Stable Ribonucleoprotein Complex Research Articles

Structure and dsRNA-binding activity of the Birnavirus Drosophila X Virus VP3 protein.

The Birnavirus multifunctional protein VP3 plays an essential role coordinating the virus life cycle, interacting with the capsid protein VP2, with the RNA-dependent RNA polymerase VP1 and with the dsRNA genome. Furthermore, the role of this protein in controlling host cell responses triggered by dsRNA and preventing gene silencing has been recently demonstrated. Here we report the X-ray structure and dsRNA-binding activity of the N-terminal domain of Drosophila X virus (DXV) VP3. The domain folds in a bundle of three α-helices and arranges as a dimer, exposing to the surface a well-defined cluster of basic residues. Site directed mutagenesis combined with Electrophoretic Mobility Shift Assays (EMSA) and Surface Plasmon Resonance (SPR) revealed that this cluster, as well as a flexible and positively charged region linking the first and second globular domains of DXV VP3, are essential for dsRNA-binding. Also, RNA silencing studies performed in insect cell cultures confirmed the crucial role of this VP3 domain for the silencing suppression activity of the protein.IMPORTANCE The Birnavirus moonlighting protein VP3 plays crucial roles interacting with the dsRNA genome segments to form stable ribonucleoprotein complexes and controlling host cell immune responses, presumably by binding to and shielding the dsRNA from recognition by the host silencing machinery. The structural, biophysical and functional data presented in this work has identified the N-terminal domain of VP3 as responsible for the dsRNA-binding and silencing suppression activities of the protein in Drosophila X virus.

Insights into the structure and function of Est3 from the Hansenula polymorpha telomerase

Telomerase is a ribonucleoprotein enzyme, which maintains genome integrity in eukaryotes and ensures continuous cellular proliferation. Telomerase holoenzyme from the thermotolerant yeast Hansenula polymorpha, in addition to the catalytic subunit (TERT) and telomerase RNA (TER), contains accessory proteins Est1 and Est3, which are essential for in vivo telomerase function. Here we report the high-resolution structure of Est3 from Hansenula polymorpha (HpEst3) in solution, as well as the characterization of its functional relationships with other components of telomerase. The overall structure of HpEst3 is similar to that of Est3 from Saccharomyces cerevisiae and human TPP1. We have shown that telomerase activity in H. polymorpha relies on both Est3 and Est1 proteins in a functionally symmetrical manner. The absence of either Est3 or Est1 prevents formation of a stable ribonucleoprotein complex, weakens binding of a second protein to TER, and decreases the amount of cellular TERT, presumably due to the destabilization of telomerase RNP. NMR probing has shown no direct in vitro interactions of free Est3 either with the N-terminal domain of TERT or with DNA or RNA fragments mimicking the probable telomerase environment. Our findings corroborate the idea that telomerase possesses the evolutionarily variable functionality within the conservative structural context.

Live-cell single-particle tracking photoactivated localization microscopy of Cascade-mediated DNA surveillance.

Type I CRISPR-Cas systems utilize small CRISPR RNA (crRNA) molecules to scan DNA strands for target regions. Different crRNAs are bound by several CRISPR-associated (Cas) protein subunits that form the stable ribonucleoprotein complex Cascade. The Cascade-mediated DNA surveillance process requires a sufficient degree of base-complementarity between crRNA and target sequences and relies on the recognition of small DNA motifs, termed protospacer adjacent motifs. Recently, super-resolution microscopy and single-particle tracking methods have been developed to follow individual protein complexes in live cells. Here, we described how this technology can be adapted to visualize the DNA scanning process of Cascade assemblies in Escherichia coli cells. The activity of recombinant Type I-Fv Cascade complexes of Shewanella putrefaciens CN-32 serves as a model system that facilitates comparative studies for many of the diverse CRISPR-Cas systems.

