Stem Pitting Research Articles

Applying infectious clones and untargeted metabolite profiling to characterize citrus tristeza virus-induced stem pitting in citrus

Applying infectious clones and untargeted metabolite profiling to characterize citrus tristeza virus-induced stem pitting in citrus

Assessing the de novo assemblers: a metaviromic study of apple and first report of citrus concave gum-associated virus, apple rubbery wood virus 1 and 2 infecting apple in India

BackgroundThe choice of de novo assembler for high-throughput sequencing (HTS) data remains a pivotal factor in the HTS-based discovery of viral pathogens. This study assessed de novo assemblers, namely Trinity, SPAdes, and MEGAHIT for HTS datasets generated on the Illumina platform from 23 apple samples, representing 15 exotic and indigenous apple varieties and a rootstock. The assemblers were compared based on assembly quality metrics, including the largest contig, total assembly length, genome coverage, and N50.ResultsMEGAHIT was most efficient assembler according to the metrics evaluated in this study. By using multiple assemblers, near-complete genome sequences of citrus concave gum-associated virus (CCGaV), apple rubbery wood virus 1 (ARWV-1), ARWV-2, apple necrotic mosaic virus (ApNMV), apple mosaic virus, apple stem pitting virus, apple stem grooving virus, apple chlorotic leaf spot virus, apple hammerhead viroid and apple scar skin viroid were reconstructed. These viruses were further confirmed through Sanger sequencing in different apple cultivars. Among them, CCGaV, ARWV-1 and ARWV-2 were recorded from apples in India for the first time. The analysis of virus richness revealed that ApNMV was dominant, followed by ARWV-1 and CCGaV. Moreover, MEGAHIT identified novel single-nucleotide variants.ConclusionsOur analyses highlight the crucial role of assembly methods in reconstructing near-complete apple virus genomes from the Illumina reads. This study emphasizes the significance of employing multiple assemblers for de novo virus genome assembly in vegetatively propagated perennial fruit crops.

First Report of Citrus Leaf Blotch Virus on Nagami Kumquat in Turkey.

Kumquat, known as the smallest of citrus fruits, has seen an increase in the number of commercial orchards in recent years. In May of 2022, a PCR-based survey for citrus virus diseases was conducted in commercial Nagami kumquat (Fortunella margarita (Lour.) Swingle) orchards in the Cukurova region of Turkey. During the survey, five trees with bud union disorder symptoms were found in two different kumquat orchards in the Erdemli district of Mersin province. Young leaf samples from the five trees showing bud union disorder symptoms and two symptomless trees were collected from 6-year-old kumquat. Common citrus viruses and viroids, such as citrus psorosis virus, citrus exocortis viroid, and hop stunt viroid, were not detected in PCR tests performed on all collected samples. The samples were also tested for citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), a virus associated with a bud union crease in kumquat (Vives et al.2001). Total RNA was isolated from collected leaf samples using the RNeasy Plant Mini Kit (Qiagen, USA). In the RT-PCR assay, two separate specific primer pairs were used to determine the presence of CLBV. The coat protein gene (CP), was amplified with primers KU-18 (5'-TTAAGATTACAGACACGAAGG- 3') and KU-19 (5' CTGTTTTTGAATTTTGCTCG-3'), and the RNA-dependent RNA polymerase gene (RdRp) was amplified with KU-27(5'-GATGCAAGCCAGGATGAATAC-3') and KU-15 (5'-CAGACACTCCAAGACCTTTCC-3') primers (Vives et al. 2002). All of symptomatic samples yielded amplicons of the expected size (456-bp RdRp and 438-bp CP). No amplicons were obtained from symptomless samples. Two PCR products were sequenced to confirm their identity by direct sequencing (GenBank accession no: OQ718432, OQ718433, PP726107, PP726108). Consensus sequences of these two genes showed 96% and 97% nt identity with CP and RdRP genes of the CLBV sequence in GenBank (MT038390, EU857539), respectively. For biological indexing, four RT-PCR-positive samples were used as inoculum sources. Four of Etrog citron (C. medica) and four of Dweet tangor (C. tangerina) seedlings were graft-inoculated for each source, and two seedlings for each cultivar were used as a negative control. Two months later, chlorotic blotching symptoms were observed on Dweet tangor leaves. Six months later, Etrog citron exhibited stem pitting symptoms. None of the negative control seedlings developed any symptoms. RT-PCR was performed to confirm the presence of CLBV in the virus-inoculated seedlings, and amplicons of the expected sizes (456-bp RdRp and 438-bp CP) were obtained. To the best of our knowledge, this is the first report of the CLBV infection in citrus in Turkey. CLBV is thought to have originated from infected grafting material in the country, although it is not known where it may have originated. Further research is needed to determine the distribution of CLBV and its potential to impact commercial citrus production in Turkey.

