Sterile Distilled Water Research Articles

Neuroprotective Role of Zingerone: Investigating the Effective Doses of Zingerone in Lead Acetate-Induced Brain Dysfunctions in Rats

This experiment was designed to determine the effective dose of zingerone against the sublethal dose of lead acetate that induced brain dysfunctions in rats through using different successive doses of zingerone on some parameters related to oxidative stress for 28 days. Thirty-six adult male rats were randomly selected and divided equally into six experimental groups and treated for 28 days as follows: Control group: administered (orally) sterile distilled water. G1 group: administered (orally) (1/280 from LD50) of lead acetate and treated with 25mg/kg for 4 weeks, the rats were then dissected. G2 group: administered (orally) (1/280 from LD50) of lead acetate and treated with 50mg/kg for 4 weeks, the rats were then dissected. G3 group: administered (orally) (1/280 from LD50) of lead acetate and treated with 100mg/kg for 4 weeks, the rats were then dissected. G4 group: administered (orally) (1/280 from LD50) of lead acetate and treated with 150mg/kg for 4 weeks, the rats were then dissected. G5 group: administered (orally) (1/280 from LD50) of lead acetate and treated with 200mg/kg for 4 weeks, the rats were then dissected. Blood samples were collected, by heart punched under anesthesia, at the end of the experiment for measuring the serum malondialdehyde, neuroglobulin, and dopamine concentrations. The result showed a significant (P<0.05) positive correlation between successive doses of zingerone and dopamine and neuroglobulin concentrations, while a significant (P<0.05) negative correlation between successive doses of zingerone and the concentration of malondialdehyde in all animals that are treated with lead acetate compared to the control group. Concluded from this research show that the zingerone has potent antioxidants and neuroprotective effects at the dose 125 mg/kg BW may result in a significant improvement of the neurotransmitter levels and decrease in the production of oxidative stress to the brain tissue.

First report of Pectobacterium peruviense as the causal pathogen of blackleg and soft rot in Solanum tuberosum cv. Superchola in Cañar, Ecuador.

Potato (Solanum tuberosum) is grown in Ecuador's Andean region at altitudes from 2,200 to 3,600 m.a.s.l., and the most commercially significant cultivar is Superchola, which constitutes 60% of total production, covering around 11,000 hectares (MAG, s.f. 2022). From November 2022 to January 2023, dark, water-soaked lesions progressing upwards from the base of the stems were observed on Superchola potato plants in Cañar, Ecuador (2°23'56.4''S 78°59'13.2''W). Approximately 20 plants in a hectare showed symptoms. Symptomatic stems from five plants were collected, surface-disinfected with 2% sodium hypochlorite, followed by 70% ethanol, and thoroughly rinsed with sterile distilled water. Plant tissue sections (1 cm²) were homogenized in 10 mM MgCl₂, serially diluted, and plated on Tryptic Soy Agar (TSA). After 48 hours of incubation at 28°C, creamy-white, yellowish, and white round colonies appeared. Streak plating was performed, yielding 14 purified bacterial isolates named M1 to M14. For the pathogenicity tests, each purified isolate was inoculated into healthy potato tubers and stem pieces (5 cm) using the prick inoculation method described by Ma et al. (2018) with modifications. Surface-sterilized tubers and stems were wounded using autoclaved toothpicks, into which 5µl of a bacterial suspension, carrying ~1 x 106 CFU/ml of bacteria per strain, was deposited into a 5 mm deep wound. Three independent replicates were conducted. Only one isolate, designated as M3, presented maceration on potato tubers, and dark, watered-soaked lesions appeared on the stem 48 h post-inoculation with strain. Other bacterial isolates showed no symptoms in either stems or tubers. Pathogenicity tests were confirmed on healthy, 4-week-old potato plants grown in a 50% perlite and 50% peat moss substrate. Inoculations were done using two methods: (1) toothpick piercing, where 5 µl of saline solution containing ~1 x 106 CFU/ml of bacteria was applied to a wound approximately 5mm deep (Ma et al. 2018), and (2) immersion of the plant foliage in a bacterial suspension of 1x 108 CFU/ml in saline solution for 10 min Controls used bacteria-free toothpicks (wounded) and sterile 10 mM MgCl₂ solution (unwounded). Plants were enclosed in plastic containers to maintain high humidity and grown at 15/25°C (day/night) with a 12 h photoperiod. Five days post-inoculation, blackleg symptoms were observed in the stems of the infected area, which turned black and rotten (wounded and unwounded). In all cases, negative controls remained symptomless. To complete Koch's postulates, bacteria were reisolated from symptomatic potato stems and showed the same morphology. To identify the isolate M3, whole genome sequencing using Oxford Nanopore technology was performed. Three marker genes were extracted, and a 5,734-bp sequence was concatenated from dnaX (2073 bp), recA (1,074bp), and leuS (2,583bp) (GenBank accession nos. PQ177849, PQ177847 and PQ177848, respectively). The concatenated sequences of M3 and type strains were used to construct a multilocus Bayesian inference phylogenetic tree using BEAST version 1.8.4. Isolate M3 grouped with Pectobacterium peruviense, showing a 100% sequence identity with the type strain P. peruviense IFB5232(Drummond et al. 2012; Portier et al. 2019; Toth et al. 2021; Waleron et al. 2018). To our knowledge, this is the first report of P. peruviense causing blackleg and soft rot in potato plants in Ecuador. Further research is essential, but this information could assist in monitoring the pathogen's spread and developing disease management strategies.

First Report of Lelliottia amnigena Causing Soft Rot on Purple Stem Mustards in China.

The purple stem mustards (Brassica rapa subsp. chinensis var. purpuraria) (Govaerts R, 2003) are widely cultivated along Yangtze River Valley in China, which is famous for its flavorful and nutritious edible stalks (Wang et al., 2022). In February 2023, a disease of soft rot was observed in multiple purple stem mustards planting fields in Wuhan city, Hubei province, China (30.41°N, 114.22°E). Disease incidence rates were almost 20 to 30% in the planting area (5 ha in size), causing severe economic loss. Infected plants displayed water-soaked symptoms at the base of the petioles, emitting a foul soft rot odor. The severely infected petioles, stems and roots exhibit pus symptoms leading to plant death. To identify the causal agent, small pieces of soft rot symptomatic tissue were cut from the margin of necrotic lesions and surface disinfected with 75% (v/v) ethanol for 30 seconds, followed by three successive rinses with sterile distilled water. The exudates from the clipped tissues were serially diluted and then incubated onto nutrient agar (NA) plates to obtain purified strains at 28°C for 48 hours (Koike et al., 2002). After incubation, 15 strains were obtained and the colonies of all strains were Gram-negative, aerobic, small, round, convex, whitish to dull white, and had smooth slimy edges. Three single bacterial strains CT020801 - CT020803, which were individually isolated from three different diseased samples, were selected as representative strains for further study. Biochemical tests using the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA) revealed that these strains were positive for methyl red, pectin, dextrin, D-Cellobiose, β-galactosidase, citrate, and maltose, but negative for indole, arginine dihydrolase, urease, ornithine decarboxylase, and gelatinase tests. The 16S ribosomal RNA gene and the three housekeeping genes, atpD, rpoB, and recN were amplified using genomic DNA of Lelliottia amnigena NCTC12124T as the template, with specially designed primers. All amplified fragments were sequenced and deposited in GenBank with accession numbers OQ954706-OQ954707, OQ954713, and OQ953873-OQ953881. BLAST alignments of the 16S rRNA, atpD, rpoB and recN sequences revealed that the sequences of Strain CT020801-03 exhibited the highest identity (100%, ≥97.97%, ≥98.85% and ≥94.52%, respectively) with L. amnigena （Figure S2）. Phylogenetic tree analysis based on multilocus sequence joint 16S rRNA - atpD - rpoB - recN revealed that CT020801 - CT020803 and L. amnigena clustered together in the same clade (Carrie et al., 2013). These results were consistent with those reported for Lelliottia amnigena (Osei et al., 2022). To confirm pathogenicity, healthy base petioles of three-week-old purple stem mustards seedlings were stab inoculated with 20 μL bacterial suspensions (approximately 108 CFU/mL) and then incubated at 28°C and 80% relative humidity in a growth chamber. A sterile liquid NB medium served as the negative control. The test was repeated thrice with each test consisting of five seedlings per treatment. After three days, soft rot symptoms appeared on the stem bases of the inoculated plants, consistent with the initial symptoms observed in the field. Control plants showed no symptoms. The strains were successfully re-isolated from symptomatic plants and identified as L. amnigena, fulfilling Koch's postulates. L. amnigena, a member of the Enterobacter genus (Birlutiu et al., 2023; Brady et al., 2013; Izard et al., 1981), is commonly found in soil and has been identified as an opportunistic pathogen responsible for plant soft rot disease (Reyes-García et al., 2020; Schroeder et al., 2009; Wu et al., 2023). Previous studies have linked L. amnigena to soft rot disease in potato tubers in China. However, this study marks the first documented case of L. amnigena causing soft rot disease in purple stem mustards in China. This discovery expands the known host range of the pathogenic bacteria and will help to provide essential information for making effective measures to manage this disease.