P.278 - CRISPR/Cas9-mediated genome editing corrects splicing alterations in myotonic dystrophy type 1

Myotonic dystrophy type 1 (DM1) belongs to the group of nucleotide repeat disorders. More specifically this autosomal form of muscular dystrophy is caused by the expansion of the CTG trinucleotide repeat located at the 3' untranslated region (3′-UTR) of the DMPK gene. Elongated CUG repeats of the mutated DMPK mRNAs become sequestration sites for splicing factors, and induce the formation of stable ribonucleoprotein complexes visualized as foci. As a consequence, the alternative splicing of numerous transcripts is dysregulated, which leads to the DM1 pathological alterations affecting various tissues. We have developed a strategy to delete the CTG repeat expansion in the human DMPK locus by using the CRISPR/Cas9 system. For that purpose, we constructed different expression platforms for small size Cas9 nucleases under either a ubiquitous or a muscle-specific promoter and guide RNAs (sgRNAs) targeting the 3'-UTR of the DMPK gene. Co-transfection of these constructs in DM1 cells resulted in the deletion of the CTG repeat. In order to optimize the delivery of Cas9 and sgRNAs in myoblast cell lines, these constructs were cloned into lentiviral vectors. Cells transduced with Cas9-sgRNA lentiviral vectors were tested for the deletion of DMPK CTG repeats and for the presence of nuclear foci by FISH. Furthermore, upon muscle cell differentiation, we investigated the mis-splicing of transcripts that are dysregulated in the DM1 disease. Our data overall demonstrate that the deletion of the CTG repeats at the 3′-UTR of the DMPK gene reverts the DM1 phenotype at molecular and cellular levels.

Functional Consequences of RNA 5'-Terminal Deletions on Coxsackievirus B3 RNA Replication and Ribonucleoprotein Complex Formation.

Group B coxsackieviruses are responsible for chronic cardiac infections. However, the molecular mechanisms by which the virus can persist in the human heart long after the signs of acute myocarditis have abated are still not completely understood. Recently, coxsackievirus B3 strains with 5'-terminal deletions in genomic RNAs were isolated from a patient suffering from idiopathic dilated cardiomyopathy, suggesting that such mutant viruses may be the forms responsible for persistent infection. These deletions lacked portions of 5' stem-loop I, which is an RNA secondary structure required for viral RNA replication. In this study, we assessed the consequences of the genomic deletions observed in vivo for coxsackievirus B3 biology. Using cell extracts from HeLa cells, as well as transfection of luciferase replicons in two types of cardiomyocytes, we demonstrated that coxsackievirus RNAs harboring 5' deletions ranging from 7 to 49 nucleotides in length can be translated nearly as efficiently as those of wild-type virus. However, these 5' deletions greatly reduced the synthesis of viral RNA in vitro, which was detected only for the 7- and 21-nucleotide deletions. Since 5' stem-loop I RNA forms a ribonucleoprotein complex with cellular and viral proteins involved in viral RNA replication, we investigated the binding of the host cell protein PCBP2, as well as viral protein 3CDpro, to deleted positive-strand RNAs corresponding to the 5' end. We found that binding of these proteins was conserved but that ribonucleoprotein complex formation required higher PCBP2 and 3CDpro concentrations, depending on the size of the deletion. Overall, this study confirmed the characteristics of persistent CVB3 infection observed in heart tissues and provided a possible explanation for the low level of RNA replication observed for the 5'-deleted viral genomes-a less stable ribonucleoprotein complex formed with proteins involved in viral RNA replication.IMPORTANCE Dilated cardiomyopathy is the most common indication for heart transplantation worldwide, and coxsackie B viruses are detected in about one-third of idiopathic dilated cardiomyopathies. Terminal deletions at the 5' end of the viral genome involving an RNA secondary structure required for RNA replication have been recently reported as a possible mechanism of virus persistence in the human heart. These mutations are likely to disrupt the correct folding of an RNA secondary structure required for viral RNA replication. In this report, we demonstrate that transfected RNAs harboring 5'-terminal sequence deletions are able to direct the synthesis of viral proteins, but not genomic RNAs, in human and murine cardiomyocytes. Moreover, we show that the binding of cellular and viral replication factors to viral RNA is conserved despite genomic deletions but that the impaired RNA synthesis associated with terminally deleted viruses could be due to destabilization of the ribonucleoprotein complexes formed.