Apple chlorotic leaf spot virus infection affects the physiology and biochemistry of leaves and the quality of fruits of Tuscany (Italy) autochthonous apple varieties

AbstractThe present study focused on three autochthonous varieties of apple trees belonging to the old Tuscany germplasm (central Italy), Chitignano, Mora and Ruggine, and aimed to (a) evaluate the presence of the four main latent viruses of apple trees (apple chlorotic leaf spot virus [ACLSV], apple mosaic virus [ApMV], apple stem grooving virus [ASGV] and apple stem pitting virus [ASPV]) and (b) elucidate the biochemical and physiological responses of apple leaves and fruits challenged by ACLSV (the only virus detected). Indeed, despite no visible symptoms being reported, more than half of the assayed trees tested positive for ACLSV, although it occurred only in Mora and Ruggine. ACLSV impaired the photosynthetic performance of apple trees, especially in Ruggine leaves, but variety‐specific responses in terms of reorganization of photosynthetic pigment and primary metabolites were reported. Mora showed a higher ability to trigger the de‐epoxidation state of xanthophylls and to accumulate α‐tocopherol, while d‐glucose and sucrose increased only in infected Ruggine leaves, probably as a signalling response and/or an osmotic adjustment of this variety under ACLSV infection. Unexpectedly, ACLSV infection slightly increased pome size, but it dramatically reduced their quality (i.e., soluble solids content), again especially in Ruggine, the only variety where reductions of d‐fructose, d‐glucose and malic acid contents were reported. Overall, the evidence here reported could offer valuable insights to effectively cope with the detrimental viral diseases affecting this species and to protect the production of one of the most consumed and appreciated fruits in the world.

Vitrification cryo-foil method for shoot tip cryopreservation and virus eradication in apple

Establishment of a new method for improved shoot tip cryopreservation is crucial to facilitate the long-term preservation of plant germplasm as well as the use of cryotherapy for pathogen eradication. The present study reported a vitrification (V) cryo-foil method for shoot tip cryopreservation and virus eradication in apple. Shoot tip regrowth levels after cryopreservation were comparable among V cryo-foil (53 %), V cryo-plate (46 %) and conventional droplet vitrification (Dr-vi, 48 %). The V cryo-foil is more efficient to perform than Dr-vi as more shoot tips can be cryopreserved by one person. In the histological study applying an image-overlaying strategy, shoot tips cryopreserved by V cryo-foil showed a higher survival chance in the youngest leaf primordia than in the apical dome. When V cryo-foil was tested for virus eradication, fifty-five percent (55 %) of cryo-derived shoots were free of the apple stem pitting virus (ASPV), while none and less than 10 % were free of the apple stem grooving virus (ASGV) and the apple chlorotic leaf spot virus (ACLSV), respectively. Thus, these two viruses were efficiently preserved by V cryo-foil cryopreservation. Noticeably, although the shoot regrowth level was reduced to 27 %, a higher frequency (81 %) of ASPV eradication was achieved when a reduced duration of cryoprotectant exposure was applied in V cryo-foil, supporting the use of insufficient cryoprotection for improved virus eradication.

