Specific DNA Binding Activity Research Articles

Characterization of the DNA Binding Domain of StbA, A Key Protein of A New Type of DNA Segregation System

Low-copy-number plasmids require sophisticated genetic devices to achieve efficient segregation of plasmid copies during cell division. Plasmid R388 uses a unique segregation mechanism, based on StbA, a small multifunctional protein. StbA is the key protein in a segregation system not involving a plasmid-encoded NTPase partner, it regulates the expression of several plasmid operons, and it is the main regulator of plasmid conjugation. The mechanisms by which StbA, together with the centromere-like sequence stbS, achieves segregation, is largely uncharacterized. To better understand the molecular basis of R388 segregation, we determined the crystal structure of the conserved N-terminal domain of StbA to 1.9 Å resolution. It folds into an HTH DNA-binding domain, structurally related to that of the PadR subfamily II of transcriptional regulators. StbA is organized in two domains. Its N-terminal domain carries the specific stbS DNA binding activity. A truncated version of StbA, deleted of its C-terminal domain, displays only partial activities in vivo, indicating that the non-conserved C-terminal domain is required for efficient segregation and subcellular plasmid positioning. The structure of StbA DNA-binding domain also provides some insight into how StbA monomers cooperate to repress transcription by binding to the stbDR and to form the segregation complex with stbS.

Inherited Human XY Sex Reversal and Gonadal Neoplasia Due to Enhanced Formation of Non-Specific Enhanceosomes by an Architectural Transcription Factor

The development of organisms is regulated by a fine-tuned gene-regulatory network, which is driven by transcription factors (TFs). In the embryogenesis, these TFs control diverse cell fates and final body plan. This is precisely regulated by a specific DNA-binding process and enhanceosome formation. A model is provided by testis determination in mammals, which is initiated by a Y-encoded architectural transcription factor, SRY. Mutations in SRY cause gonadal dysgenesis leading to various developmental defects. Such mutations cluster in SRY’s high mobility group (HMG) box, a sequence-specific DNA-binding domain shared by a conserved family of TFs. Here, we have characterized several mutations at the same position in HMG box, which are compatible with either male or female phenotypes as observed in an XY father and XY daughter, respectively. These mutations, at a function-unknown motif in the SRY HMG box, markedly disturb the specific DNA affinity. On transient transfection of human and rodent cell lines, the SRY variants exhibit decreased specific DNA-binding activity (relative to wild type) are associated with mis-formed enhanceosomes. The variants’ gene regulatory activities were reduced by 2-fold relative to wild-type SRY at similar levels of mRNA expression. When engineered mutations that functions to increase the DNA-binding specificity were deployed to SRY variants, the transcriptional activity was in association with restored occupancy of sex-specific enhancer elements in principal downstream gene Sox9. Our findings define a novel mechanism of impaired organogenesis, disturbed specific DNA-binding activity of a master transcription factor, leading to a developmental decision poised at the edge of ambiguity.

The involvement of toll-like receptors 2 and 4 in human platelet signalling pathways

In addition to haemostasis, platelets play an essential role in mechanisms of inflammation and in immunological reactions. Platelets express various toll-like receptors (TLR) on their surface, among them TLR2 and TLR4, which are important for the recognition of bacterial patterns. This study compared TLR2- and TLR4-dependent platelet signalling and their effect on platelet function.Platelet-rich-plasma and washed platelets were prepared from peripheral blood samples of healthy donors. Pam3CSK4 or LPS (lipopolysaccharides from Escherichia coli) were used for stimulation of TLR2 and TLR4. Intracellular signalling pathways were investigated by Western blot. TLR2- and TLR4-mediated specific transcription factor DNA binding activity was measured by the nuclear factor kappa B (NFκB) transcription factor assay kit. Platelet adhesion and glycoprotein Ib function were assessed by immunofluorescence staining and analysis of ristocetin-induced agglutination.Both, Pam3CSK4 and LPS were able to induce NFκB-mediated and classical activating platelet signalling with a higher stimulatory capacity of TLR2. In addition, TLR2 and TLR4 activation led to a similar activation of inhibitory pathways. In contrast to TLR2, stimulation of TLR4 resulted in decreased Akt/protein kinase B phosphorylation conditioned by enhanced protein phosphatase 2A activity. TLR4-mediated signalling induced platelet adhesion and facilitated ristocetin-induced platelet agglutination.In conclusion, Pam3CSK4 directly induces aggregation via classical activation cascades, whereas LPS enhances platelet adhesion and glycoprotein receptor Ib-dependent platelet agglutination.

