Sucrose Transporter Research Articles

ZmCCD8 regulates sugar and amino acid accumulation in maize kernels via strigolactone signalling

SummaryHow carbon (sucrose) and nitrogen (amino acid) accumulation is coordinatively controlled in cereal grains remains largely enigmatic. We found that overexpression of the strigolactone (SL) biosynthesis gene CAROTENOID CLEAVAGE DIOXYGENASE 8 (CCD8) resulted in greater ear diameter and enhanced sucrose and amino acid accumulation in maize kernels. Loss of ZmCCD8 function reduced kernel growth with lower sugar and amino acid concentrations. Transcriptomic analysis showed down‐regulation of the transcription factors ZmMYB42 and ZmMYB63 in ZmCCD8 overexpression alleles and up‐regulation in zmccd8 null alleles. Importantly, ZmMYB42 and ZmMYB63 were negatively regulated by the SL signalling component UNBRANCHED 3, and repressed expression of the sucrose transporters ZmSWEET10 and ZmSWEET13c and the lysine/histidine transporter ZmLHT14. Consequently, null alleles of ZmMYB42 or ZmMYB63 promoted accumulation of soluble sugars and free amino acids in maize kernels, whereas ZmLHT14 overexpression enhanced amino acid accumulation in kernels. Moreover, overexpression of the SL receptor DWARF 14B resulted in more sucrose and amino acid accumulation in kernels, down‐regulation of ZmMYB42 and ZmMYB63 expression, and up‐regulation of ZmSWEETs and ZmLHT14 transcription. Together, we uncover a distinct SL signalling pathway that regulates sucrose and amino acid accumulation in kernels. Significant association of two SNPs in the 5′ upstream region of ZmCCD8 with ear and cob diameter implicates its potential in breeding toward higher yield and nitrogen efficiency.

GhDOFD45 promotes sucrose accumulation in cotton seeds by transcriptionally activating GhSWEET10 expression

SUMMARYCotton seed development and fiber elongation are the inseparable and overlapped development processes requiring the continuous supply of sucrose as the direct carbon source. However, little is known about the molecular mechanism of how sucrose is transported from the source tissues (leaves) into growing cotton seeds. Here, we identify the function of a sucrose transporter gene, Sugars Will Eventually be Exported Transporter 10, GhSWEET10 in cotton seed development. GhSWEET10 encodes a functional sucrose transporter, predominantly expressing in the funiculus, inner seedcoat, and endosperm during fiber elongation. GhSWEET10 RNAi plants (GhSWEET10i) accumulated less sucrose and glucose in growing seeds and that led to shorter fibers and smaller seeds, whereas GhSWEET10 overexpressed plants (GhSWEET10OE) had bigger seeds and longer fibers with more sugar accumulation during fiber elongation. GhSWEET10 gene is transcriptionally controlled by the transcription factor GhDOFD45. GhDOFD45 knockout plants (GhDOFD45‐KO) possessed the phenotypes of smaller seeds and shorter fibers like those of GhSWEET10i plants. Furthermore, GhSWEET10 mainly exports the sucrose from the funiculus into developing seeds according to the mimic‐analysis of sucrose transporting. Collectively, all these findings show that GhDOFD45 positively regulates GhSWEET10 expression to mainly transport sucrose from leaves into developing cotton seeds. Our findings also imply that the sucrose transport into enlarging seeds benefits fiber development, and thus GhSWEET10 can be selected as a target of breeding novel cotton varieties with larger and more vigorous seeds.