Citrus tristeza virus: A century‐long challenge for the world's citrus industries

AbstractCitrus tristeza virus (CTV) is a causal agent of diseases that have challenged the global citrus production for more than a century. The disease named ‘tristeza’, which means ‘sadness’ in Portuguese and Spanish, has spread by aphids and vegetative propagation, resulting in costly pandemics that reshaped the world citrus production by forcing the adaption of disease‐tolerant rootstocks. Furthermore, management of the second major CTV‐induced disease, stem pitting, became a unique example of the use of cross‐protection on a large nationwide scale, allowing many citrus growing regions to control the disease that could not be managed through horticultural practices. The information gathered in this review commemorates a hundred years of research on the virus and the respective diseases, which began with classical horticultural approaches and advanced toward the cutting‐edge molecular biology studies. In this regard, it is proper to mention that CTV research greatly benefited from close international collaboration between research institutions and scientists from the affected and nonaffected citrus areas. Moreover, despite the considerable initial losses caused by tristeza, the world's fresh fruit and juice concentrate citrus industries reemerged as highly productive following the research advancements, a situation that changed throughout Florida and Brazil in the past two decades or so with the outbreak of the devastating citrus greening (Huanglongbing) bacterial disease. This review encompasses past and recent advances in the CTV research positioning the citrus‐CTV pathosystem as a pivotal model system for investigating virus interactions with perennial woody hosts. The review will also serve as an updated version of the respective section on CTV in the Description of Plant Viruses that the Association of Applied Biologists manages. We dedicated this review to the 85th Birthday celebration of Prof. Moshe Bar‐Joseph, a world‐renowned plant pathologist whose half‐a‐century‐long career devoted to citrus diseases yielded many important, pioneering discoveries on CTV and other closteroviruses. Many of those are highlighted in this review. Prof. Bar‐Joseph retired from the Volcani Center, Agricultural Research Organization in Israel several years ago, yet he continues to be actively engaged in research and provides his expertise to citrus pathologists around the world in the present days.

Serological and Molecular Detection of Citrus Tristeza Virus: A Review.

Citrus tristeza virus (CTV) is a globally pervasive and economically significant virus that negatively impacts citrus trees, leading to substantial reductions in fruit yield. CTV occurs within the phloem of infected plants, causing a range of disease phenotypes, such as stem pitting (SP), quick decline (QD), and other detrimental diseases. Research on CTV is challenging due to the large size of its RNA genome and the diversity of CTV populations. Comparative genomic analyses have uncovered genetic diversity in multiple regions of CTV isolates' genomes, facilitating the classification of the virus into distinct genotypes. Despite these challenges, notable advancements have been made in identifying and controlling CTV strains through serological and molecular methods. The following review concentrates on the techniques of nucleic acid identification and serological analysis for various CTV isolates, assisting in the comparison and evaluation of various detection methods, which are crucial for the effective management of CTV diseases, and so contributes to the innovation and development of CTV detection methods.

First report of apple hammerhead viroid infecting apple trees in Montenegro.

