Strawberry Pallidosis Associated Virus Research Articles

First report of strawberry pallidosis-associated virus infecting strawberry from Iran

First report of strawberry pallidosis-associated virus infecting strawberry from Iran

The occurrence of strawberry virus 1 infecting strawberry in Shandong province, China.

Strawberry (Fragaria × ananassa Duch.) is one of the most important horticultural plants worldwide with high economic and nutritional value. Strawberry associated virus 1 (SaV1) is a putative Cytorhabdovirus isolated from strawberry in Fujian province, China (Ding et al., 2019). Strawberry virus 1 (StrV-1) is another putative Cytorhabdovirus characterized from F. ananassa and F. vesca in Czech Republic (Fránová et al., 2019). The complete genomes of isolates of SaV1 and StrV-1 share 79 to 98% nucleotide (nt) identities. In August 2020, foliar chlorotic spots or streaks were observed in four strawberry cultivars (cv. Honeoye, Mibao, 8128 and All Star) in Yantai, Shandong province, China. To identify the associated viruses, symptomatic leaves from two plants of each cultivar (8 samples) were pooled for high-throughput sequencing (HTS). Total RNA was extracted from the composite sample and used for constructing a cDNA library after ribosomal RNA (rRNA)-depletion. Sequencing was carried out on Illumina Hiseq 4000 (Novogene, China). Raw reads were filtered, trimmed and de novo assembled as described previously (Grabherr et al., 2013; Zhou et al. 2020). The resulting contigs were screened by BLASTn and BLASTx against GenBank database. Subsequent analyses indicated the presence of strawberry vein banding virus, strawberry pallidosis associated virus and strawberry mottle virus in the analyzed sample, which had been reported previously in strawberry (Martin and Tzanetakis, 2013; Shi et al., 2018; Bhagwat et al., 2016). Besides, five contigs ranging from 266 to 6,057 nt were obtained. They shared 87 to 91% nt sequence identity with StrV-1 isolate B (GenBank accession no. MK211271). To confirm StrV-1 infection in the strawberry plants, total RNA was isolated from all eight samples using RNAprep Pure Plant Plus Kit (Tiangen, China). Reverse transcription polymerase chain reaction (RT-PCR) was conducted with two pairs of specific primers StrVp1 (Forward: 5'-CATTACTGAAGCATTCCGTG-3'/Reverse: 5'-AGATATCACGCACAGTGAC-3'), and StrVp2 (Forward: 5'-TTGCGCGAAGCGGATGTCCG-3'/Reverse: 5'-GGCTGCCAGAGCGTTGGATG-3'), targeting nt positions 70-1,231 and 7,825-9,348 of StrV-1 isolate B, respectively. Fragments with the expected sizes were amplified from two samples of cv. All Star. The amplicons were cloned, sequenced, and deposited in GenBank under accession no. MW419123-124 and MW645247-248. Both protein encoding sequences shared 91 to 92% and 80 to 84% nt identities with the corresponding sequences of StrV-1 isolate B and SaV1, respectively, indicating that the isolates from this study are genetic variants of StrV-1 and distantly related to SaV1. Crude sap was prepared by homogenizing leaf tissues of StrV-1 infected strawberry in 0.02 mol/L sodium phosphate buffer with 0.45% (w/v) sodium diethyldithiocarbamate thihydrate, then gently rubbed onto five healthy Nicotiana benthamiana plants. Neither the inoculated leaves nor the systemically infected leaves showed obvious symptoms seven days post inoculation. However, StrV-1 was detected by RT-PCR in all five N. benthamiana plants as described above. In addition, a survey of strawberry greenhouses was conducted in August 2020 and approximately 10% of plants in a 667 m2 greenhouse in Yantai had StrV-1-like symptoms. To the best of our knowledge, this is the first report of the occurrence of StrV-1 infecting strawberry in Shandong province, China. Our findings expand the geographic range and genetic diversity of StrV-1 and indicate it could be a potential virus threat to strawberry production in China.