Site-Directed Chemical Probing to map transient RNA/protein interactions.

RNA-protein interactions are at the bases of many biological processes, forming either tight and stable functional ribonucleoprotein (RNP) complexes (i.e. the ribosome) or transitory ones, such as the complexes involving RNA chaperone proteins. To localize the sites where a protein interacts on an RNA molecule, a common simple and inexpensive biochemical method is the footprinting technique. The protein leaves its footprint on the RNA acting as a shield to protect the regions of interaction from chemical modification or cleavages obtained with chemical or enzymatic nucleases. This method has proven its efficiency to study in vitro the organization of stable RNA-protein complexes. Nevertheless, when the protein binds the RNA very dynamically, with high off-rates, protections are very often difficult to observe. For the analysis of these transient complexes, we describe an alternative strategy adapted from the Site Directed Chemical Probing (SDCP) approach and we compare it with classical footprinting. SDCP relies on the modification of the RNA binding protein to tether an RNA probe (usually Fe-EDTA) to specific protein positions. Local cleavages on the regions of interaction can be used to localize the protein and position its domains on the RNA molecule. This method has been used in the past to monitor stable complexes; we provide here a detailed protocol and a practical example of its application to the study of Escherichia coli RNA chaperone protein S1 and its transitory complexes with mRNAs.

322. Genome Editing for Nucleotide Repeat Disorders: Towards a New Therapeutic Approach for Myotonic Dystrophy Type 1

Myotonic dystrophy type 1 (DM1) belongs to the group of nucleotide repeat disorders. More specifically this autosomal form of muscular dystrophy is caused by the expansion of the CTG trinucleotide repeat located at the 3’ untranslated region (3’-UTR) of the DMPK gene. Elongated CUG repeats of the mutated DMPK mRNAs become sequestration sites for splicing factors, and induce the formation of stable ribonucleoprotein complexes visualized as foci. As a consequence, the alternative splicing of numerous transcripts is dysregulated, which leads to the DM1 pathological alterations affecting various tissues. We have developed a strategy to delete the CTG repeat expansion in the human DMPK locus by using the CRISPR/Cas9 system. For that purpose, we constructed different expression platforms for small size Cas9 nucleases under either a ubiquitous or a muscle-specific promoter and guide RNAs (sgRNAs) targeting the 3’-UTR of the DMPK gene. Co-transfection of these constructs in DM1 primary myoblasts resulted in the deletion of the CTG repeat. We are currently optimizing the delivery of these Cas9 and sgRNAs constructs in cells by their vectorization in lentiviral and adeno-associated vectors and will present data on in vitro (DM1 patient-derived cell lines) and in vivo (wild-type mice) assays.

Quaternary arrangement of an active, native group II intron ribonucleoprotein complex revealed by small-angle X-ray scattering

The stable ribonucleoprotein (RNP) complex formed between the Lactococcus lactis group II intron and its self-encoded LtrA protein is essential for the intron’s genetic mobility. In this study, we report the biochemical, compositional, hydrodynamic and structural properties of active group II intron RNP particles (+A) isolated from its native host using a novel purification scheme. We employed small-angle X-ray scattering to determine the structural properties of these particles as they exist in solution. Using sucrose as a contrasting agent, we derived a two-phase quaternary model of the protein–RNA complex. This approach revealed that the spatial properties of the complex are largely defined by the RNA component, with the protein dimer located near the center of mass. A transfer RNA fusion engineered into domain II of the intron provided a distinct landmark consistent with this interpretation. Comparison of the derived +A RNP shape with that of the previously reported precursor intron (ΔA) particle extends previous findings that the loosely packed precursor RNP undergoes a dramatic conformational change as it compacts into its active form. Our results provide insights into the quaternary arrangement of these RNP complexes in solution, an important step to understanding the transition of the group II intron from the precursor to a species fully active for DNA invasion.