Apple hammerhead viroid (AHVd, Pelamoviroid, Avsunviroidae) is one of the five viroids infecting apples. It has been identified on all continents except Australia since its viroid nature was confirmed (DiSerio et al. 2018; CABI and EPPO 2022). AHVd has been found in apple trees showing leaf mosaic, ringspot and dieback (Hamdi et al., 2021). Apple (Malus domestica Borkh.) and its wild relatives are traditionally grown in Montenegro. With an annual production of 7767 tons on 216 ha, it is the second most important fruit tree (after plum) in the country (Anonymous 2022). In a 2020-2022 survey, 29 apple trees exhibiting virus-like symptoms (e.g. mosaic, necrosis) were sampled throughout Montenegro, including 16 locations in eight municipalities (Podgorica, Danilovgrad, Niksic, Mojkovac, Bijelo Polje, Berane, Pljevlja and Savnik). Small RNAs were isolated using the mirVana miRNA Isolation Kit (Ambion, Life Technologies) and pooled into three bulk samples. Each bulk contained 9 to 10 samples. Libraries of sRNAs were constructed using the Ion Total RNA-Seq Kit v2 and barcoded using the Xpress RNA-Seq Barcode 1-16 Kit (Ion Torrent) according to the manufacturer's instructions. Small RNA library sequencing was performed on Illumina platform (Novogene Europe) yielding 9.9, 9.8 and 18.6 million reads in the three libraries. The CLC Genomics Workbench software was used to demultiplex the reads into pools using the 'Demultiplex Reads' tool. The online program VirusDetect (Zheng et al. 2017) was used for virus/viroid detection and identification. Besides viruses known to infect apple (apple stem grooving virus, apple stem pitting virus, apple mosaic virus), contigs mapping to AHVd were identified in all three bulks enabling full AHVd genomes reconstruction. To verify AHVd presence, all 29 apple samples were tested by reverse transcription-polymerase chain reaction (RT-PCR) using the AHVd PG13f/PG12r primers (Messmer et al. 2017). AHVd amplicons were obtained in three samples (30/21, 32/21 and 38/21) from bulk 1 and two samples (47/21 and 55/21) from bulk 2, while all samples from bulk 3 tested negative potentially due to the low titer of the pathogen or nucleotide mismatches at the 3' end of the primers. The three amplicons from bulk 1 were Sanger sequenced and partial AHVd genomes over 200 nts were obtained from two of them (30/21 and 32/21) (GenBank acc. nos. OQ863319 and OR020603). Furthermore, three full consensus AHVd genomes were assembled in Geneious Prime by mapping Sanger sequences onto contigs from Virus Detect and named 30/21, 32/21 and 38/21 (acc. nos. PP133245, -46, and -47, respectively). All three genomes exhibited conserved hammerhead motifs (Messmer et al. 2017). In BLASTn analysis, the isolate 30/21 from Montenegro shared the highest nt identity (98.8%) with the isolate SA-36 (ON564299) from Czechia, while 32/21 and 38/21 showed the highest identities (95.4% and 92.3%) with isolates SD17_2-3 (MK188691) from Canada and JF2 (ON564298) from Czechia, respectively. To the best of our knowledge, this is the first report of AHVd infecting Malus domestica in Montenegro. The AHVd-positive samples 30/21 and 32/21 originated from at least two-decade-old apple trees from Niksic, whilst 38/21 came from a 40-year-old tree from Mojkovac district, suggesting that this viroid has long been present in different parts of the country. The AHVd discovery in Montenegro should be considered in any phytosanitary regulations and pome fruit certification program in the country.

Applying volumetric electron microscopy to visualize xylem tissue impacted by citrus tristeza virus-induced stem pitting

Applying volumetric electron microscopy to visualize xylem tissue impacted by citrus tristeza virus-induced stem pitting

Deciphering the Virome of the Pimple-Shaped ‘Yali’ Pear Fruit through High-Throughput Sequencing

Viral diseases pose a threat to fruit tree growth. In this study, we observed some pimple-shaped ‘Yali’ pears (Pyrus bretschneideri Rehd.) and investigated their viral components. We used virome analysis to elucidate the viral composition within the pimple-shaped fruit. RT-PCR was applied to detect the plant viruses of fruits, leaves, and branches in ‘Yali’ pear. We also constructed a phylogenetic tree based on the amino acid sequences of the movement proteins of 6 apple stem grooving virus (ASGV) isolates and 44 ASGVs from the NCBI database. We detected ASGV and apple stem pitting virus (ASPV) in the pimple-shaped pear fruits, which is the first report of these viruses existing in ‘Yali’ pear fruits. ASGV was present in all pimple-shaped fruit samples from six ‘Yali’ pear-producing regions. The phylogenetic tree showed that ASGVs from pears, apples, and citrus plants were separated into different branches, suggesting that hosts influence the genetic diversity of ASGV. Our study revealed the viral components and genetic variation of ASGV in pimple-shaped pear fruit, providing new insights into the epidemiology of this virus.

First Report of Three Bunya-Like Viruses, Apple Luteovirus 1, and Apple Hammerhead Viroid in Apples from Hakkari, Türkiye

