SPR Technique Research Articles

Biotinylated aptamer-based SPR biosensor for detection of CA125 antigen

Carbohydrate antigen 125 (CA125) is used for the prediction of the risk of ovarian malignancy algorithm value as an early diagnosis algorithm of ovarian cancer (OC). Hence, the detection of OC in the early stage requires techniques with high sensitivity and specificity. This work presents the development of a highly sensitive and specific aptamer-based SPR biosensor for the detection of CA125 antigen. A biotinylated CA125 aptamer (Ap) was immobilized onto a streptavidin-coated gold chip by affinity capture. Parameters affecting the response such as temperature, flow rate, and pH of flow buffer were optimized, and bioanalytical method validation elements were calculated. The linear range of the system response was 10–100 U mL−1, and the limit of detection (LOD) was found to be 0.01 U mL−1. The results affirmed that both precision and accuracy were lower than 15% for each concentration of CA125, and its recoveries were in the range of 97.5–105%. Therefore, the precision, accuracy, and recovery were acceptable for the determination of CA125 using the developed aptabiosensor. The developed Ap-based SPR technique was highly efficient for the clinical measurement of CA125 in human serum samples. In conclusion, the developed aptasensor can be an alternative for the screening and early detection of OC.

Characterization of FcγRIa (CD64) as a Ligand Molecule for Site-Specific IgG1 Capture: A Side-By-Side Comparison with Protein A.

Fc γ receptors (FcγRs) are one of the structures that can initiate effector function for monoclonal antibodies. FcγRIa has the highest affinity toward IgG1-type monoclonal antibodies among all FcγRs. In this study, a comprehensive characterization was performed for FcγRIa as a potential affinity ligand for IgG1-type monoclonal antibody binding. The binding interactions were assessed with the SPR technique using different immobilization techniques such as EDC-NHS coupling, streptavidin-biotin interaction, and His-tagged FcγRIa capture. The His-tagged FcγRIa capture was the most convenient method based on assay repeatability. Next, a crude IgG1 sample and its fractions with different monomer contents obtained from protein A affinity chromatography were used to evaluate FcγRIa protein in terms of monoclonal antibody binding capacity. The samples were also compared with a protein A-immobilized chip (a frequently used affinity ligand) for IgG1 binding responses. The antibody binding capacity of the protein A-immobilized chip surface was significantly better than that of the FcγRIa-immobilized chip surface due to its 5 Ig binding domains. The antibody binding responses changed similarly with protein A depending on the monomer content of the sample. Finally, a different configuration was used to assess the binding affinity of free FcγRs (FcγRIa, FcγRIIa, and FcγRIIIa) to three different immobilized IgGs by immobilizing protein L to the chip surface. Unlike previous immobilization techniques tested where the FcγRIa was utilized as a ligand, nonimmobilized or free FcγRIa resulted in a significantly higher antibody binding response than free protein A. In this configuration, kinetics data of FcγRI revealed that the association rate (ka 50-80 × 105 M-1 s-1) increased in comparison to His capture method (1.9-2.4 × 105 M-1 s-1). In addition, the dissociation rate (kd 10-5 s-1) seemed slower over the His capture method (10-4 s-1) and provided stability on the chip surface during the dissociation phase. The KD values for FcγRIa were found in the picomolar range (2.1-10.33 pM from steady-state affinity analysis and 37.5-46.2 pM from kinetic analysis) for IgG1-type antibodies. FcγRIa possesses comparable ligand potential as well as protein A. Even though the protein A-immobilized surface bound more antibodies than the FcγRIa-captured surface, FcγRIa presented a significant antibody binding capacity in protein L configuration. The results suggest FcγRIa protein as a potential ligand for site-oriented immobilization of IgG1-type monoclonal antibodies, and it needs further performance investigation on different surfaces and interfaces for applications such as sensing and antibody purification.