Phosphorylation of bamboo mosaic virus satellite RNA (satBaMV)-encoded protein P20 downregulates the formation of satBaMV-P20 ribonucleoprotein complex

Bamboo mosaic virus (BaMV) satellite RNA (satBaMV) depends on BaMV for its replication and encapsidation. SatBaMV-encoded P20 protein is an RNA-binding protein that facilitates satBaMV systemic movement in co-infected plants. Here, we examined phosphorylation of P20 and its regulatory functions. Recombinant P20 (rP20) was phosphorylated by host cellular kinase(s) in vitro, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and mutational analyses revealed Ser-11 as the phosphorylation site. The phosphor-mimic rP20 protein interactions with satBaMV-translated mutant P20 were affected. In overlay assay, the Asp mutation at S11 (S11D) completely abolished the self-interaction of rP20 and significantly inhibited the interaction with both the WT and S11A rP20. In chemical cross-linking assays, S11D failed to oligomerize. Electrophoretic mobility shift assay and subsequent Hill transformation analysis revealed a low affinity of the phospho-mimicking rP20 for satBaMV RNA. Substantial modulation of satBaMV RNA conformation upon interaction with nonphospho-mimic rP20 in circular dichroism analysis indicated formation of stable satBaMV ribonucleoprotein complexes. The dissimilar satBaMV translation regulation of the nonphospho- and phospho-mimic rP20 suggests that phosphorylation of P20 in the ribonucleoprotein complex converts the translation-incompetent satBaMV RNA to messenger RNA. The phospho-deficient or phospho-mimicking P20 mutant of satBaMV delayed the systemic spread of satBaMV in co-infected Nicotiana benthamiana with BaMV. Thus, satBaMV likely regulates the formation of satBaMV RNP complex during co-infection in planta.

CmRBP50 Protein Phosphorylation Is Essential for Assembly of a Stable Phloem-mobile High-affinity Ribonucleoprotein Complex

RNA-binding proteins (RBPs) form ribonucleoprotein (RNP) complexes that play crucial roles in RNA processing for gene regulation. The angiosperm sieve tube system contains a unique population of transcripts, some of which function as long-distance signaling agents involved in regulating organ development. These phloem-mobile mRNAs are translocated as RNP complexes. One such complex is based on a phloem RBP named Cucurbita maxima RNA-binding protein 50 (CmRBP50), a member of the polypyrimidine track binding protein family. The core of this RNP complex contains six additional phloem proteins. Here, requirements for assembly of this CmRBP50 RNP complex are reported. Phosphorylation sites on CmRBP50 were mapped, and then coimmunoprecipitation and protein overlay studies established that the phosphoserine residues, located at the C terminus of CmRBP50, are critical for RNP complex assembly. In vitro pull-down experiments revealed that three phloem proteins, C. maxima phloem protein 16, C. maxima GTP-binding protein, and C. maxima phosphoinositide-specific phospholipase-like protein, bind directly with CmRBP50. This interaction required CmRBP50 phosphorylation. Gel mobility-shift assays demonstrated that assembly of the CmRBP50-based protein complex results in a system having enhanced binding affinity for phloem-mobile mRNAs carrying polypyrimidine track binding motifs. This property would be essential for effective long-distance translocation of bound mRNA to the target tissues.

An Archaeal tRNA-Synthetase Complex that Enhances Aminoacylation under Extreme Conditions

Aminoacyl-tRNA synthetases (aaRSs) play an integral role in protein synthesis, functioning to attach the correct amino acid with its cognate tRNA molecule. AaRSs are known to associate into higher-order multi-aminoacyl-tRNA synthetase complexes (MSC) involved in archaeal and eukaryotic translation, although the precise biological role remains largely unknown. To gain further insights into archaeal MSCs, possible protein-protein interactions with the atypical Methanothermobacter thermautotrophicus seryl-tRNA synthetase (MtSerRS) were investigated. Yeast two-hybrid analysis revealed arginyl-tRNA synthetase (MtArgRS) as an interacting partner of MtSerRS. Surface plasmon resonance confirmed stable complex formation, with a dissociation constant (K(D)) of 250 nM. Formation of the MtSerRS·MtArgRS complex was further supported by the ability of GST-MtArgRS to co-purify MtSerRS and by coelution of the two enzymes during gel filtration chromatography. The MtSerRS·MtArgRS complex also contained tRNA(Arg), consistent with the existence of a stable ribonucleoprotein complex active in aminoacylation. Steady-state kinetic analyses revealed that addition of MtArgRS to MtSerRS led to an almost 4-fold increase in the catalytic efficiency of serine attachment to tRNA, but had no effect on the activity of MtArgRS. Further, the most pronounced improvements in the aminoacylation activity of MtSerRS induced by MtArgRS were observed under conditions of elevated temperature and osmolarity. These data indicate that formation of a complex between MtSerRS and MtArgRS provides a means by which methanogenic archaea can optimize an early step in translation under a wide range of extreme environmental conditions.

Sm protein methylation is dispensable for snRNP assembly in Drosophila melanogaster

Sm proteins form stable ribonucleoprotein (RNP) complexes with small nuclear (sn)RNAs and are core components of the eukaryotic spliceosome. In vivo, the assembly of Sm proteins onto snRNAs requires the survival motor neurons (SMN) complex. Several reports have shown that SMN protein binds with high affinity to symmetric dimethylarginine (sDMA) residues present on the C-terminal tails of SmB, SmD1, and SmD3. This post-translational modification is thought to play a crucial role in snRNP assembly. In human cells, two distinct protein arginine methyltransferases (PRMT5 and PRMT7) are required for snRNP biogenesis. However, in Drosophila, loss of Dart5 (the fruit fly PRMT5 ortholog) has little effect on snRNP assembly, and homozygous mutants are completely viable. To resolve these apparent differences, we examined this topic in detail and found that Drosophila Sm proteins are also methylated by two methyltransferases, Dart5/PRMT5 and Dart7/PRMT7. Unlike dart5, we found that dart7 is an essential gene. However, the lethality associated with loss of Dart7 protein is apparently unrelated to defects in snRNP assembly. To conclusively test the requirement for sDMA modification of Sm proteins in Drosophila snRNP assembly, we constructed a fly strain that exclusively expresses an isoform of SmD1 that cannot be sDMA modified. Interestingly, these flies were viable, and snRNP assays revealed no defects in comparison to wild type. In contrast, dart5 mutants displayed a strong synthetic lethal phenotype in the presence of a hypomorphic Smn mutation. We therefore conclude that dart5 is required for viability when SMN is limiting.

Quantitative Analysis of RNA‐mediated Protein–Protein Interactions in Living Cells by FRET