First Report of Xanthomonas hortorum pv. vitians as the Causal Agent of Bacterial Leaf Spot on Lettuce in China.

Lettuce (Lactuca sativa) is a leafy vegetable that belongs to the family Asteraceae. This cool-season crop grows well during Spring and Fall in China (Qi et al., 2021). In October 2023, a leaf disease with dark brown to black lesions was observed on lettuce (var. iceberg) in Yongning Town, Yanqing District, Beijing, China (40°53'N, 116°16'E). The disease incidence ranged from 10 to 40% in the surveyed greenhouse and field. Translucent and water-soaked brown spots were observed on the margins of leaf, then coalesced into large necrotic lesions surrounded by a chlorotic halo. Infected sections were soaked with 75% ethyl alcohol for 7 second, rinsed with sterile water for 15 second twice, and cut into pieces in the sterile water. The sample extracts were streaked on Nutrient agar medium. After incubation for 48 hours, 12 colonies were obtained and all the colonies were Gram-negative and aerobic with yellow, round-shape, smooth and glistening appearance. Four isolates SCZX1-SCZX4 with typical characteristics were selected for further identification tests. Pathogenicity test of SCZX1-SCZX4 was performed on the three-week-old lettuce (var. butterhead) by spraying with the bacterial suspension (108 CFU·ml-1). Inoculated lettuce were incubated at 26℃ and 70% relative humidity in the growth chamber. Another set of lettuce plants were mock inoculated with sterile distilled water. Three trials were carried out per isolate, and each treatment included fifteen lettuce plants. Symptoms appeared within 7-10 days after inoculation and are identical to those naturally infected lettuces. Negative control plants had no symptoms. The 16S rRNA region and two housekeeping genes (gyrB and atpD) of each isolate were amplified with universal primers F27/R1492 (Monciardini et al., 2006) and specific primers (Roach et al., 2018), respectively. According to BLAST analysis of each isolate (Genbank accession number PP027925, PP140779, PP140781 to PP140783, PP137422 to PP137428), BLAST searches of the obtained sequences revealed 100.0% of 16S rRNA region(1400/1400 nucleotides), 100.0% of gyrB(774/774 nucleotides), and 100.0% of atpD(768/768 nucleotides) identity and query coverage to Xhv CFBP 498 (Genbank accession number LR828257.1). Phylogenetic analysis revealed that SCZX1-SCZX4 clustered with the neopathotype strain Xhv LMG 938PT, which was isolated from a diseased L. sativa in Zimbabwe (Timilsina, S et al., 2015). Physiological and biochemical tests of SCZX1-SCZX4 were conducted by the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA), and the test results are consistent with the Xhv LMG 938PT (Morinière, L et al., 2020) and L1-L7 (Pernezny, K et al., 1995). Strains were re-isolated from re-inoculated lettuce, then re-identified as Xhv by the same method, fulfilling Koch's postulates. Bacterial leaf spot (BLS) is a worldwide-spread lettuce disease caused by numerous bacterial pathogens, including Xhv (Dia, N.C et al., 2022), Pseudomonas cichorii (Patel, N et al., 2021) and P. viridiflava (Alippi, A. M et al., 1999) etc. Xhv had been widely reported as the causal pathogen of BLS in Turkey (Sahin, F et al., 2000), United States (Bull, C.T et al., 2007), Saudi Arabia (Al-Saleh, M et al., 2008), and France (Morinière et al., 2020). However, the first report of Xhv causing BLS on lettuce in China is significant to provide pathogen information for growers in making effective measures to manage this disease.

First Report of Neofusicoccum nonquaesitum Causing Branch Dieback of English Walnut (Juglans regia) in the Maule Region, Chile

English walnut (Juglans regia) cultivation has been expanding in recent years in Chile, with a surface of 9,000 ha planted in the Maule Region (35° 26' S, 71° 40' W), central Chile. In a field survey conducted between August (2022) and January (2023) in three localities of the Maule Region, several declined trees were observed. English walnuts exhibited small chlorotic leaves, cankers, dead twigs, and dieback of branches, with an incidence of 10 to 35% of trees affected per orchard. Internally, diseased branches exhibit brown to dark brown wood cankers. Symptomatic branches (n = 30) were collected and surface disinfected with 96% ethanol, and flamed. Pieces of wood (approximately 5 mm) were placed on potato dextrose agar (PDA), supplemented with 0.005% tetracycline, 0.01% streptomycin, and 0.1% Igepal CO-630 (Díaz et al. 2018), and incubated at 22°C for 5 days in darkness. Four isolates (VLC-1-6-20, VLC-1-10-20, VLC-1-12-20, and VLC-1-15-20) exhibited moderate growth rates (16.4 mm/day), developing a white hue to olivaceous black colonies after 7 days at 22°C on PDA. Chlamydospores were absent. Black pycnidia were formed individually or in clusters. The isolates produced aseptate, hyaline, and fusiform, with base truncate conidia measuring 24.8 ± 1.6 x 6.8 ± 0.63 µm (l/w = 3.1; n = 50). The four isolates characterized were amplified using of the internal transcribed spacer (ITS1/ITS4), a portion of beta-tubulin (Bt2a/Bt2b), and part of the translation elongation factor 1- α (EF1-728/EF1-968) genes (Phillips et al. 2013). Blast analyses showed 100, 99 and 100 % identity with ex-type isolate PD-484 of Neofusicoccum nonquaesitum for ITS (deposited as GenBank accession no. PP697845 to PP697848), Bt (PP789576 to PP789579) and EF1 (PP830824 to PP830827) regions, respectively. Combined phylogenetic analysis using MEGA 7 software and the maximum likelihood test clustered the four isolates with ex-type of N. nonquaesitum. Pathogenicity was performed using two isolates (VLC-1-6-20 and VLC-1-10-20), which were inoculated in healthy tree walnuts cv. Chandler (8 years old), using 40 μl of mycelial suspension (105 fragments of mycelium/ml) on rounded wounds in the middle of each attached young branch (n=30 branches) (Twizeyimana et al. 2013). Sterile distilled water was used as a control treatment. Pathogenicity tests were repeated twice. After 6 months, necrotic streaks with mean lengths of 13 mm and 28 mm were observed in the middle of wounded young branches. No necrotic lesions were observed in the control treatments. Reisolation of N. nonquaesitum was positive (100%) only from inoculated branches and molecularly identified (EF1-a), fulfilling Koch’s postulates. Previously, N. nonquaesitum has been reported causing dieback on English walnut in California (Chen et al. 2014). To our knowledge, this is the first report of N. nonquaesitum causing canker and branch dieback of English walnut in central Chile. Previously, Diplodia mutila, Dothiorella sarmentorum, and N. austral have been associated with walnut dieback in Chile (Díaz et al. 2018; Iqbal et al. 2023; Barcos et al. 2023). In conclusion, it is imperative to implement epidemiological studies to avoid the spread and severity of branch dieback of walnuts in the Maule region, central Chile.

First Report of Fusarium proliferatum Causing Pinellia ternata Corm Rot in Henan, China.