The auxin response factor gene family in wheat (Triticum aestivum L.): Genome-wide identification, characterization and expression analyses in response to leaf rust

Auxin response factors (ARFs) are plant-specific transcription factors that bind explicitly to Auxin Response Elements and mediate downstream expression of auxin responsive genes involved at various stages of plant growth and development. This study identified 52 ARF genes located within the wheat genome. Based on phylogenetic analysis, the identified ARF proteins of wheat were classified into four classes (class I, II, III and IV). Synteny analysis revealed the orthologous relation with other monocots. The maximum numbers of predicted ARF genes were mapped on wheat chromosome 3B Ten conserved motifs of ARF was determined on all the identified sequences. Based on amino acid composition of the middle region of the ARF proteins, nine ARF proteins were transcription activators and the remaining were transcription repressors. The ARF genes of wheat contained 1–17 introns and deduced proteins of the genes having similar pattern of intron-exon distribution clustered within the same clade in the phylogenetic tree. TaARF1, TaARF4, TaARF7, TaARF34, TaARF39 were predicted to be targeted by the stress responsive miRNA Tae-miRNA160. The identified proteins were mostly localized within the nucleus and had sequence specific DNA binding activity. They were annotated in regulation of expression of early auxin responsive genes in auxin signaling pathway. Thirty-one TaARF proteins interacted and exhibited co-expressed regulation with other TaARF and Aux/IAA proteins. Increased expression of TaARF1 and TaARF23 at 120 h post inoculation (hpi) and 72 hpi in resistant and susceptible isolines respectively, specifies their roles in providing better resistance to the plant during leaf-rust infection.

Various strategies of effector accumulation to improve the efficiency of genome editing and derivative methodologies.

CRISPR-Cas9 is a sophisticated tool in which Cas9/sgRNA complexes bind to the programmed target sequences and induce DNA double-strand breaks (DSBs) enabling highly efficient genome editing. Moreover, when nuclease-inactive Cas9 (dCas9) is employed, its specific DNA-binding activity provides a variety of derivative technologies such as transcriptional activation/repression, epigenome editing, and chromosome visualization. In these derivative technologies, particular effector molecules are fused with dCas9 or recruited to the target site. However, there had been room for improvement, because both genome editing and derivative technologies require not only the DNA-binding tools but also the additional components for their efficient and flexible outcomes. For genome editing, DSB repair molecules and knock-in donor templates need to act at the DSB sites. Derivative technologies also require their various effector domains to be gathered onto the target sites. Recently, many groups have developed and utilized inventive platforms to accumulate these additional components to the target sequence by modifying Cas9 protein and/or sgRNA. Here, we summarize the strategies of CRISPR-based effector accumulation and the improved methodologies using these creative platforms.

Global Regulatory Roles of the Histidine-Responsive Transcriptional Repressor HutC in Pseudomonas fluorescens SBW25.