Specific assembly of ribonucleoprotein complexes is essential in controlling various cellular functions including gene regulation. Diverse scaffolds containing proteins or nucleic acids could play key roles in stabilizing specific ribonucleoprotein complexes by enhancing protein-protein or RNA-protein interactions. One such example is the assembly of active RNA polymerase II transcription elongation complex originating from HIV-1 long terminal repeat promoter that involves HIV-1-encoded Tat protein and viral mRNA structure, trans-activation responsive RNA, and human CyclinT1 which is a subunit of the positive transcription elongation factor complex b. By using genetically encoded fluorescent proteins fused with Tat and human CyclinT1, here we demonstrate that human CyclinT1 was diffused throughout the nucleus and specific interactions between Tat and human CyclinT1 altered the localization of human CyclinT1 to specific nuclear foci. We also found that trans-activation responsive RNA enhanced protein-protein interactions between human CyclinT1 and Tat in living cells. Our results highlights the importance of trans-activation responsive RNA as a scaffold for stable and high affinity assembly of two protein partners to form a regulatory switch essential in HIV-1 gene regulation. RNA-mediated assembly of ribonucleoprotein complexes could be a general mechanism for stable ribonucleoprotein complex formation and a key step in regulating other cellular processes and viral replication. Furthermore, our results suggest that Tat interactions with human CyclinT1 change the nuclear location of positive transcription elongation factor complex b to modulate positive transcription elongation factor complex b function and transcription of cellular genes.

IMP1 interacts with poly(A)‐binding protein (PABP) and the autoregulatory translational control element of PABP‐mRNA through the KH III‐IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs.

RNA-binding proteins HuR and AUF1 bind to many common AU-rich target mRNAs and exert opposing influence on target mRNA stability, but the functional interactions between HuR and AUF1 have not been systematically studied. Here, using common target RNAs encoding p21 and cyclin D1, we provide evidence that HuR and AUF1 can bind target transcripts on both distinct, nonoverlapping sites, and on common sites in a competitive fashion. In the nucleus, both proteins were found together within stable ribonucleoprotein complexes; in the cytoplasm, HuR and AUF1 were found to bind to target mRNAs individually, HuR colocalizing with the translational apparatus and AUF1 with the exosome. Our results indicate that the composition and fate (stability, translation) of HuR- and/or AUF1-containing ribonucleoprotein complexes depend on the target mRNA of interest, RNA-binding protein abundance, stress condition, and subcellular compartment.

TAR RNA loop: a scaffold for the assembly of a regulatory switch in HIV replication.

Replication of HIV requires the Tat protein, which activates elongation of RNA polymerase II transcription at the HIV-1 promoter by interacting with the cyclin T1 (CycT1) subunit of the positive transcription elongation factor complex b (P-TEFb). The transactivation domain of Tat binds directly to the CycT1 subunit of P-TEFb and induces loop sequence-specific binding of P-TEFb onto nascent HIV-1 trans-activation responsive region (TAR) RNA. We used systematic RNA-protein photocross-linking, Western blot analysis, and protein footprinting to show that residues 252-260 of CycT1 interact with one side of the TAR RNA loop and enhance interaction of Tat residue K50 to the other side of the loop. Our results show that TAR RNA provides a scaffold for two protein partners to bind and assemble a regulatory switch in HIV replication. RNA-mediated assembly of RNA-protein complexes could be a general mechanism for stable ribonucleoprotein complex formation and a key step in regulating other cellular processes and viral replication.

SRPDB (Signal Recognition Particle Database).

Signal recognition particle (SRP) is a stable cytoplasmic ribonucleoprotein complex that serves to translocate secretory proteins across membranes during translation. The SRP Database (SRPDB) provides compilations of SRP components, ordered alphabetically and phylogenetically. Alignments emphasize phylogenetically-supported base pairs in SRP RNA and conserved residues in the proteins. Data are provided in various formats including a column arrangement for improved access and simplified computational usability. Included are motifs for identification of new sequences, SRP RNA secondary structure diagrams, 3-D models and links to high-resolution structures. This release includes 11 new SRP RNA sequences (total of 129), two protein SRP9 sequences (total of seven), two protein SRP14 sequences (total of 10), two protein SRP19 sequences (total of 16), 10 new SRP54 (ffh) sequences (total of 66), two protein SRP68 sequences (total of seven) and two protein SRP72 sequences (total of nine). Seven sequences of the SRP receptor alpha-subunit and its FtsY homolog (total of 51) are new. Also considered are ss-subunit of SRP receptor, Flhf, Hbsu, CaM kinase II and cpSRP43. Access to SRPDB is at http://psyche.uthct. edu/dbs/SRPDB/SRPDB.html and the European mirror http://www.medkem. gu.se/dbs/SRPDB/SRPDB.html