Pinellia ternata (Thunb.) Makino is a perennial herb of the genus Pinellia in the Araceae family, which is a kind of precious Chinese herbal medicine (Bai et al. 2022). In May 2023, rotting was observed on P. ternata corm in the Tanghe planting base (3.33 ha, 32º46´6˝N, 113º 8´47˝E, 138 m), with an incidence of approximately 10%. To identify the causal agent, five rotten corms were randomly sampled from the Tanghe planting base. Symptomatic corm tissues were cut into small pieces (3 mm3) with asymptomatic tissue margins, disinfected in 75% ethanol for 30s and in 2% sodium hypochlorite for 3 min, rinsed three times with sterile distilled water, and then placed on synthetic nutrient-poor agar (SNA) plates incubated at 20℃ with a 12 h light/dark photoperiod. Hyphal-tips from the growing edge of colonies were transferred to fresh SNA to obtain pure cultures. In total, five pure isolates were obtained with similar colony morphology and white (top view) or grayish white (back view) coloration, with villous surfaces and abundant aerial hyphae. On SNA, the isolates mainly produced microconidia. Microconidia were ellipsoidal to cylindrical, thin-walled, smooth, hyaline and measured 5.40 to 11.98 (av. 7.14) µm long and 1.60 to 5.38 (av. 2.54) µm thick (n=50). Based on these morphological characteristics of colony and conidia, the causal agent was preliminarily identified as Fusarium sp. (Crous et al. 2021). To confirm pathogen identity, the total genomic DNA of 2 isolates (BX-2 and BX-3) was extracted using the 2×T5 Direct PCR kit (Beijing Tsingke Biotech Co., Ltd, Beijing, China). The internal transcribed spacer (ITS), RNA polymerase II second largest subunit (rpb2), translation elongation factor 1-alpha (tef1), and β-tubulin (tub2) gene were PCR-amplified using the universal primers ITS1/ITS4, 5f2/7cr, EF-1/EF-2 and BT2F/BT4R (Crous et al. 2021), respectively. Sequences have been deposited in GenBank (PP125560-PP125561 for ITS, PP782474-PP782475 for rpb2, PP782476-PP782477 for tef1, PP171436-PP171437 for tub2). BLAST search showed that all sequences were 99% to 100% homology with the corresponding sequences of Fusarium proliferatum (CBS 182.32). A phylogenetic tree was constructed based on the Maximum-Likelihood method in MEGA-X (Kumar et al. 2018) and revealed that the two isolates were closest to F. proliferatum. The pathogenicity tests were conducted with the two isolates (BX-2 and BX-3) as described by Liu et al. (2022) with slight modifications. For each treatment, five healthy P. ternata corms were inoculated with 1ml of conidial suspension (1×107 conidia/ml). Control plants (n=5) were inoculated with sterilized water. All samples were covered with plastic bags and maintained at a relative humidity greater than 90% in a greenhouse at 20℃ with a 12 h light/dark photoperiod. After 15 days, inoculated corms showed similar symptoms to those on the original diseased plants, while control plants remained symptomless. F. proliferatum was successfully reisolated from the inoculated plants and identified based on its morphological characteristics. Thus, Koch's postulates were fulfilled. The experiment was repeated thrice with similar results. Morphological characteristics, sequence alignment and Koch's postulates test confirmed that F. proliferatum was the cause of P. ternata corm rot disease. To our knowledge, this is the first report of F. proliferatum causing P. ternata corm rot in Henan province, China. Our findings are important for informed surveillance of the disease.

First Report of Southern Blight of Epimedium sagittatum Caused by Agroathelia rolfsii in Henan, China.

Epimedium [Epimedium sagittatum (Sieb. et Zucc.) Maxim., E. brevicornu Maxim., E. pubescens Maxim., E. koreanum Nakai] plants are perennial herbs and the dry leaves were used in traditional Chinese medicine with different medicinal effects (Chinese Pharmacopoeia, 2020 edition). In early August 2022 (the high temperature was 33 ℃ and the low temperature was 25 ℃ on average with above 70% relative humidity), large necrotized leaf spots were initially observed in one-year and two-year old E. sagittatum plants in Dengzhou (32°35'26.84" N, 112°11'8.37" E), Henan province, China. White mycelia, yellow and brown sclerotia were observed along the petioles and colonized to the back of leaves and also on soil-petioles interface around the diseased Epimedium plants. White mycelia spread rapidly from the disease plants as a center to neighboring plants and the infected plants eventually wilted. The disease incidence was 16.0% and 28.0% in the surveyed cultivation fields in Dengzhou (Henan) and Danjiangkou (Hubei), respectively, which resulted in above 20% of yield loss. The symptomatic tissues (petioles, n≥10) were cut into 0.5 cm sections with autoclaved scissors and surface sterilized with 75% ethanol for 30 s, followed by 3 min in 1% NaClO, rinsed three times with distilled sterile water, plated on autoclaved filter paper to remove excess moisture in a biological laminar hood, transferred onto potato dextrose agar (PDA) plates and incubated at 28℃ in incubator in the dark for 3-5 days. Twelve fungal isolates with white radial colony morphology were obtained and purified by hyphal-tip method. The isolates formed radial colonies showing abundant aerial mycelia with a growth rate of 19.25 to 22.25 mm/day (mean = 21.67 ± 0.77 mm; n = 36) and white abundant sclerotia were observed after 5-7 days post inoculation at 28℃. The hyphae of the isolates were hyaline, branched with clamp connections at septa. The isolates formed dark brown sclerotia on PDA plate post 10-14 days incubation. The diameter of mature brown sclerotia ranged from 1.31 to 3.07 mm (mean = 1.91 ± 0.39 mm; n = 40) and 13 to 45 sclerotia (mean = 28; n = 24) were observed on each Petri dish. The isolates were tentatively identified as Agroathelia rolfsii based on morphological characteristics (Yi Y., et al. 2024) and isolate YYHBJ1 was selected as representative isolate for molecular identification and pathogenicity test. The genomic DNA was extracted using CTAB method. For molecular identification, ITS region, translation elongation factor-1alpha (TEF-1α) and nuclear large-subunit ribosomal DNA (nLSU-rDNA) were amplified (White et al. 1990, Wendland and Kothe, 1997). The sequences 684-bp ITS (OR428367), 534-bp TEF1α (OR485567), and 965-bp nLSU-rDNA (OR426612) of isolate YYHBJ1 were deposited in GenBank. Sequence analysis revealed that ITS, TEF1α and nLSU-rDNA sequences of YYHBJ001 showed 100%, 99.63%, and 100% identity to ITS (MN380242 and JF819727), EF1α (MN262527) and nLSU-rDNA (MT225781 and AY635773) sequences of Agroathelia rolfsii (Sacc.) Redhead & Mullineux (Redhead and Mullineux 2023). Pathogenicity tests was confirmed by inoculating 1 year-old E. sagittatum plants grown in pots with sterile soil. PDA plug (5 mm diameter) colonized with 3 brown sclerotia and the fungal culture which was cultivated for 12 days was deposited beside the petiole on the surface of the soil. The control plants were inoculated with PDA plugs without the pathogen. Five plants were used in each treatment. The plants were cultivated in incubator at 28℃ with 80% relative humidity. Fourteen days later, white mycelia growing out from the sclerotia and spread along the petioles to the leave and the infected leaves were yellow. After 21 to 24 days, all inoculated plants displayed symptoms like those observed in field, while no symptoms were observed on the controls. The fungus was re-isolated from the inoculated plants as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. Based on morphological feature and DNA sequences, the pathogen of southern blight on Epimedium plants was identified as A. rolfsii (anamorph S. rolfsii). The pathogen A. rolfsii usually infect kinds of crops and cause southern blight, such as peanuts, chili peppers, green onion and so on (Daunde et al. 2018). To our knowledge, this is the first report of A. rolfsii causing southern blight on E. sagittatum plants in Henan in China.

First report of leaf spot disease caused by Fusarium asiaticum on Lonicera caerulea L. in Heilongjiang Province, China.