Ultra-high-sensitive biosensor based on SrTiO3 and two-dimensional materials: ellipsometric concepts

We propose a new Kretschmann configuration-based SPR biosensor using the combination of SrTiO3 (STO) and two-dimensional (2D) materials. Using STO and single-layer graphene (SLG) enhanced the sensitivity by about 187% compared to conventional SPR biosensors in the angle interrogation method. This enhancement is related to the 44 nm of silver/13 nm of STO/SLG structure with a sensitivity of 333.2 °/RIU and conventional Ag-based SPR biosensor has a sensitivity of 116 °/RIU. Although the highest achieved sensitivity is 409 °/RIU for the 40 nm of Ag/14 nm of STO but for biosensor applications, 2D materials are needed to act as a Biomolecule Recognition Element (BRE). Furthermore, numerical modeling of ellipsometry integrated with the SPR technique is used, and it showed extraordinary enhancement in the overall performance of the proposed biosensor. Firstly, using Ψ can help to enhance the quality factor (QF) of the 2D materials-based SPR biosensor by more than 50%. Furthermore, using differential phase from numerical modeling of ellipsometry, by providing the extraordinary sensitivity of about 32140 °/RIU, improve the sensitivity more than 270-fold compared to conventional Ag-based SPR biosensors. These results show that our proposed structure and method will be beneficial in biomedical applications.

Optimized Methods for Analytical and Functional Comparison of Biosimilar mAb Drugs: A Case Study for Avastin, Mvasi, and Zirabev

Bevacizumab is a humanized therapeutic monoclonal antibody used to reduce angiogenesis, a hallmark of cancer, by binding to VEGF-A. Many pharmaceutical companies have developed biosimilars of Bevacizumab in the last decade. The official reports provided by the FDA and EMA summarize the analytical performance of biosimilars as compared to the originators without giving detailed analytical procedures. In the current study, several key methods were optimized and reported for analytical and functional comparison of bevacizumab originators (Avastin, Altuzan) and approved commercial biosimilars (Zirabev and Mvasi). This case study presents a comparative analysis of a set of biosimilars under optimized analytical conditions for the first time in the literature. The chemical structure of all products was analyzed at intact protein and peptide levels by high-resolution mass spectrometry; the major glycoforms and posttranslational modifications, including oxidation, deamidation, N-terminal PyroGlu addition, and C-terminal Lys clipping, were compared. The SPR technique was used to reveal antigen and some receptor binding kinetics of all products, and the ELISA technique was used for C1q binding affinity analysis. Finally, the inhibition performance of the samples was evaluated by an MTS-based proliferation assay in vitro. Major glycoforms were similar, with minor differences among the samples. Posttranslational modifications, except C-terminal Lys, were determined similarly, while unclipped Lys percentage was higher in Zirabev. The binding kinetics for VEGF, FcRn, FcγRIa, and C1q were similar or in the value range of originators. The anti-proliferative effect of Zirabev was slightly higher than the originators and Mvasi. The analysis of biosimilars under the same conditions could provide a new aspect to the literature in terms of the applied analytical techniques. Further studies in this field would be helpful to better understand the inter-comparability of the biosimilars.

Theoretical and Experimental Investigation on SPR Gas Sensor Based on ZnO/Polypyrrole Interface for Ammonia Sensing Applications

This work includes the exploitation of the laboratory-assembled SPR technique for the application of gas sensors at room temperature. The refractive index change at the interface of ZnO/polypyrrole with adsorption of gases (NH3) is the basis of the SPR gas sensor. The theoretical simulations were done to find out the optimum thickness of ZnO and polypyrrole composite films for sharp SPR reflectance values. Theoretical SPR curves obtained by changing the value of the thickness of gold nanoparticle film and incident wavelength are also presented in the manuscript. Experimental studies were done to validate the theoretical studies and discussions were done about the interaction of NH3 gas with prism/Au/ZnO/polypyrrole system. Here, ZnO/polypyrrole multilayer structure is the sensing layer to develop a highly efficient SPR-based NH3 gas sensor. The outcome of these results validates the significance of the SPR technique for the application of interaction of surface adsorbed analytes, with the interface of dielectrics and sensing material.