HutC is known as a transcriptional repressor specific for histidine utilization (hut) genes in Gram-negative bacteria, including Pseudomonas fluorescens SBW25. However, its precise mode of protein-DNA interactions hasn't been examined with purified HutC proteins. Here, we performed electrophoretic mobility shift assay (EMSA) and DNase I footprinting using His6-tagged HutC and biotin-labeled probe of the hut promoter (PhutU). Results revealed a complex pattern of HutC oligomerization, and the specific protein-DNA interaction is disrupted by urocanate, a histidine derivative, in a concentration-dependent manner. Next, we searched for putative HutC-binding sites in the SBW25 genome. This led to the identification of 143 candidate targets with a P value less than 10-4 HutC interaction with eight selected candidate sites was subsequently confirmed by EMSA analysis, including the type IV pilus assembly protein PilZ, phospholipase C (PlcC) for phosphatidylcholine hydrolyzation, and key regulators of cellular nitrogen metabolism (NtrBC and GlnE). Finally, an isogenic hutC deletion mutant was subjected to transcriptome sequencing (RNA-seq) analysis and phenotypic characterization. When bacteria were grown on succinate and histidine, hutC deletion caused upregulation of 794 genes and downregulation of 525 genes at a P value of <0.05 with a fold change cutoff of 2.0. The hutC mutant displayed an enhanced spreading motility and pyoverdine production in laboratory media, in addition to the previously reported growth defect on the surfaces of plants. Together, our data indicate that HutC plays global regulatory roles beyond histidine catabolism through low-affinity binding with operator sites located outside the hut locus.IMPORTANCE HutC in Pseudomonas is a representative member of the GntR/HutC family of transcriptional regulators, which possess a N-terminal winged helix-turn-helix (wHTH) DNA-binding domain and a C-terminal substrate-binding domain. HutC is generally known to repress expression of histidine utilization (hut) genes through binding to the PhutU promoter with urocanate (the first intermediate of the histidine degradation pathway) as the direct inducer. Here, we first describe the detailed molecular interactions between HutC and its PhutU target site in a plant growth-promoting bacterium, P. fluorescens SBW25, and further show that HutC possesses specific DNA-binding activities with many targets in the SBW25 genome. Subsequent RNA-seq analysis and phenotypic assays revealed an unexpected global regulatory role of HutC for successful bacterial colonization in planta.

Functional characterization of a WRKY family gene involved in somatic embryogenesis in Panax ginseng

As a perennial herbaceous species, Panax ginseng is widely cultivated and used as traditional herbal medicine. The root of Panax ginseng commonly remains expensive as conventional breeding of Panax ginseng is difficult. Somatic embryogenesis (S.E.) is a useful tool for plant propagation and optimal model for understanding the mechanisms of plant embryogenesis. In Panax ginseng, increasing studies have been widely performed to optimize the technology of S.E., while the underlying mechanism remains unclear. In this paper, we cloned and identified a WRKY family gene named PgWRKY6 which is upregulated in response to 2,4-D (2,4-dichlorophenoxyacetic acid)-induced embryogenic callus development. The silencing of PgWRKY6 obviously reduces the induction rate of embryogenic callus, indicating its crucial role in S.E. of Panax ginseng hairy root. The expressions of several ROS-scavenging genes are also inducible during embryogenic callus development, and the transcriptions of PgGST, PgAPX1, and PgSOD are demonstrated to be regulated by PgWRKY6. Recombinant PgWRKY6, an approximate 40-KDa protein purified from Escherichia coli, shows a specific DNA-binding activity with a potential recognition site of TTGAC(C/T). This work demonstrated that as a conserved WRKY family transcription factor, PgWRKY6 functions upstream of PgGST, PgAPX1, and PgSOD, and potentially mediated auxins -ROS signaling pathway in the process of S.E. in Panax species.

PO-101 P53 core domain activity at low PH

IntroductionThe wild-type p53 is a nuclear tumour suppressor whose DNA binding function is critical for protection against cancer. The major role of p53 in normal cells is to induce cell cycle arrest or apoptosis in response cellular stress, particularly DNA damage. The region responsible for DNA interaction is located in its core domain (p53C). The specific DNA binding activity of p53 is crucial for its tumour suppression function. Missense mutations in the p53 gene are the most frequent type of gene-specific alterations in human cancer. These oncogenic mutant forms of p53 are deficient for specific DNA binding.Material and methodsDNA binding affinities of the p53C with either poly(GC) DNA or consensus DNA (5’ TTTCCTAGACATGCCTAATTA 3’) at low pH were monitored by anisotropy and intrinsic fluorescence, circular dichroism (CD), EMSA (Electrophoretic mobility shift assay) and isothermal titration calorimetry (ITC). HSQC and 1D- NMR (Nuclear magnetic resonance) measurements were carried out to observe the effect of pH on p53 structure.Results and discussionsOur results provided evidence that the specificity and stability of p53 protein:DNA complexes are influenced by pH. We describe the interaction of DNA and p53 at several pH (5.0, 5.5, 6.0, 6.5, 7.2) using fluorescence anisotropy. We confirm the formation of p53C:DNA complex under the same conditions by EMSA and ITC. Comparison of 1D and HSQC spectrum indicates structural changes in the presence of DNA when subjected at 7.2 or 6.0 pH. Far-UV CD shows that the secondary structure of p53 is maintained in the presence of specific (consensus) or unspecific (poliGC) DNA sequences in most studied pH, except at 5.0 pH. To verify the stability of p53:DNA complex at 5.0 pH, we use high pressure. This tool promote a greater effect on the p53 in the absence of DNA when compared with effect caused in the protein:DNA complex.ConclusionAltogether, these data support the hypothesis that the activity of p53 is maintained even after the acidification suggesting the pH change may have implications on cancer patology.