Expression of carbohydrate-related genes underlying 3,5,6-TPA-induced fruitlet abscission in citrus

In citrus, the synthetic auxin 3,5,6-trichloro-2-pyridyloxyacetic acid (3,5,6-TPA), applied as a foliar spray at a concentration of 15 mg l− 1 during physiological fruitlet abscission, caused additional fruitlet drop and reduced the number of fruits reaching maturity. The effect was much more pronounced at full physiological abscission than after. In this study, this thinning effect was successfully exploited for the first time in sour orange trees grown in an urban environment, reducing harvesting costs by up to almost 40%. This effect is mediated by the leaves, which alter their photosynthetic activity. Our results show a reduction of carbon fixation and sucrose synthesis in the leaf, by 3,5,6-TPA repression of the RbcS, SUS1 and SUSA genes, its transport to the fruit, as shown by the reduced expression of the sucrose transporter genes SUT3 and SUT4, and its hydrolysis in the fruit, mainly by repression of the SUS1 gene expression. Genes involved in auxin homeostasis in the fruit, TRN2 and PIN1, were also repressed. The coordinated repression of all these genes is consistent with the decrease in the fruit cell division rate, as shown by the repression of CYCA1-1 gene, leading to the production of ethylene, which ultimately induces fruitlet abscission.

Fast and simple fluorometric measurement of phloem loading exposes auxin-dependent regulation of Arabidopsis sucrose transporter AtSUC2.

The rate of sucrose export from leaves is a major factor in balancing whole-plant carbon and energy partitioning. A comprehensive study of its dynamics and relationship to photosynthesis, sink demand, and other relevant processes is hampered by the shortcomings of current methods for measuring sucrose phloem loading. We utilize the ability of sucrose transporter proteins, known as SUCs or SUTs, to specifically transport the fluorescent molecule esculin in a novel assay to measure phloem loading rates. Esculin was administered to source leaves and its fluorescence in the leaf extract was measured after 1 or 2 h. Dicot plants with an active phloem loading strategy showed an export-dependent reduction of esculin fluorescence. Relative leaf esculin export rates correlated with leaf export rates of isotopic carbon and phloem exudate sucrose levels. We used esculin experiments to examine the effects of phytohormones on phloem loading in Arabidopsis, showing, for example, that auxin induces phloem loading while cytokinin reduces it. Transcriptional regulation of AtSUC2 by AUXIN RESPONSE FACTOR1 (ARF1) corroborated the link between auxin signaling and phloem loading. Unlike established methods, the esculin assay is rapid and does not require specialized equipment. Potential applications and limitations of the esculin assay are discussed.

Sink-source driven metabolic acclimation of winter oilseed rape leaves (Brassica napus L.) to drought

The crop cycle of winter oilseed rape (WOSR) incorporates source-to-sink remobilisation during the vegetative stage as a principal factor influencing the ultimate seed yield. These processes are supported by the coordinated activity of the plant’s central metabolism. However, climate change-induced drought will affect the metabolic acclimation of WOSR sink/source relationships at this vegetative stage, with consequences that remain to be determined. In this study, we subjected WOSR to severe soil dehydration for 18 days and analysed the physiological and metabolic acclimation of sink and source leaves along the kinetics in combination with measurements of enzymatic activities and transcript levels. Overall, the acclimation of WOSR to drought led to subtle regulations of central metabolism in relation to leaf growth and Pro-induced osmotic adjustment. Notably, sink leaves drastically reduced their growth and transiently accumulated starch. Subsequent starch degradation correlated with the induction of beta-amylases, sucrose transporters, pyrroline-5-carboxylate synthases and proline accumulation. The functioning of the tricarboxylic acid cycle was also altered in sink leaves, as evidenced by variations in citrate, malate and associated enzymatic activities. The metabolic origin of Pro in sink leaves is discussed in relation to Pro accumulation in source leaves and the up-regulation of amino acid permease 1 and glutamine synthetase genes.

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Natural variation of WBR7 confers rice high yield and quality by modulating sucrose supply in sink organs.

Grain chalkiness is an undesirable trait that negatively regulates grain yield and quality in rice. However, the regulatory mechanism underlying chalkiness is complex and remains unclear. We identified a positive regulator of white-belly rate (WBR). The WBR7 gene encodes sucrose synthase 3 (SUS3). A weak functional allele of WBR7 is beneficial in increasing grain yield and quality. During the domestication of indica rice, a functional G/A variation in the coding region of WBR7 resulted in an E541K amino acid substitution in the GT-4 glycosyltransferase domain, leading to a significant decrease in decomposition activity of WBR7A (allele in cultivar Jin23B) compared with WBR7G (allele in cultivar Beilu130). The NIL(J23B) and knockout line NIL(BL130)KO exhibited lower WBR7 decomposition activity than that of NIL(BL130) and NIL(J23B)COM, resulting in less sucrose decomposition and metabolism in the conducting organs. This caused more sucrose transportation to the endosperm, enhancing the synthesis of storage components in the endosperm and leading to decreased WBR. More sucrose was also transported to the anthers, providing sufficient substrate and energy supply for pollen maturation and germination, ultimately leading to an increase rate of seed setting and increased grain yield. Our findings elucidate a mechanism for enhancing rice yield and quality by modulating sucrose metabolism and allocation, and provides a valuable allele for improved rice quality.