Sequencing a Strawberry Germplasm Collection Reveals New Viral Genetic Diversity and the Basis for New RT-qPCR Assays.

Viruses are considered of major importance in strawberry (Fragaria × ananassa Duchesne) production given their negative impact on plant vigor and growth. Strawberry accessions from the National Clonal Germplasm Repository were screened for viruses using high throughput sequencing (HTS). Analyses of sequence information from 45 plants identified multiple variants of 14 known viruses, comprising strawberry mottle virus (SMoV), beet pseudo yellows virus (BPYV), strawberry pallidosis-associated virus (SPaV), tomato ringspot virus (ToRSV), strawberry mild yellow edge virus (SMYEV), strawberry vein banding virus (SVBV), strawberry crinkle virus (SCV), strawberry polerovirus 1 (SPV-1), apple mosaic virus (ApMV), strawberry chlorotic fleck virus (SCFaV), strawberry crinivirus 4 (SCrV-4), strawberry crinivirus 3 (SCrV-3), Fragaria chiloensis latent virus (FClLV) and Fragaria chiloensis cryptic virus (FCCV). Genetic diversity of sequenced virus isolates was investigated via sequence homology analysis, and partial-genome sequences were deposited into GenBank. To confirm the HTS results and expand the detection of strawberry viruses, new reverse transcription quantitative PCR (RT-qPCR) assays were designed for the above-listed viruses. Further in silico and in vitro validation of the new diagnostic assays indicated high efficiency and reliability. Thus, the occurrence of different viruses, including divergent variants, among the strawberries was verified. This is the first viral metagenomic survey in strawberry, additionally, this study describes the design and validation of multiple RT-qPCR assays for strawberry viruses, which represent important detection tools for clean plant programs.

Pest categorisation of non-EU viruses of Fragaria L.

Following a request from the EU Commission, the Panel on Plant Health addressed the pest categorisation of the viruses and viroids of Fragaria L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These infectious agents belong to different genera and are heterogeneous in their biology. With the exclusion of strawberry latent virus and strawberry latent C virus for which very limited information exists, the pest categorisation was completed for 12 viruses having acknowledged identities and available detection methods. All these viruses are efficiently transmitted by vegetative propagation techniques, with plants for planting representing the major pathway for long‐distance dispersal and thus considered as the major pathway for entry. Depending on the virus, additional pathway(s) can also be Fragaria seeds, pollen and/or vector(s). Most of the viruses categorised here are known to infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Strawberry chlorotic fleck‐associated virus, strawberry leaf curl virus, strawberry necrotic shock virus, strawberry pallidosis‐associated virus, strawberry vein banding virus (SVBV) and tomato ringspot virus meet all the criteria evaluated by EFSA to qualify as potential Union quarantine pests (QPs). For SVBV, the Panel considered that following its entry and establishment into the EU territory, an impact of uncertain magnitude is expected mainly because a synergistic effect may occur in strawberry in case of mixed infections with viruses already present in the EU . Strawberry crinivirus 3, strawberry crinivirus 4 and strawberry polerovirus 1 meet all criteria for being considered as potential Union QPs, except for the impact in the EU territory, on which the Panel was unable to conclude. Fragaria chiloensis cryptic virus, Fragaria chiloensis latent virus and strawberry pseudo mild yellow edge virus do not meet the criterion of having potential negative impact in the EU. For several viruses, especially those recently discovered, the categorisation is associated with high uncertainties mainly because of the absence of data on their biology, distribution and impact. Since this opinion addresses specifically the non‐EU viruses, in general, these viruses do not meet the criteria assessed by EFSA to qualify as potential Union regulated non‐quarantine pests.