Heilongjiang is the largest province with the small, cultivated fruit plant, blue honeysuckle (Lonicera caerulea L.), in China (Sun et al. 2024). Between September 2022 and September 2023, a leaf spot disease was observed on about 10 percent of blue honeysuckles of the 'Lanjingling' cultivar grown in a 6.66-ha field in Mudanjiang (129.38°E, 44.59°N), Heilongjiang Province, China. The typical symptoms include a few small brown sunken leaf spots (approximately 2 mm) in the fruiting stage that gradually expand into larger brown sunken lesions (approximately 10 mm) in the senescence stage (Fig. S1). Small 3-4-mm segments of infected tissue from 100 randomly selected leaf samples with typical symptoms were surface sterilized with 75% ethanol and 5% sodium hypochlorite, rinsed in sterile distilled water, and transferred to 9-cm Petri dishes containing potato dextrose agar (PDA) after drying. Finally, 10 isolated fungi were obtained through single-spore culture on PDA, and their conidia displayed a morphology consistent with Fusarium spp. (Zheng et al. 2023), and no other fungi were isolated. The fungal colonies on PDA were pink to dark red with fluffy aerial mycelium and pigmentation (Fig. S2). Microconidia were not observed, and the macroconidia of fungi had 2 to 6 septa, which were slender, sickle-shaped to nearly curved, with an average size of 38.83 (21.30 to 55.20) × 3.87 (2.70 to 6.60) μm (n = 50) on carnation leaf agar (Fig. S3). Genomic DNA was extracted from the representative isolate LD-245 for molecular verification, and PCR amplification was performed with ITS1/ITS4 (White et al. 1990), RPB2-5F2/RPB2-7CR (Liu et al. 1999), and EFl/EF2 (O'Donnell et al. 1998) primers. Sequences of LD-245 ITS (OR565903), RPB2 (OR584061), and TEF (PP965657) revealed 99 to 100% (494/494, 722/726, and 654/654) of identity with Fusarium asiaticum (MT322117, MH582121, and MT330257). Phylogenetic tree was constructed based on the concatenated sequences of ITS, RPB2, and TEF genes, and LD-245 was clustered with F. asiaticum (Fig. S4, Table S1). Therefore, based on the morphological characteristics and molecular phylogeny, LD-245 was identified as F. asiaticum. Six two-year-old healthy plants of the 'Lanjingling' cultivar were selected for a pathogenicity test. Three plants were inoculated with LD-245 conidial suspension (1 × 106 spores/ml) or with sterile water as an experimental control. All plants were cultured in a greenhouse (28℃, 75% relative humidity, 12 h light and dark cycle), and each experiment was replicated three times. Typical leaf spot symptoms were observed on inoculated leaves after 10 days (Fig. S5), whereas no symptoms were detected on water-treated leaves. The pathogens re-isolated from infected leaves displayed the same morphological and molecular traits as the initial isolate, and were again identified as F. asiaticum, confirming Koch's postulate. F. asiaticum was previously reported on giant elephant's ear (Alocasia macrorrhizos) (Zheng et al. 2023), causing leaf spot disease in China. This study is the first report of blue honeysuckle leaf spot disease caused by F. asiaticum in China. China has the largest blue honeysuckle cultivation area globally, and the production of blue honeysuckle with horticultural value is important for growers (Sun et al. 2024). Therefore, we hope researchers can develop efficient measures to manage emerging plant diseases in the future.

First Report of Leaf Spot on Lonicera japonica Caused by Aspergillus niger in China.

Honeysuckle (Lonicera japonica Thunb, LJ) is a common medicinal and edible plant (He et al. 2022). It has been utilized in various industries such as biomedicine, animal husbandry, and food production (Li et al. 2014; Su et al. 2020). In June 2023, a significant leaf lesion was observed on approximately 20% of honeysuckle "Juhua No.1" leaves in a 3.33-ha field at the base of Julu County, Hebei province, China. Almost all leaves were infected. Leaf spot disease occurred in the field honeysuckle throughout the flowering period, especially after picking. The disease mainly infected the leaves of honeysuckle, forming irregular spots on the edge of the leaf surface with black-brown edges, the midrib and lateral veins were affected (Figure S1A). In advanced stages, the entire leaf would become necrotic. For pathogen isolation, small pieces (4×4 mm) of the infected tissue from diseased leaves were surface sterilized with 75% ethanol and 5% sodium hypochlorite, rinsed with the sterile water, incubated on PDA. Finally, six isolated pathogens were obtained. Hyphae were white. The mycelium was multicellular, had diaphragm. Conidiophores protruded from the stroma, started as spherical structures and gradually developed into radial, black-brown formations. Spore acrosome was subglobose, bilayered pedicels covering acrosome, 40-60 µm in diameter, yellowish brown (Figures S1B, S1C). Based on morphological and cultural characteristics, the leaf spot disease fungus was tentatively identified as Aspergillus spp. (Wei 1979). To test the pathogenicity of pathogen, leaves of three healthy potted honeysuckle "Juhua No.1" plants were inoculated by sprayed with conidial suspensions (106 spores/ml) (Figure S1D). Negative controls were established by inoculating leaf with sterile distilled water. All plants were incubated in a greenhouse at 28 ± 2℃. The experiment was replicated three times. After 10 days, typical leaf spot symptoms were observed on inoculated leaves, whereas no symptoms were found on the control groups. The re-isolated fungus from the inoculated leaves displayed the same morphological traits (Figures S1E-S1H), again identified as Aspergillus spp., confirming Koch's postulates, designated as H2. To confirm the pathogen's identity, genomic DNA was extracted from the pathogenicity isolate H2. The 18S rDNA and the ITS genes were amplified and sequenced using primer pairs S1/S2 (Zhang et al. 2018) and ITS1/ITS4 (Zhang et al. 2023), respectively. Results of BLAST searches showed that the 18s rDNA and ITS sequences of H2 were highly homologous (>99%) with Aspergillus niger. The close genetic relationship indicated that H2 belonged to the genus Aspergillus (Figure S2a). We further sequenced the whole genome of H2. The sequence data were available in the NCBI GenBank (Accession number: PRJNA1117256). We also analyzed the ANI (Yoon et al. 2017) and digital DNA-DNA blotting (dDDH) (Figures S2b, S2c). The ANI values of H2 compared to Aspergillus niger CBS 554.65 and Aspergillus niger KJC3 were higher than 95%. The dDDH values of H2 compared to Aspergillus niger CBS 554.65 and Aspergillus niger KJC3 were higher than 70%. Above all results, honeysuckle leaf spot disease was identified as Aspergillus niger. This is the first report of leaf spot on Lonicera japonica caused by Aspergillus niger in China. Our findings expand the geographical range of A.niger-infected plants, also provide reference for scientific prevention and control of honeysuckle leaf spot disease.

Impact of Acidic and Alkaline Environments on the Surface Morphology of Biodentine and White Mineral Trioxide Aggregate - An In-vitro Study.

The physical and chemical properties of calcium silicate cement might be affected due to exposure to acidic or alkaline conditions during clinical use. The present study aimed to evaluate the effect of acidic and alkaline environments on the surface morphology of biodentine (BD) and white mineral trioxide aggregate (wMTA). Disc-shaped specimens of BD (n = 30) and wMTA (n = 30) were prepared in a metal mould and wrapped in pieces of gauze. They were divided into three sub-groups according to the storage media: group A, soaked in sterile distilled water at a pH of 7.0; group B, exposed to butyric acid buffered at pH 4.0; and group C, exposed to calcium hydroxide solution buffered at pH 12.0. The specimens were incubated for 7 days at 37°C, followed by examination under scanning electron microscopy at 1000x and 5000x magnification to characterise the microstructural morphology. Definite changes were seen in the microstructure of BD and wMTA on exposure to acidic and alkaline pH. The microstructure of wMTA tends to exhibit reduced cohesion when exposed to an acidic environment, especially when compared to an alkaline pH. Acidic pH exerts a milder influence on the morphological structure of BD when contrasted with its effects on wMTA. Biodentine may emerge as a more prudent choice than wMTA for utilisation in inflamed periapical regions.

First Report of Colletotrichum spaethianum Causing Anthracnose on Jiaotou (Allium chinense G. Don) in China.