Cell Wall Invertases from Maternal Tissues Modulate Sucrose Flux in Apoplastic Pathways During Rice Anther and Seed Development

Efficient sucrose transport and metabolism are vital for seed and pollen development in plants. Cell wall invertases (CINs) hydrolyze sucrose into glucose and fructose, maintaining a sucrose gradient in the apoplast of sink tissues. In rice, two CIN isoforms, OsCIN1 and OsCIN2, were identified as being specifically expressed in the anthers but not in pollen. Functional analyses through genetic crosses and mutant characterization showed that oscin1/2 double mutants exhibit a sporophytic male-sterile phenotype and produce shrunken seeds. This suggests that CIN activity is essential for proper pollen development and seed formation in rice. Observation of the progeny genotypes and phenotypes from various genetic crosses revealed that the phenotype of oscin1/2 seeds is determined by the genotype of the maternal tissue, indicating the critical role of CIN function in the apoplast between maternal and filial tissues for sucrose transport and metabolism. The CIN activity in the anthers and seeds of wild-type rice was found to be significantly higher—over 500-fold in the anthers and 5-fold in the seeds—than in the leaves, highlighting the importance of CIN in facilitating the efficient unloading of sucrose. These findings suggest that the fine-tuning of CIN activity in the apoplast, achieved through tissue-specific expression and CIN isoform regulation, plays a key role in determining the carbohydrate distribution across different tissues. Understanding this regulatory mechanism could provide opportunities to manipulate carbohydrate allocation to sink organs, potentially enhancing crop yields.

OsSTP1 mediates sucrose allocation to regulate rice responses to different nitrogen supply levels

Improving the nitrogen use efficiency is an effective way to increase the yield of rice, and maintaining carbon-nitrogen balance is essential for the normal growth and development of rice. To investigate the impact of the sucrose transporter protein OsSTP1 on nitrogen absorption in rice, in this study, we constructed transgenic lines overexpressing the sucrose transporter gene OsSTP1 (OsSTP1-OE1, OsSTP1-OE2) and mutant transgenic lines (osstp1-1, osstp1-2) from the wild type TB309. Further, we conducted a hydroponic experiment with four nitrogen supply levels of free nitrogen (FN, 0 mg/L), low nitrogen (LN, 10 mg/L), normal nitrogen (NN, 40 mg/L), and high nitrogen (HN, 80 mg/L) to study the responses of each line to different nitrogen supply levels during the seedling stage. The results showed that compared with the wild type and mutant lines in the LN group, the OsSTP1-overexpressing lines exhibited significantly increased biomass, root length, and plant height, decreased soluble sugar content in the leaves, and increased soluble sugar content in the roots. The results indicate that the soluble sugars produced by leaf photosynthesis are transported to the roots through the phloem to promote root growth and nitrogen uptake, thus increasing the aboveground biomass. This study has identified that OsSTP1 can affect the long-distance transport of carbohydrates from source to sink to promote root growth, ultimately influencing rice's absorption and accumulation of nitrogen, improving nitrogen use efficiency and providing reference for reducing nitrogen fertilizer application.

The poplar SWEET1c glucose transporter plays a key role in the ectomycorrhizal symbiosis.