Türkiye is a major apple fruit producer in the crossroads of Europe and the Middle East. Several reports have described the presence of multiple viruses affecting apple production in Türkiye, including apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), apple chlorotic leafspot virus (ACLSV), and apple mosaic virus (ApMV) (Kurçman 1977; Fidan 1994; Çağlayan et al. 2003). However, there are no reports of the presence of the recently discovered bunya-like viruses citrus concave gum-associated virus (CCGaV), and apple rubbery wood viruses 1 and 2 (ARWV1 and 2), as well as apple luteovirus 1 (ALV-1), and apple hammerhead viroid (AHVd) in Türkiye, all of which have been previously reported in other apple-producing countries (Wright et al. 2018; Liu et al. 2018; Zhang et al. 2014). Leaves from one Gala, two Granny Smith, and one Golden Delicious apple trees showing mild symptoms of curling, chlorosis, and yellowing were collected from four different orchards in the province of Hakkari, southeast Türkiye during June 2022 and sent to USDA APHIS Plant Germplasm Quarantine Program (under permit) for virus and viroid HTS-based diagnostics. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s guidelines to prepare RNAseq libraries using the TruSeq Stranded Total RNA Library Plant Kit (Illumina, Inc) as described in Malapi-Wight et al. (2021). Libraries were sequenced on the NextSeq500 sequencer (PE 2x75), and approximately 45 million reads were obtained per each sample on average. Bioinformatic analysis was performed as described in Costa et al. (2022) using Phytopipe, where unclassified pathogen-derived reads were de novo assembled and contigs were compared to the NCBI viral nucleotide and protein databases by BlastN and BlastX respectively using a 10-4 e-value cutoff. Nearly complete genome contigs were obtained for ACLSV (OR640150) and ASPV (OR640151) in all four samples and for ASGV (OR640152) in 3 of the 4 samples. The average BlastN identity to sequences in GenBank was 92.3% for ACLSV, ranging from 89-94 %. BlastN identity for ASPV was 86%, ranging from 81-92 % while the ASGV average BlastN identity was 98.2%. Nearly complete genomes with average genome coverage of 92.4% and 95.6% for RNA1 and RNA2 of CCGaV (OR640153 and OR640154), were found in two of the four samples with BlastN identity of 94.7% and 94.8% to GenBank sequences. Additionally, nearly complete genome of the large (L), medium (M), and small (S) segments for ARWV1 were found in two samples with average genome coverage of 99.9%, 99.4%, and 100% respectively and BlastN identity of 98.8%, 95.2%, and 98.4% (OR640155, OR640156, OR640157). ARWV2 contigs were also found in 1 sample where M and S segments had a coverage of 99.8% and BlastN identity of 95.4% (OR640158 and OR640159). The nearly complete genome of ALV-1 was also found in two of four samples with genome coverage of 94.1% and an average BlastN identity of 93.4% (OR640160). AHVd was found in one of the Granny Smith trees with 19,260 mapped reads to the reference GenBank MH049335.1 and identity of 98.3% (OR640149). The HTS findings of CCGaV, ARWV1, ARWV2, and ALV-1, from Türkiye were later confirmed by Sanger sequencing using custom-designed primers targeting the coat protein, the RNA-dependent RNA polymerase, or ~390bp for the AHVd genome (Supplementary Table 1). To further learn about the incidence of these agents, we tested 12 other apple samples from six different neighboring orchards and found them at 18.8% rate for CCGaV, 12.5% for both ARWV1 and ARWV2, 25% for ALV-1, and 37.5% for AHVd respectively. To our knowledge, this is the first report of the apple viruses CCGaV, ARWV1, ARWV2, and ALV-1, and the AHVd viroid in Türkiye. Further studies of the impact of these agents on orchard’s health are necessary, including their prevalence in high apple production regions of Türkiye.

РЕАЛИЗАЦИЯ ПРИОРИТЕТНЫХ НАПРАВЛЕНИЙ НАУЧНО-ТЕХНИЧЕСКОЙ ДЕЯТЕЛЬНОСТИ «ВННИИВиВ «МАГАРАЧ» РАН» В ОБЛАСТИ ВИНОГРАДАРСТВА В 2023 ГОДУ