Jiaotou (Allium chinense G. Don) is a culinary and aromatic herb belonging to the family Amaryllidaceae. It is native to China and cultivated for its culinary uses in many other countries, which also possess high medicinal value in traditional Chinese medicine (Rhetso et al. 2020). In March 2023, a disease resembling anthracnose was detected in the fields of Changde city, Hunan Province, China. The symptoms manifested as yellow to brown necrotic spots located at the tip or middle of the blade. The lesions tended to wrinkle, leading to leaf distortion, thinning, and wilting. This disease has a high incidence rate of approximately 50% in an area of nearly 20 hectares. Ten symptomatic plants were collected for pathogen isolation. The leaf tissues were surface sterilized using 70% ethyl alcohol and 2% sodium hypochlorite, rinsed with sterile distilled water, and then transferred to potato dextrose agar (PDA) and incubated at 26°C in the dark. Ten colonies with similar cultural morphology were selected from the 10 affected plant samples. The fungal strains produced densely aerial mycelium on PDA, displaying off-white to gray-brown coloration. Conidia were hyaline, curved or slightly curved, aseptate, with a rounded apex and truncate base, contained oil globules, and measuring 21.0 to 29.0 × 4.1 to 5.3 μm (n = 50. Appressoria were dark brown, irregular in shape, partially lobed, and measured 6.5 to 15.5 µm long × 5.0 to 10.5 µm wide. Setae were straight, dark brown, with two- to three-septate, 78.5 to 155.4 μm long (n = 50). These morphological characteristics were similar to Colletotrichum spaethianum (Damm et al. 2009). The internal transcribed spacer (ITS) region of rDNA, actin (ACT), chitin synthase (CHS-1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes of three representative strains, JT-1, JT-2 and JT-3, were amplified and sequenced as described in Weir et al. (2012). These sequences were 99 to 100% identical to corresponding sequences of C. spaethianum strains (565/569 bp, MN396364.1 for ITS; 565/569 bp, MN433299.1 for ACT; 262/263 bp, MN433298.1 for GAPDH; 272/272 bp, MH020773 for CHS-1, respectively) (Zhong et al. 2020; Liu et al. 2020; Sun et al. 2020). A concatenated phylogenetic tree showed that all three strains were clustered within the C. spaethianum clade. The sequences of isolate JT-1 were deposited in GenBank (accession nos. PP911453, PP911607, PP911605, and PP911606 for ITS, ACT, GAPDH and CHS-1, respectively). For pathogenicity assays, 1-month-old seedings of A. chinense in plots were inoculated by spraying with a conidial suspension (1 × 105 conidia/ml) until runoff. Control plants were sprayed with sterilized water. All the inoculated plants were kept in a greenhouse at 25°C with a 12-h/12-h light/dark cycle. The experiment was conducted twice with three replications each. After 7 days, symptoms similar to those observed in the field developed on leaves of the inoculated plants, whereas the control plants remained asymptomatic C. spaethianum was specifically reisolated and identified from the symptomatic leaves, thus fulfilling Koch's postulates. Colletotrichum spaethianum has been recorded as a pathogen fungus on many medicinal plants, such as Peucedanum praeruptorum (Guo et al. 2013), Anemarrhena asphodeloides (Okorley et al. 2019), and Paris polyphylla (Zhong et al. 2020). To our knowledge, this is the first report of C. spaethianum causing anthracnose on Jiaotou in China. Effective control measures should be implemented to mitigate potential further damage to Jiaotou cultivation.

First report of Alternaria leaf spot caused by Alternaria brassicae on broccoli in North Carolina, United States.

In September 2023, broccoli (Brassica oleracea var. italica) 'Sweet Bunch' plants on an organic farm in Buncombe County, North Carolina (NC), displayed symptoms of Alternaria leaf spot. Disease affected 10 to 20% of leaf area on all (approximately 30) plants. Lesions were dark brown with chlorotic halos, irregular in shape, and ≤3 cm in diameter. Leaf samples were incubated in a humidity chamber for 24 h, and the pathogen was putatively identified as Alternaria brassicae based on conidial morphology (Rimmer et al. 2007; Supplemental Fig. 1). Leaf pieces (2 x 2 mm) spanning lesion edges were surface-disinfested (1% sodium hypochlorite solution) for 1 min, rinsed in sterile distilled water, embedded in potato dextrose agar, and incubated at 22°C with a 12-h photoperiod. A pure culture was obtained by transferring a hyphal tip onto 20% V8 juice agar and incubated as above. After 10 d, colonies consisted of concentric zones of white to brown mycelia with white, aerial mycelia. Within 7 d, conidia measuring 80 to 150 µm long with 0 to 3 longitudinal septa, 6 to 15 transverse septa, and a long beak were observed, and the isolate was putatively identified as A. brassicae (Rimmer et al. 2007). To confirm identification, DNA was extracted from mycelia and subjected to PCR using primers to amplify a portion of the internal transcribed spacer of rDNA (ITS: ITS1/ITS4) (White et al. 1990), the transcription elongation factor-1 (tef1: EF1-728F/EF1-986R) (Carbone and Kohn 1999), and the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH: gpd1/gpd2) (Berbee et al. 1999). Amplicons were sequenced at Eton Bioscience (Durham, NC) and subjected to BLAST analysis in NCBI GenBank. Sequences matched (99.5 to 100% identity) A. brassicae CBS 116528 accessions KC584185 (ITS), KC584641 (tef1), and KC584102 (GAPDH) (Woudenberg et al. 2013). All sequences were deposited in NCBI GenBank (accessions PP584506, PP584507, PP584508). To confirm pathogenicity on broccoli and kale (B. oleracea var. sabellica), 5-week-old plants of broccoli 'Sweet Bunch', 'Eastern Crown', and 'Green Magic' and kale 'Winterbor', 'Darkibor', and 'Oldenbor' grown in 10-cm-diameter pots were separated by crop type and arranged in four randomized complete blocks by cultivar. Each block contained single-plant replicates of each cultivar that were either inoculated or non-inoculated. Conidia of A. brassicae obtained from 10-d-old cultures (3.5 x 103 conidia/ml) were sprayed onto each inoculated plant until run-off. Non-inoculated plants were sprayed with distilled water. Plants were incubated in a humidity chamber alternated with ambient greenhouse conditions every 48 h for 10 d, with average greenhouse temperatures ranging from 15 to 28°C. The experiment was conducted twice. Dark brown to gray lesions measuring 1 to 3 mm in diameter were observed on leaves of all inoculated plants within 5 d of inoculation (Supplemental Fig. 2), and non-inoculated plants remained healthy. On broccoli plants, lesions expanded in concentric rings, and sporulation of the pathogen was observed on leaf tissue and petioles 10 d after inoculation. Lesions remained small (< 3 mm) on kale plants, and sporulation was not observed. Alternaria brassicae was re-isolated from leaf tissue of all inoculated cultivars using methods described above. Pathogen identity was confirmed via colony and conidial morphology. The larger impact of A. brassicae on brassicas is unknown, but finding this less common Alternaria species in the eastern United States could have implications for host resistance development and fungicide efficacy (Nieto-Lopez et al. 2023).

First Report of Alternaria alternata Causing Alternaria Leaf Spot of Black Nightshade in China.