The mutualistic interaction between ectomycorrhizal fungi and trees is characterized by the coordinated exchange of soil nutrients with soluble sugars. Despite the importance of this process, the precise mechanism by which sugars are transported from host roots to colonizing hyphae remains unclear. This study aimed to identify the specific membrane transporters responsible for the unloading of sugars at the symbiotic interface, with a focus on the role of the root Sugars Will Eventually Be Exported Transporter (SWEET) uniporters. Our study used RNA sequencing and quantitative PCR to identify PtaSWEET gene expression in Populus tremula × alba-Laccaria bicolor ectomycorrhizal root tips. Our results suggest that symbiosis-induced PtaSWEET1c is primarily responsible for transporting glucose and sucrose, as demonstrated by the yeast assays. Moreover, we used a promoter-YFP reporter to confirm the localization of the PtaSWEET1c expression in cortical cells of ectomycorrhizal rootlets, supporting its major role in supplying glucose at the symbiotic interface. Furthermore, our observations confirmed the localization of PtaSWEET1c-GFP in the plasma membrane. The inactivation of PtaSWEET1c reduced ectomycorrhizal root formation and 13C translocation to ectomycorrhizal roots. Our findings highlight the crucial role of PtaSWEET1c in facilitating glucose and sucrose transport at the symbiotic interface of Populus-L. bicolor symbiosis.

Sucrose induces flowering by degradation of the floral repressor Ghd7 via K48-linked polyubiquitination in rice.

Sucrose functions as a signaling molecule in several metabolic pathways as well as in various developmental processes. However, the molecular mechanisms by which sucrose regulates these processes remain largely unknown. In the present study, we demonstrate that sucrose promotes flowering by mediating the stability of a regulatory protein that represses flowering in rice. Exogenous application of sucrose promoted flowering by inducing florigen gene expression. Reduction of sucrose levels in the phloem through genetic modifications, such as the overexpression of the vacuolar invertase OsVIN2 or the mutation of OsSUT2, a sucrose transporter, delayed flowering. Analysis of relative transcript levels of floral regulatory genes showed that sucrose activated Ehd1 upstream of the florigen, with no significant effect on the expression of other upstream genes. Examination of protein stability after sucrose treatment of major floral repressors revealed that the Ghd7 protein was specifically degraded. The Ghd7 protein interacted with the E3 ligase IPA INTERACTING PROTEIN1 (IPI1), and sucrose-induced K48-linked polyubiquitination of Ghd7 via IPI1, leading to protein degradation. Mutants defective in IPI1 delayed flowering, confirming its role in modulating proteins involved in flowering. We conclude that sucrose acts as a signaling molecule to induce flowering by promoting Ghd7 degradation via IPI1.

Melatonin mitigates root growth inhibition and carbon-nitrogen metabolism imbalance in apple rootstock M9T337 under high nitrogen stress.

Nitrogen (N) is an essential element for plant growth, development, and metabolism. In apple production, the excessive use of N fertilizer may cause high N stress. Whether high N stress can be alleviated by regulating melatonin supply is unclear. The effects of melatonin on root morphology, antioxidant enzyme activity and 13C and 15N accumulation in apple rootstock M9T337 treated with high N were studied by soil culture. The results showed that correctly raising the melatonin supply level is helpful to root development of M9T337 rootstock under severe N stress. Compared with HN treatment, HN+MT treatment increased root and leaf growth by 11.38%, and 28.01%, respectively. Under high N conditions, appropriately increasing melatonin level can activate antioxidant enzyme activity, reduce lipid peroxidation in roots, protect root structural integrity, promote the transport of sorbitol and sucrose to roots, and promote further degradation and utilization of sorbitol and sucrose in roots, which is conducive to the accumulation of photosynthetic products, thereby reducing the inhibitory effect of high N treatment on root growth. Based on the above research results, we found that under high N stress, melatonin significantly promotes nitrate absorption, enhances N metabolism enzyme activity, and upregulates related gene expression, and regulate N uptake and utilization in the M9T337 rootstock. These results presented a fresh notion for improving N application and preserving carbon-nitrogen balance.

Combined transcriptome and physiological analysis reveals exogenous sucrose enhances photosynthesis and source capacity in foxtail millet

Foxtail millet (Setaria italica (L.) P. Beauv.) is an environmentally friendly crop that meets the current requirements of international food security and is widely accepted as a photosynthesis research model. However, whether exogenous sucrose treatment has a positive effect on foxtail millet growth remains unknown. Here, we employed physiological and molecular approaches to identify photosynthesis and source capacity associated with exogenous sucrose during the growth of Jingu 21 seedlings. RNA-seq analysis showed that some differentially expressed genes (DEGs) related to photosynthesis and carotenoid biosynthesis were induced by exogenous sucrose and that most of these genes were up-regulated. An increase in gas exchange parameters, chlorophyll content, and chlorophyll fluorescence of Jingu 21 was noted after exogenous sucrose addition. Furthermore, exogenous sucrose up-regulated genes encoding sucrose and hexose transporters and enhanced starch and sucrose metabolism. More DEGs were up-regulated by sucrose, the nonstructural carbohydrate (NSC) content in the leaves increased and energy metabolism and sucrose loading subsequently improved, ultimately enhancing photosynthesis under normal and dark conditions. Further analysis revealed that WRKYs, ERFs, HY5, RAP2, and ABI5 could be key transcription factors involved in growth regulation. These results indicate that exogenous sucrose affects the normal photosynthetic performance of foxtail millet by increasing NSC transport and loading. They improve our understanding of the molecular mechanisms of the effects of exogenous sucrose on photosynthesis in foxtail millet, providing an effective measure to enhance source–sink relationships and improve yield.

Increased sugar content impairs pollen fertility and reduces seed-setting in high-photosynthetic-efficiency rice

Crop yield depends on biomass, which is primarily associated with photosynthesis. We previously demonstrated that two photorespiratory bypasses, i.e., GOC (glycolate oxidase + oxalate oxidase + catalase) and GCGT (glycolate oxidase + catalase + glyoxylate carboligase + tartronic semialdehyde reductase), significantly increased photosynthesis, biomass, and grain yield, but decreased seed-setting rates in rice. This study explored the underlying mechanism of how elevated photosynthetic efficiency impacted the seed-setting. First, pollen germination assessed in vivo and in vitro, revealed a reduced germination rate in GCGT rice. Subsequent analysis found that photosynthates highly accumulated in the leaves and stems; sucrose and soluble sugar levels were increased but the starch level was reduced in the anthers. Uridine diphosphate glucose (UDP-Glc) was increased but uridine diphosphate galactose (UDP-Gal) was unaltered, thus causing an imbalance in the UDP-Glc/UDP-Gal ratio in GCGT anthers. Most anthers in GCGT plants had two locules in contrast to four in the wild-type (WT). Pollen tapetum was developmentally abnormal, and genes related to sucrose synthesis, transport, and tapetal programmed cell death (PCD) were upregulated, whereas those involved in starch synthesis and conversion were downregulated in GCGT anthers. Taken together, our results demonstrated that an increase in sugar content was the primary factor causing reduced seed-setting rates in high photosynthetic efficiency rice, during which metabolic disorder of sugars and UDP sugar imbalance in anthers lead to impaired pollen fertility.

Salt tolerance in wheat is associated with the maintenance of shoot biomass, stomatal conductance, and sucrose in the phloem.

Wheat (Triticum aestivum L.) is a mega-staple for millions of the world's populations and its yield potential is impacted by soil salinization. This study investigated genotypic variation in salt tolerance among six wheat genotypes, Gladius, Drysdale, GD0014, GD0120, GD0180, and GD0185. The study also characterized shoot traits, photosynthetic traits, leaf Na and K concentrations, and phloem sucrose. The plants were grown under controlled growth room conditions at 0 mM NaCl (Control) and 100 mM NaCl. The results showed that the salt tolerance index (STISFW, SFW: shoot fresh weight) varied from 0.52 for GD0120 to 0.69 for GD0180. Based on the STISFW, salt tolerance for the wheat genotypes was in the order, GD0180 > Gladius > GD0185 > Drysdale > GD0014 > GD0120. Projected shoot area (PSA) at all growth stages, 14, 20, 27, 34, and 40 DAS were strongly correlated with SFW at 45 DAS. Salt treatment significantly increased phloem sucrose level in the salt intolerant, Drysdale, while having no effect on this parameter in Gladius. Gladius showed greater maintenance of stomatal conductance than Drysdale. The relative ratio of K/Na between treatment and control was strongly correlated with the relative ratio of SFW (r = .85). The correlation between PSA at 14 DAS and SFW at 45 DAS and the correlation between the relative ratio of K/Na between treatment and control with STISFW identify these parameters to be potential traits for screening salt tolerance in wheat. Higher salt tolerance in Gladius would be associated with higher maintenance of stomatal conductance and enhanced phloem sucrose transport.

Role of BraSWEET12 in Regulating Flowering through Sucrose Transport in Flowering Chinese Cabbage

We assessed the flowering Chinese cabbage (Brassica rapa var. parachinensis), a specialty vegetable found in southern China. The sugar content of the stem tip is closely related to bolting and flowering. Sugar Will Eventually be Exported Transporters (SWEETs) are bidirectional sugar transporter proteins involved in numerous plant growth and development processes. The expression of BraSWEET12 is positively correlated with sugar content. However, it is unclear whether BraSWEET12 is involved in bolting and flowering. In this study, we identified and characterized BraSWEET12. BraSWEET12 in flowering Chinese cabbage contains 288 amino acids and is located on the cell membrane as a sucrose transporter protein. BraSWEET12 is highly expressed in the petals and stem tips of flowering Chinese cabbage and is upregulated by gibberellin and low temperatures. Overexpression of BraSWEET12 in Arabidopsis can increase sucrose content at the stem tip, upregulate the expression of AtAP1 and AtLFY, and advance the flowering time. Subsequently, our results indicate that BraSWEET12 is involved in sucrose accumulation at the stem tip of flowering Chinese cabbage and plays a crucial role in flowering regulation. These results provide a reference for elucidating the regulatory mechanisms underlying flowering Chinese cabbage bolting and flowering.

Sweetpotato sucrose transporter IbSUT1 alters storage roots formation by regulating sucrose transport and lignin biosynthesis.

The formation and development of storage roots is the most important physiological process in sweetpotato production. Sucrose transporters (SUTs) regulate sucrose transport from source to sink organs and play important roles in growth and development of plants. However, whether SUTs involved in sweetpotato storage roots formation is so far unknown. In this study, we show that IbSUT1, a SUT, is localized to the plasma membrane. Overexpression of IbSUT1 in sweetpotato promotes the sucrose efflux rate from leaves, leading to increased sucrose levels in roots, thus induces lignin deposition in the stele, which inhibits the storage roots formation and compromises the yield. Heterologous expression of IbSUT1 in Arabidopsis significantly increases the sucrose accumulation and promotes lignification in the inflorescence stems. RNA-seq and biochemical analysis further demonstrated that IbMYB1 negatively regulates the expression of IbSUT1. Overexpression of IbMYB1 in Arabidopsis reduces the sucrose accumulation and lignification degree in the inflorescence stems. Moreover, co-overexpression of IbMYB1 and IbSUT1 restores the phenotype of lignin over-deposition in Arabidopsis. Collectively, our results reveal that IbSUT1 regulates source-sink sucrose transport and participates in the formation of sweetpotato storage roots and highlight the potential application of IbSUT1 in improving sweetpotato yield in the future.

Integrated cytological, physiological, and comparative transcriptome profiling reveals the regulatory network for male sterility in Welsh onion (Allium fistulosum L.)

Welsh onion (Allium fistulosum L.) is a specialty crop with value as a vegetable, condiment, and medicine. However, the molecular mechanisms related to pollen abortion and cytoplasmic male sterility are poorly understood, limiting the heterosis utilization and hybrid production of A. fistulosum. This study investigated the dynamic differences between male-sterile (MS) plants and male-fertile (MF) plants at different anther developmental stages based on integrated cytological, physiological, and transcriptomic analyses. Cytological observations revealed that pollen abortion in the MS plants began during the tetrad stage and was caused by vacuolated microspores, abnormal degradation of the tapetum, and inadequate nutrient supply. The physiological results showed that MS plants exhibited low total soluble sugar and starch contents and decreased antioxidant enzyme activities (peroxidase and catalase). Comparative transcriptome analysis identified 7005 differentially expressed genes (DEGs) and functional enrichment analysis indicated that significant transcriptomic differences were related to oxidative phosphorylation, starch and sucrose metabolism, and cutin, suberine, and wax biosynthesis. The relative expression levels of key DEGs in these three important metabolic pathways were determined using quantitative real-time polymerase chain reaction. On this basis, a core transcriptome-mediated MS network was proposed for MS plants with four functional components: inhibited sucrose synthesis and transport; blocked cutin, suberine, and wax synthesis; accelerated reactive oxygen species generation; and abnormal tapetal programmed cell death. These results provide theoretical guidance for further exploring the molecular mechanisms of male sterility in A. fistulosum.

Arbuscular mycorrhizal fungi alter carbon metabolism and invertase genes expressions of Populus simonii × P. nigra under drought stress.

Arbuscular mycorrhizal fungi (AMF) play a crucial role in regulating the allocation of carbon between source and sink tissues in plants and in regulating their stress responses by changing the sucrose biosynthesis, transportation, and catabolism in plants. Invertase, a key enzyme for plant development, participates in the response of plants to drought stress by regulating sucrose metabolism. However, the detailed mechanisms by which INV genes respond to drought stress in mycorrhizal plants remain unclear. This study examined the sugar content, enzyme activity, and expression profiles of INV genes of Populus simonii × P. nigra (PsnINVs) under two inoculation treatments (inoculation or non-inoculation) and two water conditions (well-watered or drought stress). Results showed that under drought stress, AMF up-regulated the expressions of PsnA/NINV1, PsnA/NINV2, PsnA/NINV3, and PsnA/NINV5 in leaves, which may be related to the enhancement of photosynthetic capacity. Additionally, AMF up-regulated the expressions of PsnA/NINV6, PsnA/NINV10, and PsnA/NINV12 in leaves, which may be related to enhancing osmotic regulation ability and drought tolerance.

Combining transcriptomics and HPLC to uncover variations in quality formation between ‘Benihoppe’ and ‘Fenyu No.1’ strawberries

‘Benihoppe’ and ‘Fenyu No.1’ are representative varieties of red and pink strawberries in China, possess distinct hue and flavor profiles. This study analyzed the underlying biochemical and molecular differences of two varieties utilizing transcriptomics and high-performance liquid chromatography (HPLC). Ripening ‘Benihoppe’ fruits accumulated more sucrose and pelargonin-3-glucoside (P3G) with a little cyanidin and higher firmness. Whereas ripening ‘Fenyu No.1’ fruits contained more fructose, glucose, malic acid and ascorbic acid (AsA), but less P3G and citric acid. Moreover, genotype significantly influenced phenolic compounds contents in strawberries. Transcriptome analysis revealed that pectin degradation (PL, PG, PE), sucrose synthesis (CWINV, SUS, TPS) and citric acid metabolism (α-OGDH, ICDH, GAD, GS, GDH, PEPCK, AST) were weakened in ‘Benihoppe’ fruit. In contrast, the synthesis of sucrose (CWINH, SPS), citric acid (CS, PEPC), anthocyanin (F3H, F3′H, F3′5′H, DFR, UFGT and ANS), and citric acid transport (V-ATPase) was enhanced. In ‘Fenyu No.1’ fruit, the degradation of sucrose, citric acid, and pectin was enhanced, along with the synthesis of malic acid (ME) and ascorbic acid (PMM, MDHAR and GaLUR). However, anthocyanins synthesis, glucose metabolism (HK, G6PI, PFK, G6PDH, PGK, PGM, ENO, PK), fructose metabolism (FK), citric acid synthesis and transport, and AsA degradation (AO, APX) were relatively weak. RT-qPCR results corroborated the transcriptome data. In conclusion, this study revealed the distinctions and characteristics of strawberries with different fruit colors regarding texture, flavor and color formation processes. These findings offer valuable insights for regulating metabolic pathways and identifying key candidate genes to improve strawberry quality.