First Report of Strawberry pallidosis associated virus Infecting Strawberry in China

First Report of <i>Strawberry pallidosis associated virus</i> Infecting Strawberry in China

Virus Decline of Strawberry in California and the Role of Insect Vectors and Associated Viruses

Greenhouse white fly, Trialeurodes vaporariorum (Westwood); western flower thrips, Frankliniella occidentalis (Pergande); and strawberry aphid, Chaetosiphon fragaefolii (Cockerell), are common pests of strawberries in California and are vectors of one or more viruses. Most of the viruses transmitted by these vectors do not cause symptoms on strawberry when the infection occurs individually. However, when one of the viruses (Beet pseudoyellows virus or Strawberry pallidosis-associated virus) transmitted by T. vaporariorum is present along with one of the viruses transmitted by F. occidentalis, C. fragaefolii, or other sources, it results in a virus decline of strawberry, which can cause significant crop losses. Stunted root and plant growth, purple coloration of foliage, and dieback of the plant are some of the symptoms associated with virus decline. Increases in T. vaporariorum infestations during the past few years significantly elevated the risk of whitefly as a crop pest and a disease vector. This article reviews virus decline of strawberry, symptoms of infection, and the current status of insect vectors in California strawberries. Accepted for publication 17 November 2015. Published 20 November 2015.

First Report of Fragaria chiloensis cryptic virus, Fragaria chiloensis latent virus, Strawberry mild yellow edge virus, Strawberry necrotic shock virus, and Strawberry pallidosis associated virus in Single and Mixed Infections in Strawberry in Central Mexico.

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico.

Statement on the dossier for a derogation request of the US authorities concerning cold-treated strawberry plants intended for planting

Following a request from the European Commission, the Panel on Plant Health was asked to provide a scientific opinion on the report “Evaluation of Strawberry Nursery Plant Cold Treatments on Survival of the Whitefly, Bemisia tabaci” submitted to the European Commission by the United States Department of Agriculture (USDA) as technical justification for a derogation from requirements listed in Annex IV, Part A, Section 1, point 46 of the Council Directive 2000/29/EC[2]. The Panel reviewed the report to indicate methodological issues of concern and evaluated the effectiveness of the treatment proposed for the elimination of B. tabaci whiteflies from consignments to be shipped to the EU. In addition, the Panel clarified which viruses listed in the Annexes of Council Directive 2000/29/EC can be transmitted by strawberry plants and by B. tabaci. The Panel concludes that due to the poor quality of the report submitted and to serious shortcomings in the experimental design the report does not demonstrate the effectiveness of the cold treatment proposed. Although there is potential for the development of a cold treatment protocol for the elimination of B. tabaci from strawberry plant consignments, reliable mortality estimates for the proposed cold treatment of 28 degrees Fahrenheit (-2.2 degrees Celsius) for 2 weeks cannot be derived from this study. No B.tabaci-transmitted viruses are currently known to infect strawberry and no viruses of Fragaria spp. listed in Directive 2000/29/EC are known to be transmitted by B. tabaci. However, adult whiteflies of B. tabaci on strawberry consignments can carry plant viruses irrespective of whether strawberry is a host plant for these viruses and thus represent a pathway for the introduction of non-European viruses. There is also some uncertainty concerning the extent to which known or unknown B. tabaci-transmitted viruses could infect strawberry. Two whitefly-transmitted viruses have been recently confirmed as associated with strawberry pallidosis disease occurring in the US: Beet pseudo-yellows virus (BPYV) and Strawberry pallidosis associated virus (Spiv) but are only known to be transmitted by the greenhouse whitefly Trialeurodes vaporariorum and not by B. tabaci. Strawberry plants for planting are vegetatively propagated and are thus subject to infection by viruses. Irrespective of the presence of B. tabaci, strawberry transplants from US may represent a pathway for the introduction of any non-European viruses (and other potentially harmful organisms) of Fragaria. This applies for example to SPaV, which is not reported as present in the EU and, if introduced, could be further spread by its vector, the glasshouse whitefly T. vaporariorum, which is widely established in the EU.