Black nightshade (Solanum nigrum L.) belongs to Solanaceae family, which is distributed all over China and has become one of the malignant weeds in cotton field in Xinjiang (Zhang et al., 2020; Zhang et al., 2021). During July 2016 to August 2023, leaf spot was observed on black nightshade in Hami and Shihezi city, Xinjiang, China. The spots appeared as brown circular or irregular, with some small black dots surrounded with yellow halos. Twenty five black nightshade plants were collected from a cotton field (100 m2) for pathogen isolation in Shihezi, July 2023. Leaf samples (2×2 mm) from the boundary between diseased tissue and healthy tissue, sterilized in 70% ethanol for 45 s, dipped in 2% NaClO for 30 s, rinsed three times with sterile distilled water, placed on potato dextrose agar (PDA) after dried and cultivated at 25°C in the dark for 4 days. Twenty-five fungal isolates were obtained and purified by using the single-spore isolation method, and all isolates were found to be similar in morphology, appeared as dark brown and produced dark brown pigmentation on PDA. Conidiophores were black brown, 8 to 58 × 10 to 20 μm, with 1 to 5 transverse septa and 0 to 3 longitudinal septa, the results similar to those of Alternaria alternata isolated from buckwheat (Li et al., 2021). To confirm this identification, total genomic DNA of the isolates were extracted by CTAB method (Doyle et al., 1987). The internal transcribed spacer (rDNA-ITS), Alternaria major allergen gene (Alt α1) and glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) of the A. alternata 26 were amplified using the primers ITS1/ITS4 (Glass et al., 1995), Altα1-F/Altα1-R (Li et al., 2024) and gpd-F/gpd-R (5'-CAACGGCTTCGGTCGCAT- TG-3' / 5'-GCCAAGCAGTTGGTTGTG-3'), respectively. The rDNA-ITS, Altα1 and GAPDH gene sequences were deposited in GenBank (KX904867, PP263361, PP263360), and showed 100% identity (rDNA-ITS: 572 out of 609 bp; Alt α1: 514 out of 516 bp; GAPDH: 619 out of 619 bp) to A. alternata (KU179665; MW522975; MK451977), respectively. The multi-gene phylogenetic tree showed that the representative isolate was grouped with A. alternata and identified as A. alternata. Black nightshade was used for pathogenicity assay. Fifteen plants at 3 to 4-leaf stage were selected and sprayed with the conidial suspension (1.0×106 spores/mL) of A. alternata 26 after wound the underside of leaves (2 mm length) with inoculating needle. Five plants were sprayed with sterilized water as control. After inoculation, placed the plants in a plastic box and covered with plastic wrap to keep 80% relative humidity for 3 days at 25℃ in the greenhouse, then removed the plastic box. Symptoms of leaf spots appeared within 12 - 15 days that were similar to the symptoms observed in the field, and the fungal pathogen that was re-isolated from symptomatic leaves was identical to original pathogen on the basis of morphological and molecular analysis to fulfill Koch's postulates. This experiment was repeated three times, and the disease incidence was above 80% after inoculation at each time. To our knowledge, this is the first report of A. alternata causing leaf spot of black nightshade in China. This report will help us to monitoring distribution of the disease and providing theoretical basis for disease prevention and control.

First Report of Leaf Blight on Paris polyphylla Caused by Ceratobasidium ramicola in China.

Paris polyphylla var. yunnanensisis a perennial herb with significant medicinal properties in anticancer, anti-inflammatory, antibacterial immunomodulatory and antispasmodic activities (Duan et al. 2018). In April 2022, leaf blight disease emerged in Xiangtan City (Hunan), affecting P. polyphylla plantings over an area of 3×104 m2 (27.904°N, 112.918°E). The disease incidence reached an average of 22% of the plants in the field, with infected plants initially displaying water-soaked chlorosis, followed by dry yellow shrinkage that gradually spread from the leaf tips to the entire plant. To identify the causal agent, 20 leaf lesions (4 mm2) collected from 20 plants were surface sterilized with 75% ethanol for 10 s, 5% NaOCl for 30 s, rinsed in sterile distilled water three times, transferred to potato dextrose agar (PDA) plates with lactic acid (0.125%) , and incubated at 28 °C in the dark. Four isolates (PP21 to PP24) with similar morphologies were obtained and purified by the hyphal-tip method. Colonies on PDA initially appeared white with cottony mycelium, later turning light-yellow on the underside. Septate hyphae were branched at right angles with a small constriction at the departure of the branch point and measured 4.16 to 7.93 µm in diameter. Binucleate cells within the septate hyphae were visualized using Giemsa staining (Servicebio, China). For molecular identification, the rDNA internal transcribed spacer (ITS), the second largest subunit of nuclear DNA-directed RNA polymerase II (RPB2), and ATP synthase subunit 6 (ATP6) were amplified from genomic DNA of the isolates extracted by Fungus Genomic DNA Extraction Kit (Bioflux, China) using primers ITS1/ITS4 (White et al. 1990), bRPB2-6F/bRPB2-7.1R (Matheny 2005; Reeb et al. 2004) and ATP61/ATP62 (Kretzer and Bruns 1999), respectively. The ITS, RBP2 and ATP6 of the four isolates were sequenced and deposited in GenBank. BLASTn search of sequenced ITS (PQ187050, PQ187051, PP728052, PQ187052), RBP2 (PQ202833, PQ202834, PP735921, PQ202835) and ATP6 (PQ202837, PQ202838, PP735922, PQ202839) revealed a >99% identity with the type strain of Ceratobasidium ramicola CBS133.82 (NR138368, DQ301708, and DQ301577). For phylogenetic analysis, concatenated sequences of ITS, RBP2, and ATP6 were employed using the maximum-likelihood method in MEGA-X. Based on the morphological and molecular analyses, the isolates were classified into the C. ramicola clade (Bandoni 1979; Samuels et al. 2012; Jeong et al. 2023). To test the pathogenicity of the isolate PP23, mycelial plugs (5 mm in diameter) were placed directly on 15 healthy leaves from 15 three-year-old plants after puncturing with sterile needles. Sterile PDA plugs served as controls. All plants were kept in a greenhouse with conditions of 25°C, 80% relative humidity and a photoperiod of 12 h. After 5 days, all infected plants developed leaf blight symptoms similar to those described above, whereas the control plants remained asymptomatic. The pathogenicity test was conducted three times. C. ramicolawas re-isolated from all symptomatic leaves and confirmed to be identical to the original isolate based on morphology and nucleotide sequences of ITS, RBP2, and ATP6. While C. ramicola is commonly reported to be isolated from diseased cacao, its pathogenicity to cacao remains unknown (Samuels et al. 2012). To our knowledge, this is the first report of C. ramicola causing leaf blight on P. polyphylla, a medicinal herb with significant economic importance in China.

First Report of Aspergillus tubingensis Causing Leaf Spot on Pogostemon cablin in China

Patchouli (Pogostemon cablin (Blanco) Benth) is an important medicinal and aromatic plant widely cultivated in China, India, and other Southeast Asian countries. It is renowned for its diverse applications in traditional medicine and its detoxification, antibacterial, anti-inflammatory, and other pharmacological properties (Wu et al. 2016; Fang et al. 2022). In May 2023, a severe leaf spot disease was observed on Pogostemon cablin plants grown in most plantations in Yulin, Guangxi, China (22°26′N; 109°83′E), with over 50% incidence rate. Symptoms began as small, circular, brown spots on leaves, enlarging with yellow halos. Lesions expanded into irregular shapes with necrotic centers. Advanced stages showed extensive yellowing, browning, and leaf senescence. A total of 20 symptomatic plants were sampled from 5 different locations within the detected area, with 4 plants sampled per location. To isolate the pathogen, 20 affected leaves were collected from these plants and preliminarily washed with sterile distilled water (SDW). Five small tissue pieces (5×5 mm) were excised from the lesion edge of each leaf, surface-disinfected with 75% ethanol and 1% NaClO, rinsed thrice with SDW, and placed on potato dextrose agar (PDA) at 28 °C in darkness for 7 days. Out of these, 18 plants (90%) yield fungal isolate with recurrent and similar morphological characteristics. Four representative isolates (X5-1-1, X5-1-3, X5-1-5, and X5-1-7) were selected for further analysis. On PDA, colonies were initially white, gradually turning black on the surface, with light yellow on the reverse side of the plate. Conidia were brown to black, globose, rough-walled, and 2.6 to 5.2 µm in diameter. Conidial heads were brown-black, and conidiophores were smooth and hyaline. Morphological characteristics matched those of Aspergillus sp. (Guo et al. 2017). For molecular identification, the internal transcribed spacer (ITS) region and the β-tubulin (TUB) gene of all four isolates were sequenced (Lim et al. 2019). All four isolates (X5-1-1, X5-1-3, X5-1-5, and X5-1-7) showed consistent morphological characteristics and 100% identical ITS and TUB sequences. Representative sequences from isolate X5-1-5 were submitted to GenBank (ITS: PP789632; TUB: PP798205). The obtained ITS and TUB sequences showed 99% similarity to Aspergillus tubingensis (ITS: OP737633; TUB: MG991377). Based on morphological and molecular analyses, the fungus was identified as A. tubingensis (Palmer et al. 2019). For pathogenicity tests, a spore suspension (1 × 10^6 conidia/mL) was prepared from 7-day-old cultures of A. tubingensis grown on PDA. The suspension was sprayed onto leaves of 10 healthy Pogostemon cablin plants until runoff. Control plants were sprayed with SDW. All plants were kept in a controlled greenhouse (12/12h light/dark, 25 ± 2 °C, 90% humidity). After 7 d, symptoms identical to those observed in the field developed on all pathogen inoculated plants, while control plants remained asymptomatic. The fungus was successfully re-isolated from infected leaves in three successive trials, fulfilling Koch's postulates. Notably, A. tubingensis has previously been reported causing field diseases on strawberry in California, Jatropha curcas and Helleborus species in China (Palmer et al. 2019; Guo et al. 2017, Liaquat et al. 2019), and vine canker on table grape in Italy (Vitale et al. 2012). To our knowledge, this is the first report of A. tubingensis causing leaf spot on Pogostemon cablin in China. This finding provides a foundation for further investigate into the biology, epidemiology, and management of this disease.