SbbR/SbbA, an Important ArpA/AfsA-Like System, Regulates Milbemycin Production in Streptomyces bingchenggensis.

Milbemycins, a group of 16-membered macrolide antibiotics, are used widely as insecticides and anthelmintics. Previously, a limited understanding of the transcriptional regulation of milbemycin biosynthesis has hampered efforts to enhance antibiotic production by engineering of regulatory genes. Here, a novel ArpA/AfsA-type system, SbbR/SbbA (SBI_08928/SBI_08929), has been identified to be involved in regulating milbemycin biosynthesis in the industrial strain S. bingchenggensis BC04. Inactivation of sbbR in BC04 resulted in markedly decreased production of milbemycin, while deletion of sbbA enhanced milbemycin production. Electrophoresis mobility shift assays (EMSAs) and DNase I footprinting studies showed that SbbR has a specific DNA-binding activity for the promoters of milR (the cluster-situated activator gene for milbemycin production) and the bidirectionally organized genes sbbR and sbbA. Transcriptional analysis suggested that SbbR directly activates the transcription of milR, while represses its own transcription and that of sbbA. Moreover, 11 novel targets of SbbR were additionally found, including seven regulatory genes located in secondary metabolite biosynthetic gene clusters (e.g., sbi_08420, sbi_08432, sbi_09158, sbi_00827, sbi_01376, sbi_09325, and sig24sbh) and four well-known global regulatory genes (e.g., glnRsbh, wblAsbh, atrAsbh, and mtrA/Bsbh). These data suggest that SbbR is not only a direct activator of milbemycin production, but also a pleiotropic regulator that controls the expression of other cluster-situated regulatory genes and global regulatory genes. Overall, this study reveals the upper-layer regulatory system that controls milbemycin biosynthesis, which will not only expand our understanding of the complex regulation in milbemycin biosynthesis, but also provide a basis for an approach to improve milbemycin production via genetic manipulation of SbbR/SbbA system.

Characterization of PAX9 variant P20L identified in a Japanese family with tooth agenesis.

Transcription factors PAX9 and MSX1 play crucial roles in the development of permanent teeth at the bud stage, and their loss-of-function variants have been associated with congenital tooth agenesis. We sequenced the coding regions of the PAX9 and MSX1 genes from nine patients with non-syndromic tooth agenesis, and identified a missense mutation, P20L, of PAX9 in a single familial case involving three patients in two generations. Identical mutation was previously reported by other authors, but has not been characterized in detail. The mutation was located in a highly conserved N-terminal subdomain of the paired domain and co-segregated as a heterozygote with tooth agenesis. The patients showed defects primarily in the first and second molars, which is typical for cases attributable to PAX9 mutation. Luciferase reporter assay using the 2.3-kb promoter region of BMP4 and electrophoretic mobility shift assay using the CD19-2(A-ins) sequence revealed that P20L substitution eliminated most of the transactivation activity and specific DNA binding activity of PAX9 under the experimental conditions we employed, while some residual activity of the mutant was evident in the former assay. The hypomorphic nature of the variant may explain the relatively mild phenotype in this case, as compared with other PAX9 pathogenic variants such as R26W.

An Infectious Disease–Associated Il12b Polymorphism Regulates IL-12/23 p40 Transcription Involving Poly(ADP-Ribose) Polymerase 1