DETECTION OF STRAWBERRY VIRUSES IN EGYPT

As part of a USAID-MERC funded project, 'Disease-indexing and mass propagation of superior strawberry cultivars', an effort was made to evaluate the virus status of strawberries in Egypt. Diagnostic reverse transcription-polymerase chain reaction (RT-PCR) tests for Strawberry mottle virus, Strawberry crinkle virus, Strawberry vein banding virus (SVBV), Strawberry mild yellow edge virus (SMYEV), Strawberry chlorotic fleck virus, Strawberry necrotic shock virus, Strawberry latent ringspot virus, Apple mosaic virus, Fragaria chiloensis latent virus, Strawberry pallidosis associated virus (SPaV) and Beet pseudo yellows virus (BPYV) were developed and/or evaluated at the USDA-ARS laboratory in Corvallis, Oregon. Positive controls for the testing consisted of dried leaf samples of strawberries infected with each of the above viruses, shipped to Egypt and Israel under import permits. Collection of strawberry test samples was done in production fields (cultivars unknown) and from nuclear stock plants grown in Egypt ('Tamar' and 'Yael' originating from Israel). RNA extraction was carried out using Qiagen kits or a previously described protocol. Reverse transcription and polymerase chain reactions were carried as per manufacturer's recommendations. Amplicons were visualized after separation on an agarose gel and staining with ethidium bromide. The RT-PCR detection of viruses from RNA extracted from positive controls that were vacuum dried was successful for several but not all of the viruses used in this study. Thus, extracted RNA that can be shipped under ethanol may be a better positive control that dried tissue samples. Material carried back to the USA from Egypt as extracted RNA under ethanol was not impacted by storage at room temperature during transport. Initial testing of strawberry material from fields in Egypt showed that SMYEV, SVBV, BPYV and SPaV were detected in field samples. The plants tested from the nuclear stocks tested negative for each of the viruses tested.

우리나라에서 발생하는 딸기 바이러스병(2007-2008)

Virus disease surveys of strawberries cultivated and preserved as germplasm resources in Korea was conducted during 2007-2008. Virus detection was conducted by RT-PCR using total RNAs extracted from strawberry samples. We detected the infection with Strawberry mild yellow edge virus (SMYEV), Strawberry mottle virus (SMoV), Strawberry vein banding virus (SVBV) and Strawberry pallidosis associated virus (SPaV) while no infection with Strawberry crinkle virus (SCV), Strawberry necrotic shock virus (SNSV), Strawberry latent ring spot virus (SLRSV) and Arabis mosaic virus (ArMV) was observed. The infection rate of virus disease on 4 cultivars including Seolhyang, Maehyang, Gumhyang, and Dahong, bred in Korea, was 0.1, 1.9, 0, and 0%, respectively. Surprisingly, however, cultivar Red Peal introduced from Japan in 1997 revealed 48.3% virus infection rate. SMYEV, SMoV and SPaV were also identified in strawberries growing in the farm fields of Korea. In the field, however, SMYEV was the most predominant virus (97.4%) among those 3 identified viruses. SVBV was detected only in strawberry kept as a germplasm.

STRAWBERRY CHLOROTIC FLECK DISEASE MAY BE CAUSED BY A NOVEL CLOSTEROVIRUS

Chlorotic fleck (CF) is a graft transmissible disease identified almost 50 years ago. The disease agent can cause significant losses in strawberry and is known to be transmitted by the cotton aphid, an indication of the viral etiology of the disease. While CF was a major disease in the area where it was first identified (Louisiana, U.S.A.), no further steps were taken towards identification of the causal agent, probably because of the mild and inconsistent symptoms the agent caused on indicator plants. The strawberry decline observed in the western coast of North America during the last six years led us to investigate the possibility that novel agents may be involved in the symptomatology with CF being one of them. The known CF plant known to exist in the U.S.A. is maintained at the National Clonal Germplasm Repository in Corvallis, Oregon and was used to isolate the CF agent. Cloning and sequence analysis from dsRNA isolated from the CF plant verified the presence of three viruses, two of them being the criniviruses associated with pallidosis disease (Strawberry pallidosis associated virus and Beet pseudo yellows virus) and the third, a previously unidentified member of the family Closteroviridae. Phylogenetic analysis placed the virus in the Closterovirus genus, the aphid-borne closteroviruses. The genome of the new virus has been obtained and detection protocols developed have verified the presence of the virus in the U.S.A. Experiments are currently underway to determine if any of the major strawberry aphids are vectors of the virus.