First Report of Fire Blight Caused by Erwinia amylovora on Pear in Saudi Arabia.

In the spring of 2020 and 2021, pear trees (Pyrus communis cv. Williams) in orchards (27°46'36.0"N 42°29'44.7"E, 30°00'00.2"N 40°15'11.8"E, and 28°44'52.9"N 36°18'47.8" E) in Hail, Al Jouf, and Tabuk regions exhibited fire blight symptoms. After removing bark, the affected trees showed shoot blight, brown-blighted shoot tips and blossom blight, dead flowers on the stems, and reddish-colored cankers. The disease incidence varied from 10% to 25%. Pathogen was isolated from 21 symptomatic samples including fruits, flowers, and shoots. Bacteria were isolated from washed tissues on King's B (KB) and semi-selective CCT media (Ishimaru and Klos, 1984). After 48 hours, colonies resembling Erwinia amylovora on KB media were 1.5-2 mm in diameter, white, circular, slightly convex, with a smooth surface, and exhibited no fluorescence under ultraviolet light. Colonies on CCT after 72 h were 3-4 mm in diameter, mucoid with shiny surfaces, semitransparent, speckled with craters, and slightly violet. All isolates were purified by subculturing on KB. All isolates were Gram-negative and rod-shaped, fermentative of glucose, positive for catalase and negative for oxidase, and potato rot. They induced a hypersensitive reaction when infiltrated in tobacco leaves (cv. Xanthi). Based on morphology and biochemical tests (EPPO, 2004), the strains were identified as Erwinia sp. Twenty-six strains from Saudi Arabia (SA) and the reference strain (NCPPB 683T) hydrolyzed gelatin and formed white, highly mucous colonies on the levan medium. These strains could not reduce nitrate to nitrite and tested negative for urease and indole production. All the isolates and the reference strain were confirmed to be E. amylovora based on a PCR 0.9-kb DNA fragment amplification with a species-specific primer set, A/B targets pEA29 (Bereswill et al. 1992). 16S-rDNA fragments from Saudi isolates were amplified with 27F and 1492R primers (Lane, 1991). Purified amplicons from PCR were sequenced (OR717505 and OR743536-OR743560), and a BLAST search of the GenBank database revealed 100% (927/927) homology with E. amylovora strain CP066796.1. The housekeeping gene rpoB was PCR amplified with primers CM7-F and CM31b-R (Rezzonico et al. 2012), and the products were sequenced (PP465516-PP465541). BLAST analysis showed 100% (944/944 nt) and 96.19% (908/944 nt) identities with the sequences of E. amylovora ATCC 15580 CP066796.1 and E. pyrifoliae CP201486 CP103445.1, respectively. To fulfill Koch's postulates, SA strains were inoculated on five healthy 3-month-old clones of apple (Malus domestica cv. Gala) per strain with a 10-μl bacterial suspension containing 107 colony-forming units per milliliter by injecting directly in the veins of the upper second leaf plus 5 healthy plants injected with sterile distilled water as control. Plants were incubated at 28°C for six days under a 12-hour light regime. Observed symptoms were similar to the ones observed in the field. The experiment was replicated twice. Bacterial colonies on CCT media were re-isolated from the inoculated apple rootstocks and confirmed by the A/B primer set. To our knowledge, this is the first peer-reviewed report of E. amylovora in SA since the fire blight-like symptoms were observed in SA in 2013 (Alhudaib, 2013). Further research will identify new host plants for the fire blight pathogen within SA which is important due to the importation of pome fruit seedlings (quince, apple, and pear) from neighboring Jordan where E. aylovora was reported (Tehabsim et al. 1992).

First Report of Fusarium falciforme Causing Fusarium Wilt on pepper in Hainan, China.

Pepper (Capsicum annuum L.) is a significant vegetable crop, valued for its nutritional and economic importance (Pang et al. 2023). Pepper cultivation in China accounts for about 8-10% of the total vegetable planting area, contributing an output value of approximately 250 billion yuan. This makes pepper the leading vegetable in terms of both planting area and economic value. In December 2023, a total of 70% disease incidence of Fusarium wilt was observed in a 1200 m² pepper seed breeding base in Sanya City, Hainan Province, China (18°38'60″ N, 109°16'51″ E). Symptoms initially appeared as wilting on upper leaves. Subsequently, the base of the stem started to necrosis, browning, and gradually spreading upward along the stem. As the lesions expanded, the whole plant gradually wilted and died. Ten diseased plants were randomly selected from the most severely affected area (667 m²). Diseased tissues (5 mm²) were subsequently removed from the lesion edges of these plants, surface sterilized in 75% ethanol for 30 s, and rinsed with sterile distilled water three times, finally cultured on potato dextrose agar (PDA) at 25 °C. Six fungal isolates were obtained using the single-spore isolation method (HN-01 to HN-06). Colonies produced white aerial mycelia with apricot pigments in the PDA medium. The spore morphology and size were observed and measured using synthetic nutrient-poor agar (SNA) medium. Macroconidia were hyaline, slightly curved in shape with 3 or 4 septa, measuring 28.6 to 41.4 × 3.2 to 6.2 μm (av. = 34.8 ± 3.32 × 4.6 ± 0.85 um, n = 20). Microconidia were elongated, oval with 0 or 1 septum, and measured 11.2 to 16.8 × 2.6 to 5.8 μm (av. = 13.5 ± 1.47 × 4.12 ± 1.03 um, n = 20). Chlamydospores were spherical, terminal or intercalary, solitary or chain-forming, with diameters ranging from 2.8 to 10.5 um (av. = 5.8 ± 2.31 um, n = 20). For molecular identification, genomic DNA from all six isolates was extracted using the cetyl trimethyl ammonium bromide (CTAB) method, and the internal transcribed spacer of rDNA (ITS), translation elongation factor 1-α (EF1-α), and RNA polymerase II beta subunit (RPB2) regions were amplified and sequenced using the primers ITS1/ITS4, EF-1/EF-2, and RPB2-5F/7cR (White et al. 1990; O'Donnell et al. 2010). The sequences were deposited in GenBank (ITS: PP779839, PP779840, PP779841, PP779842, PP779843, PP779844; EF1-α: PP797138, PP797139, PP797140, PP797141, PP797142, PP797143; RPB2: PP797144, PP797145, PP797146, PP797147, PP797148, PP797149). The sequences of all three genes showed 99 to 100% similarity with Fusarium falciforme and other closely related Fusarium species (ITS: PP735125, EF1-α: OP163897 and RPB2: MF467484). A maximum likelihood phylogenetic tree was constructed based on the ITS, EF1-α, and RPB2 sequences of all isolates, along with other closely related Fusarium species. Based on morphological and phylogenetic characteristics, all isolates were identified as F. falciforme (Xu et al. 2023; Wang et al. 2023). Ten Pepper inbred line A23-41 (5 for the inoculation treatment and 5 for the control) were tested for pathogenicity using three representative isolates: HN-01, HN-02, and HN-03. A total of 20 ul of spore suspension with concentration 106 spores/ml was injected near the soil surface of the stem, while the control treatment was inoculated with 20 μl of sterile water. The plants were placed in a climatic chamber at RH80-90% and 25/20 °C (day/night) after inoculation. The experiment was repeated three times. After 10 days, Inoculated plants stem developed necrosis, browning, while the control group remained asymptomatic. The fungus reisolated from the artificially infected stems was identified through EF1-α and RPB2 sequence analysis as F. falciforme, thus fulfilling Koch's postulates. Fusarium falciforme has been previoulsy reported as causing various diseases on different hosts in several countries, including Korea (Kang et al., 2024), Malaysia (Balasubramaniam et al., 2023), and Mexico (Payán-Arzapalo et al., 2024). To the best of our knowledge, this is the initial report demonstrating that F. falciforme causes Fusarium wilt on peppers in China. The study results can provide the basis for future research on the occurrence, prevention, and management of this disease.

