidance for the prevention and treatment of this disease.

The effect of bending angle on a flexible electrode DBD plasma under sinusoidal excitation

There is a critical demand for sophisticated surface disinfection and sterilization devices accessible to the public by using cold atmospheric pressure air plasmas. A flexible printed circuit design of a dielectric barrier discharge reactor under non-bending and two bending configurations with an angle of 120° and 180° was studied. The characteristics of power consumption, the optical emission spectrum, dynamic process, electrode temperature and ozone concentration are evaluated. The non-bending configuration produces more O3, as compared to the bending configuration at the same applied voltage. The 180° configuration has a maximum concentration of excited species at the expense of higher electrode temperature. Both bending configurations demonstrated the propagation of filaments to bending axis where the continues luminescence is observed due to the high electrical field. The energy efficiency for plasma-generated reactive species reaches to 40% for non-bending configuration and decreases with the increase of bending angle. This research provides a new strategy for perspective into the plasma generated reactive species in biomedical and environmental applications.

Micropropagation and cryopreservation of the rare endemic Colchicum figlalii germplasm

BACKGROUND: The natural population of Colchicum figlalii (Varol) Parolly & Eren grows in a narrow area of serpentine rock clearings at an altitude of 1900-2100 m in Southwestern Anatolia (Sandras Mountain, Mugla, Turkey). The species is regarded as endangered according to the IUCN Red List Categories. OBJECTIVE: To develop an optimum procedure for in vitro propagation and cryopreservation of germplasm of this rare endemic. MATERIALS AND METHODS: A total of 281 bulbs were used as in vitro culture starting material and after surface sterilization, clean material was obtained from 157 of them. Woody Plant Medium (WPM), Olive Medium (OM), and Murashige and Skoog medium (MS) were used for in vitro culture establishment. RESULTS: The maximum regeneration rate (˜67.3%) was obtained after four weeks of incubation on OM. The calli were successfully induced by using OM supplemented with 10.7 μM NAA from leaves of in vitro grown C. figlalii bulbs. A PVS2-vitrification procedure was used for cryopreservation of C. figlalii callus tissue. After cryo-storage, the best result for regeneration (66.7%) was obtained from calli treated with PVS2 for 75 min before plunging into liquid nitrogen. All rooted seedlings derived from cryopreserved calli were successfully acclimatized to greenhouse conditions. CONCLUSION: This study is an effective reference for future long-term conservation of similar species that are difficult to cryopreserve.

Development of a Suitable in vitro Regeneration Protocol for Rahangala Pear (Pyrus pyrifolia L.) in Sri Lanka

The limitation of planting material is the major drawback to expanding pear cultivation in Sri Lanka. Hence, an in vitro protocol was developed to produce planting material for the pear variety of Rahangala. Pear shoots were used as explants and surface sterilization of explants was done using 0.5% and 1% (w/v) AgNO3 for 15 min, 5% and 10% (v/v) NaOCl for 5, 10 and 15 min. In vitro shoot multiplication and root induction were found to be suitable in full and half strengths of MS medium respectively supplemented with various concentrations of BAP (1, 1.5, 2, 2.5, 3 mg/l), IBA (0, 0.5, 1, 2, 3, 4 mg/l) and NAA (0.1 mg/l). Acclimatization was conducted in pots containing different proportions of topsoil, compost, coir dust and sand. Completely Randomized Design (CRD) was used as an experimental design for this study. During sterilization of explants, the survival rate of 86.6% was recorded after 3 weeks where the treatment was done with 1% AgNO3, and 10% NaOCl for 10 min. BAP (3.0 mg/l) produced the best shoot multiplication (1.46 ± 0.2). Significantly (p<0.05), the highest mean number of roots (1.93 ± 0.98), average length (60.6 mm), and rooting percentage (68%) were observed in ½ MS medium with 4.0 mg/l IBA. After five weeks of transplantation in pots, 100% of plantlets survived in topsoil, compost, coir dust, and sand in a ratio of 1:1:1:1 Plant Tissue Cult. & Biotech. 34(1): 25-33, 2024 (June)