Research is presented that contributes to an increase in the production of domestic grape and wine products, including in the system of organic farming. The object of research is grapes of native, classical and breeding varieties. The research was carried out on the basis of the Center for collective use of the Ampelographic collection «Magarach», as well as in industrial plantations of the Crimea according to generally accepted and original methods. Characteristics of 50 varieties for the database, 4 sources of valuable traits were obtained, genotyping of wild grapes was performed, 99 allele variants were identified. Optimal concentrations of substances for the development of proembryogenic calluses and cells in suspension cultures were selected. The influence of biologically active substances on the development of heart shaped and torpedo shaped embryos has been established. The obtained 6 transgenic lines of the Podarok Magaracha variety were adapted to in vivo conditions to assess their cold resistance and frost resistance. In the vegetative collection of plants in vitro, samples are maintained under conditions of active and slow growth. An aseptic culture of 14 grape varieties was obtained. The molecular diagnosis of the latent form of phytopathogens of plant material after the recovery procedures was carried out. The biovar Agrobacterium tumefaciens was identified by the method of molecular diagnostics. During molecular diagnostics, the Rupestris stem pitting virus was detected in the samples. New knowledge has been gained about the dynamics of changes in the quality indicators of grapes depending on the variety and region of cultivation against the background of a complex of agro-climatic parameters and indices used to isolate terroirs. Varietal-rootstock combinations have been identified. The formation of datasets has continued in order to train neural networks for the detection of harmful organisms and pathologies of the development of grape plants. The technology of organic viticulture production for autochthonous varieties and varieties of the Magarach Institute breeding has been tested. The technology of storing table grapes based on the use of calcium-containing preparations has been optimized. For the first time, an information technology of cross-platform integration has been developed for the implemented hardware and software complex for photo-fixation and neural network detection of the number of pests in specialized «traps».

Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted.

Many viruses occur in apple (Malus domestica (Borkh.)), but no information is available on their seed transmissibility. Here, we report that six viruses infecting apple trees, namely, apple chlorotic leaf spot virus (ACLSV), apple green crinkle-associated virus (AGCaV), apple rubbery wood virus 2 (ARWV2), apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), and citrus concave gum-associated virus (CCGaV) occur in seeds extracted from apple fruits produced by infected maternal trees. Reverse transcription polymerase chain reaction (RT-PCR) and quantitative RT-PCR (RT-qPCR) assays revealed the presence of these six viruses in untreated apple seeds with incidence rates ranging from 20% to 96%. Furthermore, ASPV was detected by RT-PCR in the flesh and peel of fruits produced by infected maternal trees, as well as from seeds extracted from apple fruits sold for fresh consumption. Finally, a large-scale seedling grow-out experiment failed to detect ACLSV, ASGV, or ASPV in over 1000 progeny derived from sodium hypochlorite surface sterilized seeds extracted from fruits produced by infected maternal trees, suggesting no detectable transmission via embryonic tissue. This is the first report on the seedborne nature of apple-infecting viruses.

Analysis of the genetic diversity in RNA-directed RNA polymerase sequences: implications for an automated RNA virus classification system.

RNA viruses are characterized by a broad host range and high levels of genetic diversity. Despite a recent expansion in the known virosphere following metagenomic sequencing, our knowledge of the species rank genetic diversity of RNA viruses, and how often they are misassigned and misclassified, is limited. We performed a clustering analysis of 7801 RNA-directed RNA polymerase (RdRp) sequences representing 1897 established RNA virus species. From this, we identified substantial genetic divergence within some virus species and inconsistency in RNA virus assignment between the GenBank database and The International Committee on Taxonomy of Viruses (ICTV). In particular, 27.57% virus species comprised multiple virus operational taxonomic units (vOTUs), including Alphainfluenzavirus influenzae, Mammarenavirus lassaense, Apple stem pitting virus, and Rotavirus A, with each having over 100 vOTUs. In addition, the distribution of average amino acid identity between vOTUs within single assigned species showed a relatively low threshold: <90% and sometimes <50%. However, when only exemplar sequences from virus species were analyzed, 1889 of the ICTV-designated RNA virus species (99.58%) were clustered into a single vOTU. Clustering of the RdRp sequences from different virus species also revealed that 17 vOTUs contained two distinct virus species. These potential misassignments were confirmed by phylogenetic analysis. A further analysis of average nucleotide identity (ANI) values ranging from 70% to 97.5% revealed that at an ANI of 82.5%, 1559 (82.18%) of the 1897 virus species could be correctly clustered into one single vOTU. However, at ANI values >82.5%, an increasing number of species were clustered into two or more vOTUs. In sum, we have identified some inconsistency and misassignment of the RNA virus species based on the analysis of RdRp sequences alone, which has important implications for the development of an automated RNA virus classification system.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Genome analysis of viruses of Phenuiviridae, Betaflexiviridae and Bromoviridae, and apple scar skin viroid in pear by high-throughput sequencing revealing host expansion of a rubodvirus and an ilarvirus

