Southwestern Part Of Nigeria Research Articles

Evaluation of Standard Times for Some Local Blacksmith’s Products

The practice of menial farming in the southwestern part of Nigeria have necessitated the need for the blacksmith industry to produce farm implements for the need of their immediate environment (farmers). With increased cost and time of production, coupled with demand size, reduced productivity and in order to meet the customer’s schedule, the study was conceived to evaluate the standard time to start and finish a product to manage production time and to estimate the optimum production capacity of the blacksmith workstation. After a careful survey of the local blacksmiths and with the aid of a stopwatch and study time chart, standard time was evaluated for harvester, digger and axe. These implements are the most commonly used items by the locals. The standard time for the local blacksmith’s axe, digger and harvester production was estimated to be 1458.35, 1931.44 and 936.66 Seconds respectively. It can therefore be concluded that the blacksmiths working for 8 hours a day will produce either (i) about 20 units of axe per day, (ii) 15 units of digger per day, or (iii) 31 units of harvester per day, or (iv) 7 units each, of the products per day

Velocity Anisotropy: Temperature Effect on Thomson’s Parameter of Ogun Shale, Ogun State, Nigeria

When a rock’s physical property is directional or orientation-dependent, the rock is described as being anisotropic. Shale is a common sedimentary rock with inherent anisotropic nature gotten from its geological evolution. Thus in studying the elastic properties of shale, the direction of the wave propagation has to be considered and reported. Velocity anisotropy of shale with temperature effect on the Thomson’s anisotropic parameters was carried out on shales from Ogun state in the southwestern part of Nigeria. Ultrasonic velocity measurement was carried out at temperatures ranging between 50 and 300 ˚C. Elastic properties, as well as the anisotropic parameters were determined. The parameters were compared with the temperature and elastic properties of the samples. Results showed that Ogun state shales are anisotropic and that both P and S wave pulses exhibited higher values in the horizontal direction (along the bedding plane) than in the vertical orientation (normal to the bedding plane) of the samples. Elastic modulus was higher in the horizontal direction while the Poisson’s ratio and velocity ratio were higher in the vertical plane. Anisotropic parameters, gamma (ϒ) and epsilon (Ԑ) exhibited value reduction up to about 150 ˚C when they started to increase with increasing temperature. Gamma however increased more notably than the epsilon. This result indicated that fractures and microcracks within the shale samples closed up as the samples expanded due to temperature increase.

Palynological study of some Afowo bituminous sediments in parts of Southwestern Nigeria

The tar sand and shale sequences of the Afowo Formation exposed at Lore, Shagbon, and Gbegude areas in parts of southwestern Nigeria has been palynologically investigated to unravel the depositional history. The lithofacies assemblage of the studied section comprising of shale, siltstone, claystone, lignites and ferruginised facies and their peculiar sedimentological features indicate low energy quiet setting, ranging from fresh water to nearshore marine swamps. Recovered palynomorph assemblage include marine dinoflagellate cyst such as Paleocystodinium golzowenses, Lycopodium spp. of Maastrichtian age. The pollen and spore (Retidiporites magdalenensis, Echimonocolpites, Echitriporites trianguliformis and C-cristatus) indicate terrestrial fresh water environment. The abundance of palmea pollen (Echitriporites and Longapertites) and the pteridophyte suggest that the vegetation developed under a predominant humid climate.

Investigatory study on the qualities of locally grown Rice brands sold in main markets of Abeokuta, South-Western Nigeria