First Report of Beet pseudo-yellows virus and Strawberry pallidosis associated virus in Strawberry in Peru.

During a 2006 survey for the presence of criniviruses in Peru, large numbers of greenhouse whitefly (Trialeurodes vaporariorum) were observed infesting strawberry (Fragaria × ananassa) fields near Huaral on the central coast of Peru. Plants exhibited a wide range of symptoms including stunting and reddening of leaves. These symptoms are characteristic of those induced by the presence of the criniviruses Beet pseudo-yellows virus (BPYV) and/or Strawberry pallidosis associated virus (SPaV) together with any of a number of different strawberry-infecting viruses (1,3). The virus complex causes older leaves to develop a red color, vein and petiole reddening, roots become stunted, and plants fail to develop. Leaf samples with varying symptoms were collected from 22 plants from 2 fields, each planted with a different cultivar. Total nucleic acid was extracted, spotted onto positively charged nylon membranes, and tested by hybridization with probes specific to the minor coat protein (CPm) gene of BPYV (2) and coat protein (CP) gene of SPaV (4). Results identified the presence of BPYV, SPaV, or both viruses in mixed infections in symptomatic strawberry, while control plants were infected with each virus individually. No signal was detected in virus-free strawberry. Secondary confirmation was obtained using probes specific to the RNA-dependent RNA polymerase (RdRp) genes of SPaV and BPYV. The SPaV probe corresponded to nucleotides 6116-6599 of SPaV RNA1 (GenBank Accession No. NC_005895), whereas the BPYV probe corresponded to nucleotides 6076-6447 of BPYV RNA1 (GenBank Accession No. NC_005209). All probes were generated by reverse-transcription polymerase chain reaction (RT-PCR) amplification using sequence-specific primers, cloning of RT-PCR products into pGEM-T Easy (Promega, Madison, WI), confirmation by sequencing, and expression as digoxygenin-labeled transcript probes (Roche, Indianapolis, IN). Field 1, containing cv. Fern Sancho, had the largest number of symptomatic and infected plants (5 of 12 BPYV, 6 of 12 SPaV, and 4 of 12 with both). Only 1 of 10 plants from field 2 containing cv. Tajo Holandesa was infected, but with both SPaV and BPYV. BPYV and SPaV are transmitted by the greenhouse whitefly (T. vaporariorum), although BPYV is transmitted much more efficiently and has a broader host range than SPaV (4). Movement of these viruses in Peru is likely a result of both propagation by runners and vector transmission. To our knowledge, this is the first report of either virus in Peru.

Epidemiology of Strawberry pallidosis-associated virus and Occurrence of Pallidosis Disease in North America.

Strawberry pallidosis-associated virus (SPaV) was found closely associated with pallidosis disease. The modes of transmission of the virus were studied, including pollen, seed (achene), and whitefly transmission. Three whitefly species were tested for their ability to transmit SPaV, but only the greenhouse whitefly, Trialeurodes vaporariorum, was identified as a vector of the virus. Testing strawberries for SPaV and Beet pseudo yellows virus (BPYV), a second crinivirus associated with pallidosis disease, in strawberry-producing areas in North America confirmed a high incidence of both viruses in areas where high populations of whiteflies were present. Infection rates as high as 90% for SPaV and 60% for BPYV were observed when plants exhibiting decline symptoms were tested. Lower rates of infection were found in regions where whiteflies were absent or found in low numbers. The role of these criniviruses in the strawberry decline observed over the past few years along the western coast of North America was examined.

Characterization and Recent Advances in Detection of Strawberry Viruses.

Characterization and Recent Advances in Detection of Strawberry Viruses.

First Report of Strawberry as a Natural Host of Apple mosaic virus.