First report of basal stem rot on sugarcane (var. Badila) caused by Sclerotium rolfsii in China.

Badila (Saccharum officinarum) is one of the important chewing cane in south China. During the year 2019-2020, as much as 60.2%-87.5% of sugarcane plants stem showed red rot developments were observed in the fields of Yongning District, Nanning city, Guangxi province. Symptomatic plants showed red rot at basal stem nodes and sheath, when the disease serious, the epidermis and aerial roots decomposed and exfoliated, then formed sclerotiums, the upper stem also occurred the symptom. Infected plant tissues were dissected into small pieces with 0.1 × 0.1cm in size and surface sterilized in 0.1% HCl2 for 2 min, followed by 75% ethanol for 30 s, rinsed three times with sterile distilled water. Then the tissues were placed onto potato dextrose agar (PDA) plates and incubated at 25 °C for 3 days. Numerous white globoid sclerotia were formed on PDA after 5 days of growth. The sclerotia (2 to 3 mm in diameter) were white at first and then gradually turned dark brown. Aerial mycelia usually formed many narrow hyphal strands 4 to 9 μm wide. Five uniform isolates were obtained from diseased sugarcane plants. Pathogenicity of representative strain W1 was confirmed by inoculating 120-day-old Badila plants grown in field. Five plants were inoculated with colonized agar discs (6mm in diameter) by applying toothpick tips to the lower part of the stem. Five non-inoculated plants served as control. The inoculated and non-inoculated plants were sprayed sterile water then incubated with plastic film for maintained high moisture. All the plants were placed inside of a growth chamber at 26 ± 2°C with a 14-h photoperiod and 80% relative humidity. All inoculated plants showed red rot at stem and sheath after 2 weeks, whereas the control plants were symptomless. By the third week, mycelium and sclerotia developed on the crown on the inoculated plants. The fungus was re-isolated from the artificially inoculated plants. To confirm the species-level identification, partial of the ribosomal DNA internal transcribed spacer (ITS), mitocondrial small subunit (SSU), and nuclear ribosomal large subunit (LSU) regions of representative strain W1 were amplified and sequenced using the primers pairs ITS1/ITS4 (White et al. 1990), ITS-Fu-F /ITS-Fu-R and SRLSU1//SRLSU2 (Kumar et al., 2016), respectively. The resulting ITS, SSU and LSU sequences were deposited in GenBank (GenBank accession no. MW620994, MW617878, and MW617872) and shared 99.42%, 100% and 100% sequence identity with Athelia rolfsii isolate (JN017199, OM319631, and MT225781). Phylogenetic analysis conducted with neighbor-joining (NJ) method using MEGA6.0 revealed that the isolate share a common clade with reference sequence of A. rolfsii in GenBank Data Library. Based on morphological and molecular characteristics, the fungus was identified as A. rolfsii (anamorph: Sclerotium rolfsii) (Paul et al. 2017; Paparu et al. 2020). Although S. rolfsii has been reported causing sugarcane sett rot in Australia (Bhuiyan et al., 2019) and seedlings of sugarcane in Indian (Gopi et al., 2023), as we know, this is the first report of sugarcane basal stem rot disease caused by this fungus in China. This study will be helpful for the prevention and control sugarcane basal stem rot in the future.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

First Report of Colletotrichum siamense Causing Leaf Anthracnose on Jackfruit in Thailand.

Jackfruit (Artocarpus heterophyllus Lam.) is commonly grown in Thailand. In June 2023, leaf anthracnose on this plant was observed at a field in Chai Prakan District (19°42'24"N, 99°01'59"E), Chiang Mai Province, Thailand, with ~25% disease incidence in a 1000-m2 plantation area. The initial symptom had brown spots with a yellow halo, enlarged, elongated, 0.2 to 2 cm in diameter, irregular, sunken, brown, with a dark brown halo, and leaves withered and dried. Pale yellow conidiomata developed on the lesions in high humidity. Ten symptomatic leaves were used to isolate the fungal causal agents through a single spore isolation method (Tovar-Pedraza et al. 2020). Four fungal isolates (SDBR-CMU492 to SDBR-CMU495) with similar morphology were obtained. Colonies on potato dextrose agar (PDA) were 70 to 85 mm in diameter, white to grayish white with cottony mycelia, the reverse pale yellow after incubation at 25°C for 1 week. All isolates produced asexual structures. Setae were brown with 1 to 3 septa, 40 to 100 × 2.2 to 4.0 µm, a cylindrical base, and acuminate tip. Conidiophores were hyaline to pale brown, septate, and branched. Conidiogenous cells were hyaline to pale brown, cylindrical to ampulliform, 7.4 to 27.2 × 2.0 to 4.5 µm. Conidia were one celled, hyaline, smooth walled, cylindrical, ends rounded, guttulate, 11.1 to 15.7 × 3.4 to 6.1 µm. Appressoria were dark brown to black, oval to irregular, 8.8 to 24.9 × 3.6 to 10 µm. Morphologically, all isolates resembled the Colletotrichum gloeosporioides species complex (Weir et al. 2012). The internal transcribed spacer (ITS) region, actin (act), β-tubulin (tub2), calmodulin (CAL), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified using primer pairs ITS5/ITS4, ACT-512F/ACT-783R, T1/T22, CL1C/CL2C, and GDF1/GDR1, respectively (White et al. 1990; Weir et al. 2012). Sequences were deposited in GenBank (ITS: PP068858, PP068859, PP446789, PP446790; act: PP079636, PP079637, PP460760, PP460761; tub2: PP079638, PP079639, PP460762, PP460763; CAL: PP079634, PP079635, PP460758, PP460759; GAPDH: PP079632, PP079633, PP460756, PP460757). Maximum likelihood phylogenetic analyses of the concatenated five genes identified all isolates as C. siamense. To pathogenicity test, the mature leaves of a healthy plant were surface disinfested using 0.1% NaClO for 3 min, rinsed three times with sterile water, and wounded. Conidia suspensions (15 µl of 1 × 106 conidia/ml) of each isolate grown on PDA at 25°C for 2 weeks were used to inoculate wounded and unwounded samples by the attached method. Control leaves were mock inoculated with sterile distilled water. Ten replications were conducted for each treatment and repeated twice. Plants were placed in a greenhouse at 25 to 30°C and 80 to 90% relative humidity. After 7 days, all inoculated leaves displayed brown lesions, while control leaves had no symptoms. Colletotrichum siamense was reisolated from inoculated tissues on PDA to complete Koch's postulates. Prior to this study, C. fructicola and C. gloeosporioides caused leaf anthracnose on jackfruit worldwide (Sangchote et al. 2003; Chitambar 2016). Leaf anthracnose on jackfruit caused by C. siamense has been reported from Australia (James et al. 2014) and Bazil (Borges et al. 2023). In Thailand, Bhunjun et al. (2019) reported that C. artocarpicola causes leaf anthracnose in jackfruit. Therefore, this is first report of C. siamense causing leaf anthracnose on jackfruit in Thailand. The finding will inform epidemiological investigations and future approaches to managing this disease.