Qualities of some selected rice varieties sold in the main markets of Abeokuta, the capital of Ogun State where rice is mostly grown and consumed in the south-western part of Nigeria was investigated. Rice (Aroso, Mokwa, Royal niger, Orlam and Ofada rice) were evaluated for their physical, chemical properties and sensory qualities using established laboratory procedures. The average width of the rice ranged from “0.261 to 0.268 mm”, “0.260 to 0.265 mm, “0.260 to 0.262 mm”, “0.269 to 0.270 mm”, and 0.271 to 0.275 mm” respectively. The rice average lengths ranged between “0.346 to 0.350 mm”, “0.365 to 0.368 mm”, “0.356 to 0.359 mm”, “0.357 to 0.357 mm” and “0.365 to 0.379 mm” respectively. The physical appearance of the rice investigated ranged from good to very good except for mokwa and orlam rice which shows fair colours. Chemical properties of the rice samples ranged from 10.21 to 11.97%, 0.83 to 2.62, 1.89 to 2.16%, 0.24 to 0.37%, 5.50 to 7.56%, 77.89 to 79.60%, 59.90 to 65.17%, 12.15 to 14.61% and 85.39 to 87.85% for moisture, total ash, fat, crude fibre, crude protein, carbohydrate, starch, amylose and amylopectin contents respectively. The cooking properties ranged from 2 to 7.5, 230 to 250% and 5.49 to 5.64 in length and 0.689 to 1.337mm for volume expansion ratio, water uptake and elongation ratio respectively. This study revealed that Aroso and Orlam rice were of excellent in physical, chemical, sensory qualities and are both recommended for consumption. This research finding serves as a basis of choice for consumers and it also reveals the areas for improvement in terms of qualities of the local rice investigated.

IS BISPHENOL A (BPA) A PUBLIC HEALTH CONCERN? A CROSS-SECTIONAL STUDY OF PUBLIC KNOWLEDGE, ATTITUDE AND RISK PERCEPTION IN SOUTHWESTERN PART OF NIGERIA

Bisphenol A (BPA) is a chemical produced in large quantities for use primarily in the production of polycarbonate plastics and epoxy resins. Exposure to BPA is a public health concern because studies since the last decade have consistently linked BPA with several physiological disorders such as cardiovascular diseases, neurological, obesity, and some forms of cancers. Hence, this study assessed the level of BPA knowledge and awareness among randomly selected individuals in the Southwestern part of Nigeria. This study employed a mixed-methods approach, utilizing a survey specifically designed to collect data for the research. Different statistical methods were utilized including descriptive and inferential to analyze the data and to assess exploratory variables such as public knowledge, attitude, and risk perception. Findings revealed that though 96.2 % knew chemicals in plastics could cause adverse health effects, the level of knowledge on BPA and its attendant health risks among the sample population was abysmally low (only 35% knew this subject). However, most of our respondents interestingly expressed great attitude in terms of willingness to share information learned about BPA to others in the community. Based on the findings of this study, a massive awareness campaign about BPA and associated health risks would be required through effective scientific communication to improve public health outcomes.

Contributory Pension Scheme and Welfare of Retirees: A case of Tertiary Institutions of Education in Southwestern Nigeria

The study investigated the effect of the Contributory Pension Scheme (CPS) on the welfare of retirees of tertiary institutions of education in the Southwestern zone of Nigeria. Using the Taro Yamane formula and a multi-level sampling technique, a sample size of 125 retirees was obtained from three tertiary institutions of education in the Southwestern part of Nigeria as follows: Osun State College of Education, Ilesa (41), Lagos State University of Education, Lagos (36) and Adeyemi College of Education, Ondo (48). The main instrument of data collection was a set of questionnaire which was administered to the retirees to collect relevant data. The instrument was validated and its reliability coefficient calculated to be 0.82 using the Cronbach Alpha formula. The data collected was analysed using the Chi-square and the one-sample t-test statistics. The results showed that the contributory pension scheme did not have significant effect on the welfare of the retirees (t = .207, p < 0.05). Useful recommendations were made based on this finding.