Apple mosaic virus (ApMV) has been reported to naturally infect a number of hosts in the Rosaceae family including Rosa spp., Malus spp., and Rubus spp. etc., as well as several hosts such as Humulus spp. and Betula spp. in other plant families (2), but has not been reported to naturally infect Fragaria spp. although it has been grafted into Fragaria spp. (1). In an attempt to develop a detection method for strawberry leafroll as part of an overall strategy to develop diagnostics for all reported virus and virus-like diseases of strawberry, double-stranded RNA (dsRNA) was extracted and cloned as described elsewhere (3) from a single-leafroll-infected plant of Fragaria vesca 'UC-5' (CFRA no. 9026 maintained at the USDA-ARS National Clonal Germplasm Repository [NCGR] in Corvallis, OR). Newer leaves on the plant had a chlorotic peacock pattern with a few leaves exhibiting a downward leafroll. The dsRNA pattern suggested possible infection with a crinivirus and an ilarvirus. A database search (BLAST at the National Center for Biotechnology Information) showed that clones with sequence homology to two criniviruses (Strawberry pallidosis associated virus [SPaV] and Beet pseudo-yellows virus [BPYV] as well as ApMV) were obtained from this leafroll-infected plant. Sequences of the three viruses from this plant have been deposited in GenBank (Accession Nos. AY854050, AY854051, and AY854052 for ApMV, BPYV, and SPaV, respectively). The sequence obtained for the strawberry isolate of ApMV represents part of RNA 3 and covers the majority of the coat protein (CP) gene. The nucleotide sequence identity of the CFRA 9026 isolate with the CPs of other ApMV isolates range from 87 to 91% and the amino acid sequence identity ranges from 79 to 88% with similarities ranging from 84 to 94%. Two sets of primers were designed to amplify fragments of ApMV from strawberry (ApMV-str) and one set of degenerate primers to amplify ApMV from several hosts. With the ApMV-str specific primers, we were able to detect ApMV from strawberry but not from rose, whereas with the degenerate primers, we were able to detect ApMV in strawberry and rose. Amplicons obtained with all three sets of primers were sequenced and were identical to the sequence obtained during the cloning process. In addition, polyclonal antibodies were used to trap ApMV from infected strawberries onto polystyrene immunoassay plates (NUNC, Rochester, NY). After washing, reverse transcription (RT) reactions were carried out in these wells and used in polymerase chain reaction (PCR). The sequence of the amplicons obtained were ApMV-specific as determined by sequencing. At this time, only the leafroll infected plant from the collection at the NCGR in Corvallis, OR has been tested. To our knowledge, this is the first characterization of a virus associated with strawberry leafroll disease, and development of the RT-PCR test will allow for detection of this virus in field samples to determine its distribution and importance in strawberry production.

Nucleotide sequence, genome organization and phylogenetic analysis of Strawberry pallidosis associated virus, a new member of the genus Crinivirus

The complete nucleotide sequence of Strawberry pallidosis associated virus (SPaV), a newly identified member of the genus Crinivirus, family Closteroviridae has been determined. RNA 1 is 8067 nucleotides long and encodes at least three open reading frames (ORFs). The first ORF (ORF 1a) specifies a multifunctional protein that has papain-like proteinase, methyltransferase and RNA helicase domains. The RNA-dependent-RNA polymerase is encoded in ORF 1b and is probably expressed by a +1 ribosomal frameshift. The 3' ORF of RNA 1 encodes a small protein with two potential transmembrane helices. RNA 2 is 7979 nucleotides long and encodes 8 ORFs, similar in amino acid sequence and arrangement with those of other criniviruses. SPaV encodes the largest structural protein of closteroviruses sequenced to date as the minor coat protein of the virus has molecular mass of approximately 80 kDa. The 3' non-translated regions share nucleotide sequence identities of about 56% and the predicted folding of the non-translated regions is similar. Phylogenetic analyses reveal that SPaV is related most closely to Abutilon yellows virus and Beet pseudo-yellows virus, another virus that has been identified recently to cause identical symptoms on strawberry indicator plants as SPaV.