Development of Ag decorated Au core-shell nanospheres for the detection of Cr(III) from environmental sample

Trivalent chromium ions are the abundant toxic metal, released to environment by various industrial effluent discharges. A sensitive and specific SPR technique for Cr(III) detection in trace levels from aqueous sample was developed in the present study. Here, Ag decorated Au nanoparticles (NPs) was functionalized with citrate by chemical-reduction technique. The Ag–Au NPs probe was analyzed via UV–visible spectrophotometer, TEM, EDAX, FTIR, DLS, and zetasizer. The Ag–Au NPs zeta potential was −36.66 mV and the particle size was 19 nm. The developed probe shown drastic variation in colour from dark pink to colourless with response time of 60 s after the interaction with Cr(III) ions. The absorbance at A526 showed good linearity with Cr(III) concentrations (10 nM - 100 µM). The LOD of Ag–Au NPs probe for Cr(III) detection was found to be 0.4 nM. The Ag–Au NPs sensor showed high specificity towards Cr(III) ions even in presence with competitive metal ions. In acidic pH and at temperature range of 25–50 °C the probe worked effectively. At last, the fabricated probe was applied for Cr(III) ion estimation in Cr(III) augmented environmental samples and the detection accuracy was determined by comparing with atomic absorption spectrophotometric analysis. Thus, the reported suggest that Ag–Au NPs could be applied for the selective detection of Cr(III) from environmental samples with excellent accuracy.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Recent Advancements in Receptor Layer Engineering for Applications in SPR-Based Immunodiagnostics.

The rapid progress in the development of surface plasmon resonance-based immunosensing platforms offers wide application possibilities in medical diagnostics as a label-free alternative to enzyme immunoassays. The early diagnosis of diseases or metabolic changes through the detection of biomarkers in body fluids requires methods characterized by a very good sensitivity and selectivity. In the case of the SPR technique, as well as other surface-sensitive detection strategies, the quality of the transducer-immunoreceptor interphase is crucial for maintaining the analytical reliability of an assay. In this work, an overview of general approaches to the design of functional SPR-immunoassays is presented. It covers both immunosensors, the design of which utilizes well-known and often commercially available substrates, as well as the latest solutions developed in-house. Various approaches employing chemical and passive binding, affinity-based antibody immobilization, and the introduction of nanomaterial-based surfaces are discussed. The essence of their influence on the improvement of the main analytical parameters of a given immunosensor is explained. Particular attention is paid to solutions compatible with the latest trends in the development of label-free immunosensors, such as platforms dedicated to real-time monitoring in a quasi-continuous mode, the use of in situ-generated receptor layers (elimination of the regeneration step), and biosensors using recombinant and labelled protein receptors.

Calix[4]arene-triazine conjugate intermediate: optical properties and gas sensing responses against aromatic hydrocarbons in Langmuir–Blodgett films

The detection of organic vapors by chemically based sensors was achieved with macromolecules having convenient molecular cavities. Addressed herein, a calix[4]arene derivative 25,27-(4-chloro-2-phenylamino-1,3,5-triazine)-26,28-dihydroxycalix[4]arene (C4AsTr) was synthesized and Langmuir–Blodgett (LB) thin films of this compound modified with heterocyclic units were examined for its optical properties and gas sensing capabilities against trace vapor of aromatic BTX hydrocarbons (benzene, toluene, xylene) through surface plasmon resonance technique. In line with this purpose, the experimental SPR data were fitted using the Winspall software to evaluate optical properties of the C4AsTr film. Such thickness and refractive index values of C4AsTr LB films were determined as 1.19 ± 0.02 nm for the thickness per monolayer, and 1.60 ± 0.04 for the refractive index. Exposed to above-mentioned organic vapors were measured with SPR technique, and the photodetector responses of these optical sensors, ΔI, were recorded as a function of time during kinetic process. In order to quantify real-time SPR data, early time Fick’s diffusion law was handled to extract the diffusion coefficients. There were two different regions observed with two slopes indicating that one belongs to fast surface diffusion and second one slow for bulk diffusion into C4AsTr LB film. All SPR results both theoretical and experimental indicated that C4AsTr optical LB thin-film sensors exhibit high response, a good sensitivity and selectivity for saturated benzene vapor than others. These optical thin-film sensors with aniline substituted triazine heterocycle have been potential candidates for organic vapor sensing applications with simple and low-cost preparation at room temperature.