Involvement of boxA Nucleotides in the Formation of a Stable Ribonucleoprotein Complex Containing the Bacteriophage λ N Protein

The association of the transcriptional antitermination protein N of bacteriophage lambda with Escherichia coli RNA polymerase depends on nut site RNA (boxA + boxB) in the nascent transcript and the host protein, NusA. This ribonucleoprotein complex can transcribe through Rho-dependent and intrinsic termination sites located up to several hundred base pairs downstream of nut. For antitermination to occur farther downstream, this core antitermination complex must be stabilized by the host proteins NusB, NusG, and ribosomal protein S10. Here, we show that the assembly of NusB, NusG, and S10 onto the core complex involves nucleotides 2-7 of lambda boxA (CGCUCUUACACA) and is a fully cooperative process that depends on the presence of all three proteins. This assembly of NusB, NusG, and S10 also requires the carboxyl-terminal region (amino acids 73-107) of N, which interacts directly with RNA polymerase. NusB and S10 assemble in the absence of NusG when lambda boxA is altered at nucleotides 8 and 9 to create a consensus version of boxA (CGCUCUUUAACA). These experiments suggest that multiple protein-protein and protein-RNA interactions are required to convert a core antitermination complex into a complete complex.

Trans mRNA splicing in trypanosomes: cloning and analysis of a PRP8-homologous gene from Trypanosoma brucei provides evidence for a U5-analogous RNP.

In trypanosomes all mRNAs are generated through trans mRNA splicing, requiring the functions of the small nuclear RNAs U2, U4 and U6. In the absence of conventional cis mRNA splicing, the structure and function of a U5-analogous snRNP in trypanosomes has remained an open question. In cis splicing, a U5 snRNP-specific protein component called PRP8 in yeast and p220 in man is a highly conserved, essential splicing factor involved in splice-site recognition and selection. We have cloned and sequenced a genomic region from Trypanosoma brucei, that contains a PRP8/p220-homologous gene (p277) coding for a 277 kDa protein. Using an antibody against a C-terminal region of the trypanosomal p277 protein, a small RNA of approximately 65 nucleotides could be specifically co-immunoprecipitated that appears to be identical with a U5 RNA (SLA2 RNA) recently identified by Dungan et al. (1996). Based on sedimentation, immunoprecipitation and Western blot analyses we conclude that this RNA is part of a stable ribonucleoprotein (RNP) complex and associated not only with the p277 protein, but also with the common proteins present in the other trans-spliceosomal snRNPs. Together these results demonstrate that a U5-analogous RNP exists in trypanosomes and suggest that basic functions of the U5 snRNP are conserved between cis and trans splicing.

Localization of a Human Double-Stranded RNA-Binding Protein Gene (STAU) to Band 20q13.1 by Fluorescencein SituHybridization

Asymmetric transport of mRNA within the cells is mediated by RNA-binding proteins that form, along with the mRNAs and perhaps other small RNAs, stable ribonucleoprotein complexes. However, the nature of the protein components of these complexes in vertebrates is still unknown. InDrosophila,genetic studies have identified a number of potential genes that are necessary for localization of mRNAs in oocytes; one of the most studied is thestaufengene. The staufen protein has been shown to bind to localized mRNAs in oocytes and to be expressed in somatic cells as well. To understand the mechanism of mRNA transport in mammals and characterize its components, we recently cloned and sequenced the humanstaufenhomolog cDNA (HGMW-approved symbol STAU). In this paper, we show that the gene is unique in the human genome and report its chromosomal localization by fluorescencein situhybridization. The humanstaufengene maps to chromosome 20q13.1, a region that is associated with certain genetic diseases.