BLACKBERRY YELLOW VEIN ASSOCIATED VIRUS: A NEW CRINIVIRUS FOUND IN BLACKBERRY

During the last three years blackberries in southern and southeastern U.S. have shown symptoms of vein clearing, yellow mottling and plant decline with considerable variation in symptoms with cultivars. We isolated dsRNA from symptomatic plants and identified high molecular weight bands similar to those isolated from plants infected with criniviruses. Paired extractions from virus-tested blackberries did not yield any dsRNA bands with molecular weight greater than 500 bp. Using degenerate primers developed against the crinivirus 1b protein in RTPCR resulted in an amplicon that when sequenced showed the virus was a member of the Crinivirus genus. We have also cloned the virus and sequenced clones containing regions of the minor coat protein of the virus. Phylogenetic analysis revealed that the new virus, designated as Blackberry yellow vein associated virus (BYVaV), is related most closely to Beet pseudo-yellows virus and Strawberry pallidosis associated virus, two criniviruses recently identified in strawberry. INTRODUCTION Symptoms of vein clearing, yellow mottling, ringspots and plant decline have been observed in blackberry in South Carolina, North Carolina and Arkansas over the past few years (Fig. 1). Initially the symptoms were thought to be caused by Tobacco ringspot virus (TRSV) as this virus is known to infect blackberry and similar symptoms attributed to TRSV infection have been reported (1). Symptomatic plants were tested for 14 viruses by ELISA including: Alfalfa mosaic, Arabis mosaic, Cucumber mosaic, Impatiens necrotic spot, Prunus necrotic ringspot, Raspberry bushy dwarf, Raspberry ringspot, Strawberry latent ringspot, Strawberry mild yellow edge, Tobacco ringspot, Tobacco streak, Tomato ringspot, and Tomato spotted wilt viruses as well as for Potyviruses using group specific antibodies. However, in ELISA tests very few plants that exhibited these symptoms tested positive for TRSV or any other virus. In this report we describe a crinivirus associated with the symptoms observed in blackberry and a reverse-transcritase polymerase chain reaction (RT-PCR) method for detecting this new virus. MATERIALS AND METHODS In an attempt to determine if there may be a new virus associated with these symptoms dsRNA was extracted from symptomatic and asymptomatic plants using a shortened version of the standard extraction method (2). After the dsRNA was bound to the cellulose powder in the presence of 16% ethanol in STE buffer, the samples were centrifuged for three minutes at 5,000 X g, the pellet was washed once with 50 ml of STE-EtOH and the cellulose repelleted by centrifugation. Two ml of STE was added to the final pellet and incubated at room temp for 5 min. The sample was then transferred to a microfuge tube and pellet at max rpm for 3 min. The supernatant was collected and nucleic acid precipitated by the addition of 2 ml of 95% EtOH with 5% 3 M sodium acetate. Samples were mixed then stored at -80C for 20 minutes before centrifugation in a microfuge at max speed for 30 minutes. Pellets were resuspend in 10 mM Tris-HCl containing 1 mM EDTA and analyzed by gel electrophoresis. Proc. X IS on Small Fruit Virus Diseases

Complete nucleotide sequence of a strawberry isolate of Beet pseudoyellows virus.

In our effort to identify the causal agent(s) of strawberry pallidosis we found a single pallidosis positive plant that did not give any amplicons after RT-PCR using primer sets representing multiple regions of Strawberry pallidosis associated virus (SPaV) genome and failed to react with antibodies directed against the recombinant coat protein (CP) of SPaV. DsRNA extracted from this plant showed a similar pattern to that of SPaV indicating that another crinivirus may infect strawberry. Sequence analysis of multiple cDNA clones corresponding to the heat shock 70 homolog gene (HSP70h) of the unknown virus indicated that it was Beet pseudoyellows virus (BPYV). Analysis of the complete nucleo- tide sequence of BPYV-strawberry revealed that this isolate has several distinct features when compared to Cucumber yellows virus (CuYV), a cucumber strain of BPYV, including an entire ORF not found in CuYV.

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease.

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAG- ATGTCCACTAATGATA 3') were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity.