Stress-induced DNA Duplex Destabilization Research Articles

Insertion Sequence (IS) Element-Mediated Activating Mutations of the Cryptic Aromatic β-Glucoside Utilization (BglGFB) Operon Are Promoted by the Anti-Terminator Protein (BglG) in Escherichia coli.

The cryptic β-glucoside GFB (bglGFB) operon in Escherichia coli (E. coli) can be activated by mutations arising under starvation conditions in the presence of an aromatic β-glucoside. This may involve the insertion of an insertion sequence (IS) element into a “stress-induced DNA duplex destabilization” (SIDD) region upstream of the operon promoter, although other types of mutations can also activate the bgl operon. Here, we show that increased expression of the bglG gene, encoding a well-characterized transcriptional antiterminator, dramatically increases the frequency of both IS-mediated and IS-independent Bgl+ mutations occurring on salicin- and arbutin-containing agar plates. Both mutation rates increased with increasing levels of bglG expression but IS-mediated mutations were more prevalent at lower BglG levels. Mutations depended on the presence of both BglG and an aromatic β-glucoside, and bglG expression did not influence IS insertion in other IS-activated operons tested. The N-terminal mRNA-binding domain of BglG was essential for mutational activation, and alteration of BglG’s binding site in the mRNA nearly abolished Bgl+ mutant appearances. Increased bglG expression promoted residual bgl operon expression in parallel with the increases in mutation rates. Possible mechanisms are proposed explaining how BglG enhances the frequencies of bgl operon activating mutations.

Environment-directed activation of the Escherichia coliflhDC operon by transposons.

The flagellar system in Escherichia coli K12 is expressed under the control of the flhDC-encoded master regulator FlhDC. Transposition of insertion sequence (IS) elements to the upstream flhDC promoter region up-regulates transcription of this operon, resulting in a more rapid motility. Wang and Wood (ISME J 2011;5:1517-1525) provided evidence that insertion of IS5 into upstream activating sites occurs at higher rates in semi-solid agar media in which swarming behaviour is allowed as compared with liquid or solid media where swarming cannot occur. We confirm this conclusion and show that three IS elements, IS1, IS3 and IS5, transpose to multiple upstream sites within a 370 bp region of the flhDC operon control region. Hot spots for IS insertion correlate with positions of stress-induced DNA duplex destabilization (SIDD). We show that IS insertion occurs at maximal rates in 0.24 % agar, with rates decreasing dramatically with increasing or decreasing agar concentrations. In mixed cultures, we show that these mutations preferentially arise from the wild-type parent at frequencies of up to 3×10-3 cell-1 day-1 when the inoculated parental and co-existing IS-activated mutant cells are entering the stationary growth phase. We rigorously show that the apparent increased mutation frequencies cannot be accounted for by increased swimming or by increased growth under the selective conditions used. Thus, our data are consistent with the possibility that appropriate environmental conditions, namely those that permit but hinder flagellar rotation, result in the activation of a mutational pathway that involves IS element insertion upstream of the flhDC operon.

Transposon-mediated directed mutation in bacteria and eukaryotes.

Transposon-mediated "directed" mutations occur at higher frequencies when beneficial than when detrimental and relieve the stress that causes them. The first and best-studied example involves regulation of Insertion Sequence-5 (IS5) insertion into a specific activating site upstream of the glycerol utilization operon in Escherichia coli, glpFK. This event promotes high level expression of the glpFK operon, allowing glycerol utilization in wild type cells under inhibitory conditions. The phosphoenolpyruvate-dependent, sugar transporting, phosphotransferase system (PTS) influences this process by regulating cytoplasmic glycerol-3-phosphate and cyclic AMP concentrations. Insertion frequencies are determined by IS5-specific tetranucleotide target sequences in stress-induced (DNA) duplex destabilization (SIDD) structures counteracted by two DNA binding proteins, GlpR and Crp which directly inhibit insertion, responding to cytoplasmic glycerol-3-phosphate and cyclic AMP, respectively. Expression of the E. coli master regulator of flagellar gene control, flhDC, is subject to activation by IS elements by a directed mechanism, and zinc-induced transposon-mediated zinc resistance has been demonstrated in Cupriavidus metallidurans. The use of DNA conformation and DNA binding proteins to control transposon hopping also occurs in eukaryotes.