Pear (Pyrus spp.) is an important perennial fruit crop of India. During May 2022, pear leaf samples were collected from the orchard of ICAR-Indian Agricultural Research Institute, Regional Station, Dhanda, Shimla, Himachal Pradesh, India. RNA sequencing of two pooled samples, Pe1 and Pe2, was done using NovaSeq 6000. Host unaligned reads were de novo assembled into contigs and annotated through BLAST using the virus database. Near complete genome sequences of apple rubbery wood virus 1 (ARWV-1), apple necrotic mosaic virus (ApNMV), citrus virus A (CiVA), apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), apple chlorotic leaf spot virus (ACLSV), and a genetic variant of ASGV named as ASGV-Shimla, and a partial sequence of apple scar skin viroid (ASSVd) were assembled. ARWV-1 and ApNMV belong to the genus Rubodvirus and Ilarvirus having tripartite negative sense and positive sense single stranded RNA genomes, respectively, and their presence in pear trees was observed for the first time indicating the host expansion. Presence of CiVA, ASGV and ACLSV in pear in India was also recorded for the first time in India. The fragments per kilobase of transcript per million reads mapped estimation showed the dominance of ASPV and CiVA in Pe1 and Pe2, respectively. Single nucleotide variants (SNVs) analysis revealed that ASPV had the highest number of SNVs (477), while ACLSV had the lowest number of SNVs (1). The presence of ARWV-1, ApNMV, CiVA, ASPV, ASGV, ACLSV, ASGV-Shimla, and ASSVd was also confirmed in pear samples through Sanger sequencing. The present study widens our understanding of the pear virome and host range expansion of viruses in the genus Rubodvirus and Ilarvirus. This information will be useful in biological study of these viruses and virus indexing programs in pear.

Stem-pitting caused by Citrus tristeza virus is associated with increased phloem occlusion

Stem-pitting (SP) disease results from disruption of normal phloem and xylem development. In citrus, a characteristic manifestation of SP caused by Citrus tristeza virus (CTV) is phloem regeneration. We hypothesized that phloem regeneration occurs due to reduced functionality of CTV infected phloem cells. To examine phloem cell occlusions in CTV-SP, we analyzed callose and phloem-protein (PP) accumulation in Citrus macrophylla trees infected with CTV mutants exhibiting different SP phenotypes from very mild (CTVΔp13) to severe (CTVΔp33), in addition to full-length CTV and healthy plants. CTV infection was accompanied by callose and PP accumulation in the phloem. With the increase in the SP symptoms from very mild to severe, there was a constant increase in the levels of callose and PP, accompanied by an increase in PHLOEM-PROTEIN 2 and a decrease in BETA-1,3-GLUCANASE gene expression levels. These results indicate that SP symptom development is associated with increased phloem occlusion.

The functions of triple gene block proteins and coat protein of apple stem pitting virus in viral cell-to-cell movement.

Apple stem pitting virus is a species in the genus Foveavirus in the family Betaflexiviridae. Apple stem pitting virus (ASPV) commonly infects apple and pear plants grown worldwide. In this study, by integrating bimolecular fluorescence complementation, split-ubiquitin-based membrane yeast two-hybrid, and Agrobacterium-mediated expression assays, the interaction relationships and the subcellular locations of ASPV proteins TGBp1-3 and CP in Nicotiana benthamiana leaf cells were determined. Proteins CP, TGBp1, TGBp2, and TGBp3 were self-interactable, and TGBp2 played a role in the formation of perinuclear viroplasm and enhanced the colocalization of TGBp3 with CP and TGBp1. We found that the plant microfilament and endoplasmic reticulum structures were involved in the production of TGBp3 and TGBp2 vesicles, and their disruption decreased the virus accumulation level in the systemic leaves. The TGBp3 motile vesicles functioned in delivering the viral ribonucleoprotein complexes to the plasma membrane. Two cysteine residues at sites 35 and 49 of the TGBp3 sorting signal were necessary for the diffusion of TGBp3-marked vesicles. Furthermore, our results revealed that TGBp1, TGBp2, and CP could increase plasmodesmal permeability and move to the adjacent cells. This study demonstrates an interaction network and a subcellular location map of four ASPV proteins and for the first time provides insight into the functions of these proteins in the movement of a foveavirus.

Long-term field evaluation of Pera sweet orange selections under the Brazilian humid subtropical climate

Currently, a low number of citrus varieties are commercially planted to supply the Brazilian citrus industry demand. The diversification of citrus scion and rootstock varieties is an important strategy to prevent disease outbreaks and to obtain higher off-season profits, as well as to extend fruit supply for the citrus processing industry. The aim of this study was to evaluate 16 Pera sweet orange selections (Citrus ×sinensis Osbeck) under a humid subtropical climate in the northwest region of the state of Paraná, Brazil regarding tree development, production, and disease incidence. The experimental orchard was planted in December 2012 in a randomized block design with three replications and five trees per plot. All scions were grafted on Rangpur lime rootstock (C. ×limonia Osbeck). The evaluations were performed from 2016 through 2022, and included vegetative growth, yield, fruit quality, estimated tree density and productivity for new plantings, and incidence of diseases as citrus canker, huanglongbing (HLB), and citrus tristeza virus (CTV). All data was submitted to ANOVA and means grouped by the Scott Knott’s test (p ≤ 0.05). Pera Perão was the most vigorous variety, with the heaviest and largest fruit, and was among the selections with the highest content of soluble solids (SS), titratable acidity (TA) and juice. However, this variety showed a light-yellow juice color, and one of the lowest SS·TA−1 ratio. This selection had the lowest percentage of fruits with citrus canker but was among the selections with the highest HLB incidence. The selections Ovale, Clone 9, and Clone 42 also showed higher vegetative growth and fruit length, but lower SS content, juice yield and technological indices. All other Pera selections had lower tree height and canopy volume than Ovale, Clone 9, and Clone 42, and adequate overall fruit quality. Conversely, Pera Comprida, Dibbern, Morretes, and Seleç ão 12 scored lower cumulative fruit yield. Pera Pirangi and Comprida had the highest citrus canker incidence on fruits, while Morretes, Ovo, Pirangi, Seleç ão 12, and Seleç ão 27 had the highest HLB incidence alongside Perão. Low severity level of stem pitting was observed within the evaluated selections. The scores ranged from one (absence of stem pitting) to two (sparse surface stem pitting). IAC, Olímpia, Mel, Bianchi, and IPR 159 revealed to be the most suitable for new plantings under humid subtropical edaphoclimatic conditions, as trees had small vegetative growth, high yield performance and fruit quality, in addition to showing lower incidences of citrus canker, HLB and CTV.

Development and preliminary application of a reverse-transcription droplet digital PCR assay for detection and quantification of apple stem pitting virus in vitro propagated apple plantlets

Apple stem pitting virus (ASPV) is a viral pathogen that affects pomefruit trees and causes significant economic losses. Considering its global distribution and economic impact, developing accurate and sensitive diagnostic technologies is imperative for producing ASPV-free plantlets through in vitro micropropagation. In the current study, the complete genome sequence of ASPV was obtained through high-throughput sequencing of micro-propagated apple plantlets. Further, the genome sequence was used to design primer sets for detecting ASPV using reverse-transcription droplet digital PCR (RT-ddPCR). The optimized RT-ddPCR assay did not show cross-reactivity to other major apple viruses, and it was at least 10 times more sensitive than RT-real-time quantitative PCR (RT-qPCR). Both RT-ddPCR and RT-qPCR data exhibited high degrees of linearity, with an R2 value of 0.9982. In addition, a field test was performed to validate the RT-ddPCR data in 44 apple plantlets. The results revealed that ddRT-PCR detected 41 positive samples, whereas only 39 positive samples were detected by RT-qPCR. The developed RT-ddPCR assay can serve as a precise, sensitive, and quantifiable method for the reliable diagnosis of ASPV infection in micropropagated apple plantlets, particularly in ASPV-free certification programs. Its utilization contributes to improved disease management, ensuring the maintenance of apple production.