Utilizing ZnO Nanorods for CO gas detection by SPR technique

Detection of Carbon Monoxide gas is very vital issue in the environment. This study demonstrates a simple technique to detect Carbon Monoxide gas by Plasmon resonance peak shift in gold nanoparticles (NPs) coated on ZnO nanorods that are grown on the SiO2 surface. The structure is used to sense very low concentrations of CO gas (From 1 ppm to 15 ppm). Coating the NPs on to Zno Nanorods increases the surface-to-volume ratio and hence enhances the device sensitivity. This result allows to make a simple and precise sensor with quick and high response.

Polygonal finite element modeling of crack propagation via automatic adaptive mesh refinement

Polygonal finite element provides a great flexibility in mesh generation of crack propagation problems where the topology of the domain changes significantly. However, the control of the discretization error in such problems is a main concern. In this paper, a polygonal-FEM is presented in modeling of crack propagation problems via an automatic adaptive mesh refinement procedure. The adaptive mesh refinement is accomplished based on the Zienkiewicz–Zhu error estimator in conjunction with a weighted SPR technique. Adaptive mesh refinement is employed in some steps for reduction of the discretization error and not for tracking the crack. In the steps that no adaptive mesh refinement is required, local modifications are applied on the mesh to prevent poor polygonal element shapes. Finally, several numerical examples are analyzed to demonstrate the efficiency, accuracy and robustness of the proposed computational algorithm in crack propagation problems.

Superconvergent patch recovery with constraints for three‐dimensional contact problems within the Cartesian grid Finite Element Method

SummaryThe superconvergent patch recovery technique with constraints (SPR‐C) consists in improving the accuracy of the recovered stresses obtained with the original SPR technique by considering known information about the exact solution, like the internal equilibrium equation, the compatibility equation or the Neumann boundary conditions, during the recovery process. In this paper the SPR‐C is extended to consider the equilibrium around the contact area when solving contact problems with the Cartesian grid Finite Element Method. In the proposed method, the Finite Element stress fields of both bodies in contact are considered during the recovery process and the equilibrium is enforced by means of the continuity of tractions along the contact surface.

Identification and characterization of benzo[d]oxazol-2(3H)-one derivatives as the first potent and selective small-molecule inhibitors of chromodomain protein CDYL

Chemical probes of epigenetic ‘readers’ of histone post-translational modifications (PTMs) have become powerful tools for mechanistic and functional studies of their target proteins in physiology and pathology. However, only limited ‘reader’ probes have been developed, which restricted our understanding towards these macromolecules and their roles in cells or animals. Here, we reported a structure-guided approach to develop and characterize benzo [d]oxazol-2(3H)-one analogs as the first potent and selective small-molecule inhibitors of chromodomain Y-like (CDYL), a histone methyllysine reader protein. The binding conformation between the chromodomain of CDYL and the modified peptidomimetics was studied via molecular docking and dynamic simulations, facilitating subsequent virtual screening of tens of hits from Specs chemical library validated by SPR technique (KD values: from 271.1 μM to 5.4 μM). Further design and synthesis of 43 compounds helped to interpret the structure-activity relationship (SAR) that lead to the discovery of novel small-molecule inhibitors of CDYL. Compound D03 (KD: 0.5 μM) was discovered and showed excellent selectivity among other chromodomain proteins, including CDYL2 (>140 folds), CDY1 (no observed binding) and CBX7 (>32 folds). Moreover, we demonstrated that D03 engaged with endogenous CDYL in a dose-dependent manner, and perturbed the recruitment of CDYL onto chromatin, resulting in transcriptional derepression of its target genes. Finally, the results showed that D03 promoted the development and branching of neurodendrites by inhibiting CDYL in hippocampal and cortical cultured neurons. This study not only discovers the first selective small-molecule inhibitors of CDYL, but provids a new chemical tool to intervene the dynamic nature of bio-macromolecules involved in epigenetic mechanism.

Highly sensitive surface plasmon resonance based fiber optic pH sensor utilizing rGO-Pani nanocomposite prepared by in situ method

Reduced graphene oxide-polyaniline (rGO-Pani) nanocomposite based highly sensitive fiber optic pH sensor utilizing SPR technique is fabricated and characterized. The rGO-Pani nanocomposite is successfully synthesized using in-situ method. The sensing probe is fabricated by coating a thin film of silver over the unclad core of the optical fiber which is further coated by a film of rGO-Pani nanocomposite. The preparation of rGO, Pani and rGO-Pani nanocomposite are confirmed using different characterization tools such as X-ray diffraction (XRD), Raman and Fourier-transform infrared spectroscopy (FTIR). The morphology of the rGO-Pani nanocomposite is characterized by Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM). The operating pH sensing range of the present sensor is checked by performing experiments on samples of pH lying from 2.4 to 11.35. The sensor's performance is excellent for low and high pH and it possesses the maximum sensitivity of 75.09 nm/pH at pH 11.35. The high sensitivity of the sensor is because of the change in the optical band gap of the rGO-Pani nanocomposite at the low and high pH values of the samples which is confirmed by using Tau plot. The sensor has many advantages such as compact size, low cost, high sensitivity, stability, repeatability and capability of remote sensing.

PH triggered green synthesized silver nanoparticles toward selective colorimetric detection of kanamycin and hazardous sulfide ions

The interaction among the biologically synthesized silver nanoparticles (AgNPs) and industrially useful antibiotic kanamycin or environmentally hazardous sulfide ions led to the development of a possible colorimetric sensor for the selective detection of kanamycin and sulfide ions. In this study, a facile green protocol toward the synthesis of silver nanoparticles (AgNPs) was established while Epigallocatechin gallate (EGCG) was used as reducing and stabilizing agents, for the first time. The as-synthesized nanoparticles were characterized by UV–visible spectroscopy, high resolution transmission electron microscopy (HR-TEM) and dynamic light scattering (DLS) techniques. Detection of kanamycin and sulfide ions was established based on the SPR technique. The yellow color of the AgNPs solution turned to reddish pink in the presence of kanamycin, accompanying the decrease in intensity of SPR band. In contrast, AgNPs solution turned to colorless upon the addition of sulfide ions. The sensitivity and selectivity of AgNPs toward other interference antibiotics/anions were studied. Moreover, the effect of the concentration of kanamycin and sulfide ions in the nanoparticle solution was investigated and the LOD (limit of detection) for kanamycin and sulfide ions were found to be 0.96 μM and 1.62 μM, respectively. The results indicate that the proposed technique is very efficient for the colorimetric detection of kanamycin and sulfide ions.

Neutralized chimeric DNA probe for detection of single nucleotide polymorphism on surface plasmon resonance biosensor

An implementation of neutralized chimeric DNA oligomer as a probe for sensitive detection of single nucleotide polymorphisms (SNPs) on a surface plasmon resonance imaging sensor is investigated. The chimeric DNA oligomer was synthesized in a conventional DNA synthesizer, containing neutral nucleotides with a methylated phosphate group. The secondary structures and melting points of the chimeric DNA fragment and its complexes with perfect-matched and single-mismatched complementary DNA molecules were examined by using circular dichroism and UV–vis spectroscopy in comparison with the native probe DNA counterpart. The results indicate that the chimeric DNA complexes can form a B-form structure and exhibit high thermostability. Moreover, the hybridization and discrimination efficiency of the chimeric probe DNA for the SNP genotyping were verified by using the SPRi sensor under different experimental conditions. The data reveal the effects of the ionic strength and operation temperature on the selectivity of the chimeric probe DNA for the SNP detection. The hybridization condition with a low ionic strength and high temperature allows the chimeric probe DNA distinguishing perfect-matched and single-mismatched target DNA molecules to the best extent, likely due to the reduced electrostatic repulsive force and presence of the additional methyl group on the backbone. Consequently, the direct and label-free detection with the SPR technique and neutralized chimeric probe DNA can be realized for the SNP genotyping by optimizing the operation condition and sequence design.