Neoplastic MiR‐17∼92 deregulation at a dna fragility motif (SIDD)

Chromosomal or mutational activation of BCL6 (at 3q27) typifies diffuse large B-cell lymphoma (DLBCL) which in the germinal center subtype may be accompanied by focal amplification of chromosome band 13q31 effecting upregulation of miR-17~92. Using long distance inverse-polymerase chain reaction, we mapped and sequenced six breakpoints of a complex BCL6 rearrangement t(3;13)(q27;q31)t(12;13)(p11;q31) in DLBCL cells, which places miR-17~92 antisense within the resulting ITPR2-BCL6 chimeric fusion gene rearrangement. MiR-17~92 members were upregulated ~15-fold over controls in a copy number independent manner consistent with structural deregulation. MIR17HG and ITPR2-BCL6 were, despite their close configuration, independently expressed, discounting antisense regulation. MIR17HG in t(3;13)t(12;13) cells proved highly responsive to treatment with histone deacetylase inhibitors implicating epigenetic deregulation, consistent with which increased histone-H3 acetylation was detected by chromatin immunoprecipitation near the upstream MIR17HG breakpoint. Remarkably, 5/6 DNA breaks in the t(3;13)t(12;13) precisely cut at stress-induced DNA duplex destabilization (SIDD) peaks reminiscent of chromosomal fragile sites, while the sixth lay 150 bp distant. Extended SIDD profiling showed that additional oncomiRs also map to SIDD peaks. Fluorescence in situ hybridization analysis showed that 11 of 52 (21%) leukemia-lymphoma (L-L) cell lines with 13q31 involvement bore structural rearrangements at/near MIR17HG associated with upregulation. As well as fueling genome instability, SIDD peaks mark regulatory nuclear-scaffold matrix attachment regions open to nucleosomal acetylation. Collectively, our data indict a specific DNA instability motif (SIDD) in chromosome rearrangement, specifically alterations activating miR-17~92 epigenetically via promoter hyperacetylation, and supply a model for the clustering of oncomiRs near cancer breakpoints.

An iterative strategy combining biophysical criteria and duration hidden Markov models for structural predictions of Chlamydia trachomatis σ66 promoters

BackgroundPromoter identification is a first step in the quest to explain gene regulation in bacteria. It has been demonstrated that the initiation of bacterial transcription depends upon the stability and topology of DNA in the promoter region as well as the binding affinity between the RNA polymerase σ-factor and promoter. However, promoter prediction algorithms to date have not explicitly used an ensemble of these factors as predictors. In addition, most promoter models have been trained on data from Escherichia coli. Although it has been shown that transcriptional mechanisms are similar among various bacteria, it is quite possible that the differences between Escherichia coli and Chlamydia trachomatis are large enough to recommend an organism-specific modeling effort.ResultsHere we present an iterative stochastic model building procedure that combines such biophysical metrics as DNA stability, curvature, twist and stress-induced DNA duplex destabilization along with duration hidden Markov model parameters to model Chlamydia trachomatis σ66 promoters from 29 experimentally verified sequences. Initially, iterative duration hidden Markov modeling of the training set sequences provides a scoring algorithm for Chlamydia trachomatis RNA polymerase σ66/DNA binding. Subsequently, an iterative application of Stepwise Binary Logistic Regression selects multiple promoter predictors and deletes/replaces training set sequences to determine an optimal training set. The resulting model predicts the final training set with a high degree of accuracy and provides insights into the structure of the promoter region. Model based genome-wide predictions are provided so that optimal promoter candidates can be experimentally evaluated, and refined models developed. Co-predictions with three other algorithms are also supplied to enhance reliability.ConclusionThis strategy and resulting model support the conjecture that DNA biophysical properties, along with RNA polymerase σ-factor/DNA binding collaboratively, contribute to a sequence's ability to promote transcription. This work provides a baseline model that can evolve as new Chlamydia trachomatis σ66 promoters are identified with assistance from the provided genome-wide predictions. The proposed methodology is ideal for organisms with few identified promoters and relatively small genomes.

The Functional Role of S/MARs in Episomal Vectors as Defined by the Stress-Induced Destabilization Profile of the Vector Sequences

The scaffold/matrix attachment regions (S/MARs) are chromosomal elements that participate in the formation of chromatin domains and have origin of replication support functions. Because of all these functions, in recent years, they have been used as part of episomal vectors for gene transfer. The S/MAR of the human β-interferon gene has been shown to support efficient episome retention and transgene expression in various mammalian cells. In Jurkat and other cells, DNA plasmid vectors containing Epstein–Barr virus origin of replication (EBV OriP) and the EBV nuclear antigen-1 gene mediate prolonged episome retention in the host cell nucleus, which, however, diminishes over time. In order to enhance retention, we combined this system with an S/MAR element. Unexpectedly, this completely eliminated the capacity of episomes to replicate. Calculation of the stress-induced DNA duplex destabilization profile of the vectors suggested that the S/MAR element had created an increase in molecular stability at the OriP site that may have disturbed replicative potential. In contrast, introduction of an alternative initiation of replication region from the β-globin gene locus, instead of EBV OriP and the EBV nuclear antigen-1 gene, restored replicative capacity and enhanced episome retention mediated by the S/MAR. These effects were associated with a destabilization profile at the initiation of replication region. These data demonstrate a correlation between S/MAR-mediated vector retention and the presence of an unstable duplex at a replication origin, in this particular setting. We consider that the calculation of stress-induced duplex destabilization may be an informative first step in the design of units that replicate extrachromosomally, particularly as the latter present a safer and, therefore, attractive alternative to integrating viral vectors for gene therapy applications.

Micro-RNA Gene Deregulation by Chromosome Translocations with Fragile Genomic Regions in B-Cell Lymphoma Cells

Micro-RNA (miR) genes posttranscriptionally modulate target gene expression via imperfect 3′-UTR matching sequences and play key roles in development, homeostasis and cancer. Little is known how miR genes are themselves regulated, or deregulated in cancer. Chief paradigm for neoplastic miR deregulation concerns miR-17/92 cluster members subject to genomic amplification in B-cell lymphoma. While the repeated occurrence of oncogenic miR genes at or near chromosomal breakpoints in cancer links chromosome fragility to oncogenic miR deregulation, direct evidence of a causal connection remains tenuous. We found that t(3;7)(q27;q32) in a B-cell lymphoma cell line joins 5′-BCL6 to a noncoding region of chromosome 7 inside a common chromosomal fragile site (FRA7H). In these cells hybrid mRNA was absent, unlike canonical BCL6 translocations which involve promoter exchange yielding hybrid mRNA. Affected cells instead showed downregulation of miR-29b-1, the only gene located within FRA7H - a recurrent transcriptional feature of B-cell lymphoma subsets. In another BCL6 translocation, t(3;13)(q27;q31)t(13;12)(q31;p11), which 5′-RACE also showed to be non-fusogenic, long distance inverse (LDI)-PCR revealed junction of 5′-BCL6 to chromosome 13 sequences inside the miR-17/92 host gene MIRH1 (alias c13orf25). FISH using a sensitive tyramide amplification protocol with c13orf25 clones confirmed the presence of a cryptic BCL6-MIRH1 rearrangement. Surprisingly, reverse transcriptase quantitative (q) PCR assay revealed weak MIRH1 expression using 3′-primers. In contrast, repeating the assay using more central primers covering the miR-17/92 coding region showed massive upregulation. 3′-RACE confirmed a novel high level MIRH1 transcript truncated by 3.1 kbp. Quantitative genomic PCR and FISH excluded miR-17/92 genomic copy number alteration, while LDI-PCR analysis showed that formation of truncated MIRH1 involved multiple DNA cuts at 3q27 (x1), 12p11 (x1), and 13q31 (x5) – the last including a complex excision/inversion/insertion rearrangement. Stress induced DNA duplex destabilization (SIDD) analysis revealed that 6 of 7 breaks precisely coincided with fragility peaks. Taken together, these data suggest a novel role for BCL6 translocations in the deregulation of miR genes near sites of chromosome or DNA instability. BCL6 has been shown to suppress p53 in germinal center B-cells thus protecting B-cells from apoptosis induced by DNA damage, offering a possible explanation for chromosome rearrangements associated with genomic fragility therein. Chromosomal MIRH1 dysregulation is not limited to BCL6 expressing lymphomas, however: cytogenetic investigations performed on diverse leukemia-lymphoma cell lines, including those derived from multiple myeloma and plasma cell leukemia, showed 11/50 with cytogenetic rearrangements at or near MIRH1. In sister cell lines sequentially established at diagnosis and relapse of multiple myeloma, only the latter showed miR-17/92 chromosomal rearrangement and upregulation. Interestingly miR overexpression was limited to miR-92, while miR-17/18 were barely expressed. FISH analysis and qPCR showed that discrepant expression was associated with rearrangement upstream of MIRH1. In brief, our data show that like other cancer genes, oncogenic miRs are subject to dysregulation mediated by structural chromosome rearrangements.

Superhelical Destabilization in Regulatory Regions of Stress Response Genes

Stress-induced DNA duplex destabilization (SIDD) analysis exploits the known structural and energetic properties of DNA to predict sites that are susceptible to strand separation under negative superhelical stress. When this approach was used to calculate the SIDD profile of the entire Escherichia coli K12 genome, it was found that strongly destabilized sites occur preferentially in intergenic regions that are either known or inferred to contain promoters, but rarely occur in coding regions. Here, we investigate whether the genes grouped in different functional categories have characteristic SIDD properties in their upstream flanks. We report that strong SIDD sites in the E. coli K12 genome are statistically significantly overrepresented in the upstream regions of genes encoding transcriptional regulators. In particular, the upstream regions of genes that directly respond to physiological and environmental stimuli are more destabilized than are those regions of genes that are not involved in these responses. Moreover, if a pathway is controlled by a transcriptional regulator whose gene has a destabilized 5′ flank, then the genes (operons) in that pathway also usually contain strongly destabilized SIDD sites in their 5′ flanks. We observe this statistically significant association of SIDD sites with upstream regions of genes functioning in transcription in 38 of 43 genomes of free-living bacteria, but in only four of 18 genomes of endosymbionts or obligate parasitic bacteria. These results suggest that strong SIDD sites 5′ to participating genes may be involved in transcriptional responses to environmental changes, which are known to transiently alter superhelicity. We propose that these SIDD sites are active and necessary participants in superhelically mediated regulatory mechanisms governing changes in the global pattern of gene expression in prokaryotes in response to physiological or environmental changes.

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T‐DNA loci

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.

OriDB: a DNA replication origin database

Replication of eukaryotic chromosomes initiates at multiple sites called replication origins. Replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where several complementary studies have mapped their locations genome-wide. We have collated these datasets, taking account of the resolution of each study, to generate a single list of distinct origin sites. OriDB provides a web-based catalogue of these confirmed and predicted S.cerevisiae DNA replication origin sites. Each proposed or confirmed origin site appears as a record in OriDB, with each record comprising seven pages. These pages provide, in text and graphical formats, the following information: genomic location and chromosome context of the origin site; time of origin replication; DNA sequence of proposed or experimentally confirmed origin elements; free energy required to open the DNA duplex (stress-induced DNA duplex destabilization or SIDD); and phylogenetic conservation of sequence elements. In addition, OriDB encourages community submission of additional information for each origin site through a User Notes facility. Origin sites are linked to several external resources, including the Saccharomyces Genome Database (SGD) and relevant publications at PubMed. Finally, a Chromosome Viewer utility allows users to interactively generate graphical representations of DNA replication data genome-wide. OriDB is available at .

Initiation of Heat-Induced Replication Requires DnaA and the L-13-mer of oriC

An upshift of 10 degrees C or more in the growth temperature of an Escherichia coli culture causes induction of extra rounds of chromosome replication. This stress replication initiates at oriC but has functional requirements different from those of cyclic replication. We named this phenomenon heat-induced replication (HIR). Analysis of HIR in bacterial strains that had complete or partial oriC deletions and were suppressed by F integration showed that no sequence outside oriC is used for HIR. Analysis of a number of oriC mutants showed that deletion of the L-13-mer, which makes oriC inactive for cyclic replication, was the only mutation studied that inactivated HIR. The requirement for this sequence was strictly correlated with Benham's theoretical stress-induced DNA duplex destabilization. oriC mutations at DnaA, FIS, or IHF binding sites showed normal HIR activation, but DnaA was required for HIR. We suggest that strand opening for HIR initiation occurs due to heat-induced destabilization of the L-13-mer, and the stable oligomeric DnaA-single-stranded oriC complex might be required only to load the replicative helicase DnaB.

SIDDBASE: a database containing the stress-induced DNA duplex destabilization (SIDD) profiles of complete microbial genomes

Prokaryotic genomic DNA is generally negatively supercoiled in vivo. Many regulatory processes, including the initiation of transcription, are known to depend on the superhelical state of the DNA substrate. The stresses induced within DNA by negative superhelicity can destabilize the DNA duplex at specific sites. Various experiments have either shown or suggested that stress-induced DNA duplex destabilization (SIDD) is involved in specific regulatory mechanisms governing a variety of biological processes. We have developed methods to evaluate the SIDD properties of DNA sequences, including complete chromosomes. This analysis predicts the locations where the duplex becomes destabilized under superhelical stress. Previous studies have shown that the SIDD-susceptible sites predicted in this way occur at rates much higher than expected at random in transcriptional regulatory regions, and much lower than expected in coding regions. Analysis of the SIDD profiles of 42 bacterial genomes chosen for their diversity confirms this pattern. Predictions of SIDD sites have been used to identify potential genomic regulatory regions, and suggest both possible regulatory mechanisms involving stress-induced destabilization and experimental tests of these mechanisms. Here we describe the SIDDBASE database which enables users to retrieve and visualize the results of SIDD analyses of completely sequenced prokaryotic and archaeal genomes, together with their annotations. SIDDBASE is available at .

Correlations between Scaffold/Matrix Attachment Region (S/MAR) Binding Activity and DNA Duplex Destabilization Energy

Scaffold or matrix-attachment regions (S/MARs) are thought to be involved in the organization of eukaryotic chromosomes and in the regulation of several DNA functions. Their characteristics are conserved between plants and humans, and a variety of biological activities have been associated with them. The identification of S/MARs within genomic sequences has proved to be unexpectedly difficult, as they do not appear to have consensus sequences or sequence motifs associated with them. We have shown that S/MARs do share a characteristic structural property, they have a markedly high predicted propensity to undergo strand separation when placed under negative superhelical tension. This result agrees with experimental observations, that S/MARs contain base-unpairing regions (BURs). Here, we perform a quantitative evaluation of the association between the ease of stress-induced DNA duplex destabilization (SIDD) and S/MAR binding activity. We first use synthetic oligomers to investigate how the arrangement of localized unpairing elements within a base-unpairing region affects S/MAR binding. The organizational properties found in this way are applied to the investigation of correlations between specific measures of stress-induced duplex destabilization and the binding properties of naturally occurring S/MARs. For this purpose, we analyze S/MAR and non-S/MAR elements that have been derived from the human genome or from the tobacco genome. We find that S/MARs exhibit long regions of extensive destabilization. Moreover, quantitative measures of the SIDD attributes of these fragments calculated under uniform conditions are found to correlate very highly (r2>0.8) with their experimentally measured S/MAR-binding strengths. These results suggest that duplex destabilization may be involved in the mechanisms by which S/MARs function. They suggest also that SIDD properties may be incorporated into an improved computational strategy to search genomic DNA sequences for sites having the necessary attributes to function as S/MARs, and even to estimate their relative binding strengths.

The Analysis of Stress-Induced Duplex Destabilization in Long Genomic DNA Sequences

We present a method for calculating predicted locations and extents of stress-induced DNA duplex destabilization (SIDD) as functions of base sequence and stress level in long DNA molecules. The base pair denaturation energies are assigned individually, so the influences of near neighbors, methylated bases, adducts, or lesions can be included. Sample calculations indicate that copolymeric energetics give results that are close to those derived when full near-neighbor energetics are used; small but potentially informative differences occur only in the calculated SIDD properties of moderately destabilized regions. The method presented here for analyzing long sequences calculates the destabilization properties within windows of fixed length N, with successive windows displaced by an offset distance d(o). The final values of the relevant destabilization parameters for each base pair are calculated as weighted averages of the values computed for each window in which that base pair appears. This approach implicitly assumes that the strength of the direct coupling between remote base pairs that is induced by the imposed stress attenuates with their separation distance. This strategy enables calculations of the destabilization properties of DNA sequences of any length, up to and including complete chromosomes. We illustrate its utility by calculating the destabilization properties of the entire E. coli genomic DNA sequence. A preliminary analysis of the results shows that promoters are associated with SIDD regions in a highly statistically significant manner, suggesting that SIDD attributes may prove useful in the computational prediction of promoter locations in prokaryotes.

Stress-induced DNA duplex destabilization (SIDD) in the E. coli genome: SIDD sites are closely associated with promoters.

We present the first analysis of stress-induced DNA duplex destabilization (SIDD) in a complete chromosome, the Escherichia coli K12 genome. We used a newly developed method to calculate the locations and extents of stress-induced destabilization to single-base resolution at superhelix density sigma = -0.06. We find that SIDD sites in this genome show a statistically highly significant tendency to avoid coding regions. And among intergenic regions, those that either contain documented promoters or occur between divergently transcribing coding regions, and hence may be inferred to contain promoters, are associated with strong SIDD sites in a statistically highly significant manner. Intergenic regions located between convergently transcribing genes, which are inferred not to contain promoters, are not significantly enriched for destabilized sites. Statistical analysis shows that a strongly destabilized intergenic region has an 80% chance of containing a promoter, whereas an intergenic region that does not contain a strong SIDD site has only a 24% chance. We describe how these observations may illuminate specific mechanisms of regulation, and assist in the computational identification of promoter locations in prokaryotes.

The Analysis of Stress-Induced Duplex Destabilization in Long Genomic DNA Sequences

We present a method for calculating predicted locations and extents of stress-induced DNA duplex destabilization (SIDD) as functions of base sequence and stress level in long DNA molecules. The base pair denaturation energies are assigned individually, so the influences of near neighbors, methylated bases, adducts, or lesions can be included. Sample calculations indicate that copolymeric energetics give results that are close to those derived when full near-neighbor energetics are used; small but potentially informative differences occur only in the calculated SIDD properties of moderately destabilized regions. The method presented here for analyzing long sequences calculates the destabilization properties within windows of fixed length N, with successive windows displaced by an offset distance do. The final values of the relevant destabilization parameters for each base pair are calculated as weighted averages of the values computed for each window in which that base pair appears. This approach implicitly assumes that the strength of the direct coupling between remote base pairs that is induced by the imposed stress attenuates with their separation distance. This strategy enables calculations of the destabilization properties of DNA sequences of any length, up to and including complete chromosomes. We illustrate its utility by calculating the destabilization properties of the entire E. coli genomic DNA sequence. A preliminary analysis of the results shows that promoters are associated with SIDD regions in a highly statistically significant manner, suggesting that SIDD attributes may prove useful in the computational prediction of promoter locations in prokaryotes.

Multiple collagen I gene regulatory elements have sites of stress-induced DNA duplex destabilization and nuclear scaffold/matrix association potential

The availability of the complete nucleotide sequences of numerous prokaryotic and eukaryotic organisms should stimulate the development and application of computer-based approaches for studying genome organization and function. Earlier work has shown that distinct regulatory DNA elements can be identified by computational analysis as sites of stress-induced DNA duplex destabilization (SIDD). Here we report the results of computational and experimental analyses of previously identified regulatory elements in the murine α1(I) collagen (Col1a1) gene domain. We found that several distal 5′ DNase I-hypersensitive sites (HSs) which function in the chromatin loop organization of the Col1a1 gene are characterized by strongly destabilized SIDD profiles. Elements in the proximal 5′ promoter and first intron which differentially regulate Col1a1 promoter activity in different collagen-producing cell types also contain SIDD sites. All 5′ elements associated with destabilized sites are shown to have nuclear matrix binding activity in an in vitro binding assay. Other putative regulatory elements in the transcribed and 3′-flanking regions of the Col1a1 gene, including both of its polyadenylation sites, are also associated with SIDD peaks. The human COL1A1 gene has periodic SIDD peaks within the transcribed region, suggesting that abundantly expressed genes may require SIDDs acting as topological sinks during transcription. The 5′ ends of the murine Col1a1 and the homologous human gene revealed similar SIDD profiles, but limited DNA sequence similarity, indicating that some DNA functions are evolutionarily conserved by preserving higher order DNA structural properties rather than nucleotide sequence. Our results show that destabilized SIDD profiles are a common feature of eukaryotic regulatory DNA elements with such diverse functions as chromatin organization, cell-specific transcriptional enhancement, and initiation and termination of transcription. They demonstrate the usefulness of computational analyses that predict SIDD properties in reliably identifying DNA elements involved in the structural organization of the eukaryotic genome and the regulation of its expression. J. Cell. Biochem. 84: 484–496, 2002. © 2001 Wiley-Liss, Inc.

Multiple collagen I gene regulatory elements have sites of stress‐induced DNA duplex destabilization and nuclear scaffold/matrix association potential

The availability of the complete nucleotide sequences of numerous prokaryotic and eukaryotic organisms should stimulate the development and application of computer-based approaches for studying genome organization and function. Earlier work has shown that distinct regulatory DNA elements can be identified by computational analysis as sites of stress-induced DNA duplex destabilization (SIDD). Here we report the results of computational and experimental analyses of previously identified regulatory elements in the murine alpha1(I) collagen (Col1a1) gene domain. We found that several distal 5' DNase I-hypersensitive sites (HSs) which function in the chromatin loop organization of the Col1a1 gene are characterized by strongly destabilized SIDD profiles. Elements in the proximal 5' promoter and first intron which differentially regulate Col1a1 promoter activity in different collagen-producing cell types also contain SIDD sites. All 5' elements associated with destabilized sites are shown to have nuclear matrix binding activity in an in vitro binding assay. Other putative regulatory elements in the transcribed and 3'-flanking regions of the Col1a1 gene, including both of its polyadenylation sites, are also associated with SIDD peaks. The human COL1A1 gene has periodic SIDD peaks within the transcribed region, suggesting that abundantly expressed genes may require SIDDs acting as topological sinks during transcription. The 5' ends of the murine Col1a1 and the homologous human gene revealed similar SIDD profiles, but limited DNA sequence similarity, indicating that some DNA functions are evolutionarily conserved by preserving higher order DNA structural properties rather than nucleotide sequence. Our results show that destabilized SIDD profiles are a common feature of eukaryotic regulatory DNA elements with such diverse functions as chromatin organization, cell-specific transcriptional enhancement, and initiation and termination of transcription. They demonstrate the usefulness of computational analyses that predict SIDD properties in reliably identifying DNA elements involved in the structural organization of the eukaryotic genome and the regulation of its expression.