IL-12 and IL-23 are important host defense factors produced by APCs against certain intracellular and extracellular pathogens. Their dysregulation has also been implicated in several autoimmune diseases. The nucleotide polymorphism in the promoter region of Il12b (rs41292470 consisting of the long or short allele) encoding the shared subunit of IL-12 and IL-23, p40, has been reported to associate with susceptibility to infectious diseases and autoimmune disorders. How these genetic variants impact Il12b expression at the molecular level was unclear. We established an Il12b promoter-luciferase reporter system containing the long or short allele driving the reporter gene expression and found that the long allele (infection-resistant) displayed ∼2-fold higher transcriptional activity than the short allele (infection-susceptible), associated with a selective and differential nuclear binding activity to the two alleles in activated macrophages. DNA pull-down assays coupled with mass spectrometry analyses identified the specific DNA binding activity as poly(ADP-ribose) polymerase 1 (PARP-1). Small hairpin RNA-mediated knockdown of the endogenous PARP-1 expression resulted in reduced p40 mRNA expression and Il12b promoter activity. Bone marrow-derived macrophages from PARP-1-deficient mice had decreased p40 expression at both mRNA and protein levels. Furthermore, selective PARP-1 inhibitors resulted in impaired production of IL-12p40 and IL-23 in bone-marrow derived macrophages and PBMCs. Chromatin immunoprecipitation assay revealed that PARP-1 could bind specifically to Il12b in LPS-stimulated macrophages. Our study opens the way for further elucidating the molecular mechanism whereby allele-specific immune responses to foreign and self-antigens mediated by IL-12/IL-23 are controlled in an individually variable manner.

Activation of PI3K in response to high glucose leads to regulation of SOCS-3 and STAT1/3 signals and induction of glomerular mesangial extracellular matrix formation.

Excessive deposition of extracellular matrix (ECM) in the glomerulus contributed by mesangial cells is the hallmark of diabetic nephropathy, eventually leading to glomerulosclerosis. In this study, we examined the regulatory signals involved in the high glucose (HG)-induced overproduction of ECM in rat mesangial cells (RMCs). We disclosed excessive fibronectin and collagen IV production, tyrosine phosphorylation of signal transducer and activator of transcription 1 and 3 (STAT1/3), and up-regulation of suppressor of cytokine signaling-3 (SOCS-3) expression in HG-treated RMCs. STAT1/STAT3 binding element was essential for SOCS-3 promoter activity stimulated by HG. HG was capable of promoting the specific DNA binding activities to an oligonucleotide probe containing the SOCS-3 sequence. The selective phosphoinositide 3-kinase (PI3K) inhibitor LY294002 and dominant negative p85 vector (DNΔp85) transfection effectively abolished these HG-induced responses. Moreover, HG markedly increased the cyclin kinase inhibitor p27Kip1 protein expression, which could be inhibited by LY294002 or transfection of DNΔp85. Taken together, these results suggest that HG-induced SOCS-3 upregulation depends upon the presence of STAT-binding element in the SOCS-3 promoter, which is specifically activated by STAT1/3. The PI3K/STAT1/3 signaling pathway mediated HG-triggered ECM accumulation and SOCS-3 upregulation in RMCs.

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2G73E proteins) as a biological example.

P.1.004 Novel neurotrophic strategy: interrogation of intracellular molecules regulating growth of midbrain dopaminergic neurons

Transcriptional downregulation of E-cadherin appears to be an important event in the progression of various epithelial tumors. SIP1 (ZEB-2) is a Smad-interacting, multi-zinc finger protein that shows specific DNA binding activity. Here, we report that expression of wild-type but not of mutated SIP1 downregulates mammalian E-cadherin transcription via binding to both conserved E2 boxes of the minimal E-cadherin promoter. SIP1 and Snail bind to partly overlapping promoter sequences and showed similar silencing effects. SIP1 can be induced by TGF-β treatment and shows high expression in several E-cadherin-negative human carcinoma cell lines. Conditional expression of SIP1 in E-cadherin-positive MDCK cells abrogates E-cadherin-mediated intercellular adhesion and simultaneously induces invasion. SIP1 therefore appears to be a promoter of invasion in malignant epithelial tumors.

DNA-binding protein phosphatase AtDBP1 acts as a promoter of flowering in Arabidopsis.

We provide evidence that AtDBP1 promotes flowering by regulating the transcript levels of several important integrators and floral meristem identity genes, including FLC, CO, SOC1, LFY, FT and FD. DNA-binding protein phosphatases (DBP) which exhibit both sequence specific DNA-binding and protein phosphatase 2C activities are important regulators that are involved in both the transcriptional and post-translational regulations. DBP factors are known to mediate susceptibility to potyviruses; however, whether they are involved in other processes is still unclear. In this study, under both long day (LD) and short day conditions, AtDBP1 overexpressing plants displayed early flowering, while the knock out mutants, atdbp1, exhibited a delay in flowering relative to the wild-type plants; both the overexpressing lines and atdbp1 mutants remained photoperiodic sensitive, indicating that AtDBP1 was involved in the autonomous pathway. AtDBP1 does not respond to vernalization at transcript level, and both AtDBP1 overexpressing plants and atdbp1 mutants remain responsive to vernalization, indicating that AtDBP1 may not be directly involved in vernalization. Real-time PCR analysis showed that AtDBP1 can suppress FLOWERING LOCUC C (FLC) expression, a key integrator of the autonomous and vernalization pathways, and enhance the expression levels of CONSTANS and FLOWERING LOCUC T, key regulators of the LD pathway. Furthermore, expression of floral meristem identity genes including SUPPRESSOR OF OVEREXPRESSION OF CO 1, LEAFY and FD was also promoted in AtDBP1 overexpressing plants. AtDBP1 transcription can be detected in root, leaf, stem, flower and silique. AtDBP1-GFP and YFP-AtDBP1 fusion protein were localized in the cytosol and nucleus. Our results provide the evidence demonstrating the effective role of AtDBP1 for flowering time regulation and report a novel function of DBP factors in planta besides in plant defense.

The polyglutamine-expanded androgen receptor has increased DNA binding and reduced transcriptional activity

Expansion of a polyglutamine-encoding trinucleotide CAG repeat in the androgen receptor (AR) to more than 37 repeats is responsible for the X-linked neuromuscular disease spinal and bulbar muscular atrophy (SBMA). Here we evaluated the effect of polyglutamine length on AR function in Xenopus oocytes. This allowed us to correlate the nuclear AR concentration to its capacity for specific DNA binding and transcription activation in vivo. AR variants with polyglutamine tracts containing either 25 or 64 residues were expressed in Xenopus oocytes by cytoplasmic injection of the corresponding mRNAs. The intranuclear AR concentration was monitored in isolated nuclei and related to specific DNA binding as well as transcriptional induction from the hormone response element in the mouse mammary tumor virus (MMTV) promoter. The expanded AR with 64 glutamines had increased capacity for specific DNA binding and a reduced capacity for transcriptional induction as related to its DNA binding activity. The possible mechanism behind these polyglutamine-induced alterations in AR function is discussed.

Bipartite recognition of DNA by TCF/Pangolin is remarkably flexible and contributes to transcriptional responsiveness and tissue specificity of wingless signaling.

The T-cell factor (TCF) family of transcription factors are major mediators of Wnt/β-catenin signaling in metazoans. All TCFs contain a High Mobility Group (HMG) domain that possesses specific DNA binding activity. In addition, many TCFs contain a second DNA binding domain, the C-clamp, which binds to DNA motifs referred to as Helper sites. While HMG and Helper sites are both important for the activation of several Wnt dependent cis-regulatory modules (W-CRMs), the rules of what constitutes a functional HMG-Helper site pair are unknown. In this report, we employed a combination of in vitro binding, reporter gene analysis and bioinformatics to address this question, using the Drosophila family member TCF/Pangolin (TCF/Pan) as a model. We found that while there were constraints for the orientation and spacing of HMG-Helper pairs, the presence of a Helper site near a HMG site in any orientation increased binding and transcriptional response, with some orientations displaying tissue-specific patterns. We found that altering an HMG-Helper site pair from a sub-optimal to optimal orientation/spacing dramatically increased the responsiveness of a W-CRM in several fly tissues. In addition, we used the knowledge gained to bioinformatically identify two novel W-CRMs, one that was activated by Wnt/β-catenin signaling in the prothoracic gland, a tissue not previously connected to this pathway. In sum, this work extends the importance of Helper sites in fly W-CRMs and suggests that the type of HMG-Helper pair is a major factor in setting the threshold for Wnt activation and tissue-responsiveness.

WblAch, a pivotal activator of natamycin biosynthesis and morphological differentiation in Streptomyces chattanoogensis L10, is positively regulated by AdpAch.

Detailed mechanisms of WhiB-like (Wbl) proteins involved in antibiotic biosynthesis and morphological differentiation are poorly understood. Here, we characterize the role of WblAch, a Streptomyces chattanoogensis L10 protein belonging to this superfamily. Based on DNA microarray data and verified by real-time quantitative PCR (qRT-PCR), the expression of wblAch was shown to be positively regulated by AdpAch. Gel retardation assays and DNase I footprinting experiments showed that AdpAch has specific DNA-binding activity for the promoter region of wblAch. Gene disruption and genetic complementation revealed that WblAch acts in a positive manner to regulate natamycin production. When wblAch was overexpressed in the wild-type strain, the natamycin yield was increased by ∼30%. This provides a strategy to generate improved strains for natamycin production. Moreover, transcriptional analysis showed that the expression levels of whi genes (including whiA, whiB, whiH, and whiI) were severely depressed in the ΔwblAch mutant, suggesting that WblAch plays a part in morphological differentiation by influencing the expression of the whi genes.

Transcriptome analysis of integument differentially expressed genes in the pigment mutant (quail) during molting of silkworm, Bombyx mori.

In the silkworm Bombyx mori, pigment mutants with diverse body colors have been maintained throughout domestication for about 5000 years. The silkworm larval body color is formed through the mutual interaction of melanin, ommochromes, pteridines and uric acid. These pigments/compounds are synthesized by the cooperative action of various genes and enzymes. Previous reports showed that melanin, ommochrome and pteridine are increased in silkworm quail (q) mutants. To understand the pigment increase and alterations in pigment synthesis in q mutant, transcriptome profiles of the silkworm integument were investigated at 16 h after head capsule slippage in the fourth molt in q mutants and wild-type (Dazao). Compared to the wild-type, 1161 genes were differentially expressed in the q mutant. Of these modulated genes, 62.4% (725 genes) were upregulated and 37.6% (436 genes) were downregulated in the q mutant. The molecular function of differently expressed genes was analyzed by Blast2GO. The results showed that upregulated genes were mainly involved in protein binding, small molecule binding, transferase activity, nucleic acid binding, specific DNA-binding transcription factor activity and chromatin binding, while exclusively down-expressed genes functioned in oxidoreductase activity, cofactor binding, tetrapyrrole binding, peroxidase activity and pigment binding. We focused on genes related to melanin, pteridine and ommochrome biosynthesis; transport of uric acid; and juvenile hormone metabolism because of their importance in integument coloration during molting. This study identified differently expressed genes implicated in silkworm integument formation and pigmentation using silkworm q mutant. The results estimated the number and types of genes that drive new integument formation.

Structure-Function Analysis of the C-clamp of TCF/Pangolin in Wnt/ß-catenin Signaling

The evolutionarily conserved Wnt/ß-catenin (Wnt/ß-cat) pathway plays an important role in animal development in metazoans. Many Wnt targets are regulated by members of the TCF/LEF1 (TCF) family of transcription factors. All TCFs contain a High Mobility Group (HMG) domain that bind specific DNA sequences. Invertebrate TCFs and some vertebrate TCF isoforms also contain another domain, called the C-clamp, which allows TCFs to recognize an additional DNA motif known as the Helper site. While the C-clamp has been shown to be important for regulating several Wnt reporter genes in cell culture, its physiological role in regulating Wnt targets is less clear. In addition, little is known about this domain, except that two of the four conserved cysteines are functionally important. Here, we carried out a systematic mutagenesis and functional analysis of the C-clamp from the Drosophila TCF/Pangolin (TCF/Pan) protein. We found that the C-clamp is a zinc-binding domain that is sufficient for binding to the Helper site. In addition to this DNA-binding activity, the C-clamp also inhibits the HMG domain from binding its cognate DNA site. Point mutations were identified that specifically affected DNA-binding or reduced the inhibitory effect. These mutants were characterized in TCF/Pan rescue assays. The specific DNA-binding activity of the C-clamp was essential for TCF/Pan function in cell culture and in patterning the embryonic epidermis of Drosophila, demonstrating the importance of this C-clamp activity in regulating Wnt target gene expression. In contrast, the inhibitory mutation had a subtle effect in cell culture and no effect on TCF/Pan activity in embryos. These results provide important information about the functional domains of the C-clamp, and highlight its importance for Wnt/ß-cat signaling in Drosophila.