Plasmon resonance-enhanced internal reflection ellipsometry for the trace detection of mercuric ion

Mercuric ion in aqueous media is extremely toxic to the environment and organisms. Surface plasmon resonance-based optical sensors have been reported that can detect low concentrations as low as fg analytes per cm2 of the sensor surface. Moreover, the ellipsometry, which detects the changes in polarization states of reflected light from the sensor surface, can be combined with SPR technique to figure out the changes in dielectric media beneath the sensor surface. In this paper, this technique called as surface plasmon resonance-enhanced total internal reflection was used to make trace monitoring of mercuric ion in aqueous media. A protein and an aptamer-based biosensor were developed for this purpose. Bovine serum albumin and mercury-specific aptamer were immobilized on sensor chip via self-assembly routes. The limit of detection was 40.7 nM Hg2+ for protein sensor and 26 pM Hg2+ for anti-Hg aptamer-based sensor. The selectivity of the protein sensor was lower than anti-Hg aptamer sensor when Pb2+ ion was used as the competent ion.

A randomized trial and novel SPR technique identifies altered lipoprotein-LDL receptor binding as a mechanism underlying elevated LDL-cholesterol in APOE4s

At a population level APOE4 carriers (~25% Caucasians) are at higher risk of cardiovascular diseases. The penetrance of genotype is however variable and influenced by dietary fat composition, with the APOE4 allele associated with greater LDL-cholesterol elevation in response to saturated fatty acids (SFA). The etiology of this greater responsiveness is unknown. Here a novel surface plasmon resonance technique (SPR) is developed and used, along with hepatocyte (with the liver being the main organ modulating lipoprotein metabolism and plasma lipid levels) uptake studies to establish the impact of dietary fatty acid composition on, lipoprotein-LDL receptor (LDLR) binding, and hepatocyte uptake, according to APOE genotype status. In men prospectively recruited according to APOE genotype (APOE3/3 common genotype, or APOE3/E4), triglyceride-rich lipoproteins (TRLs) were isolated at fasting and 4–6 h following test meals rich in SFA, unsaturated fat and SFA with fish oil. In APOE4s a greater LDLR binding affinity of postprandial TRL after SFA, and lower LDL binding and hepatocyte internalization, provide mechanisms for the greater LDL-cholesterol raising effect. The SPR technique developed may be used for the future study of the impact of genotype, and physiological and behavioral variables on lipoprotein metabolism. Trial registration number NCT01522482.

Kinetic analysis of IgM monoclonal antibodies for determination of dengue sample concentration using SPR technique

ABSTRACTSurface plasmon resonance (SPR) sensing is recently emerging as a valuable technique for measuring the binding constants, association and dissociation rate constants, and stoichimetry for a binding interaction kinetics in a number of emerging biological areas. This technique can be applied to the study of immune system diseases in order to contribute to improved understanding and evaluation of binding parameters for a variety of interactions between antigens and antibodies biochemically and clinically. Since the binding constants determination of an anti-protein dengue antibody (Ab) to a protein dengue antigen (Ag) is mostly complicated, the SPR technique aids a determination of binding parameters directly for a variety of particular dengue Ag_Ab interactions in the real-time. The study highlights the doctrine of real-time dengue Ag_Ab interaction kinetics as well as to determine the binding parameters that is performed with SPR technique. In addition, this article presents a precise prediction as a reference curve for determination of dengue sample concentration.

Stereoselective innovative synthesis and biological evaluation of new real carba analogues of minimal epitope Manα(1,2)Man as DC-SIGN inhibitors

Stereoselectively synthesized real 1,2 pseudomannobiosides exhibit activities as DC-SIGN inhibitors by means of an SPR technique with potential applications as antiviral agents.