Geothermal resource potentials estimation from the interpretation of aeromagnetic data over parts of Southwestern Nigeria

In a bid to explore unconventional electricity generation sources and reduce effects of fossil fuels, this study evaluates geothermal resource potentials over parts of Southwestern Nigeria, precisely depth to the bottom of magnetic source (DBMS), heat flow, geothermal gradient and their relationships. Regional-residual anomaly separation was conducted, and spectral analysis was applied on the residual anomaly component of 14 aeromagnetic data sheets. Depth to the bottom of magnetic source varies between 1.87 and 6.26 km, with average value of 3.50 km, heat flow varies between 23.18 and 77.38 mWm−2, with average value of 43.79 mWm−2, while geothermal gradient varies between 9.27 and 30.95 oC/km with average value of 17.52 oC/km. Northcentral region has the highest heat flow (77.4 mWm−2), followed by Northeast (68.3 mWm−2), Southwest has the least (< 40.0 mWm−2) while Southeast has values in between the extremes. A comparison between the average heat flow and that of ‘thermally stable’ continental regions of the world (60 or 65) mW/m2 gives 72.98 or 67.37% respectively. The estimated heat is probably from mantle plumes, radioactive sources or heat generated from pressures within basements that are overlaid by thick thermally insulated sediments, hence hot magmatic fluid flows into fractured basement and cause hydrothermal alterations of surrounding rocks. Since most geodynamic operations depends on thermal structure of the earth’s crust, the result of this study has undoubtedly contributed significantly to the body of existing thermal knowledge and closed the information gap regarding crustal temperature distribution at depth in Southwest part of Nigeria and Nigeria in general.

Reliability Analysis of a Typical 33kV Distribution Network Using MATLAB (A Case Study of Ile-Oluji 33kV Distribution Line)

The significance of a dependable and sufficient electrical power supply in societal development cannot be overstated. The distribution of electrical power holds a crucial position in the power system chain, representing the final stage where it reaches consumers. At this phase, various types of losses, including technical loss and theft, among others are associated. The Ile-Oluji community is situated in Ondo State, a south-western part of Nigeria, A region which is host to federal, state, local and private institutions. This community grapples with inconsistent power supply experiencing intermittent trips without a clear originating cause from components in the Ile-Oluji injection substation and its feeder in Ondo. This study analyses the power distribution patterns in this locality focusing on three primary elements (transformer, switch gear and supply line) extracting data on; failures, outage time, numbers of customers and total hours for the year 2019 to 2022. Reliability indices were employed to assess its performance utilising the MATLAB software. Codes were crafted to extract these indices; Availability, Failure rates, Mean Time to Repair (MTTR), Mean Time Between failure (MTBF), System Average Interruption Duration Index (SAIDI), System Average Interruption Frequency Index (SAIFI), and Customer Average Interruption Duration Index (CAIDI). The results show that there is a strong relationship among the reliability indices. It is adduced that the lower the failure rate, the higher the availability of a system. It was concluded that the power system switchgear recorded the highest failure rate amongst the three elements with 0.037341 hrs/year followed by supply line with 0.022541 hrs/year and the transformer with 0.0148 hrs/year in 2022. In corollary, transformer has the highest availability of 0.94441 followed by supply line with 0.81681 and switchgear with 0.78004 in 2021, switchgear recorded the highest failure rates because it is responsible for executing both forced and planned outages.

Investigation of the Use of Drones by Construction Professionals in Addressing Built Environment Tasks

An unmanned aerial vehicle (UAV), also called a drone, has been gaining attention globally to solve different tasks. The aim of this study is to assess the awareness and level of adoption of these types of drones by building professionals and the factors limiting their use in the built environment. The study was carried out in Lagos State, in the southwestern part of Nigeria. Data for this research were collected from primary and secondary data sources. Primary data was obtained by administering a questionnaire to the selected building industry professionals, and the collected data were analyzed using both descriptive and inferential statistical techniques. The results showed that structure inspection and photography are the most rated features of drones in addressing built environment tasks, with a mean score (MS) of 4.50, and security surveillance (MS = 3.86) is the least important feature. The level of adoption of drones in addressing built environment tasks was assessed among the professionals, and the results showed that the practice of an emergency response plan and a health and safety plan to reduce the risk of harm and ensure safety on site is considered to be the most important task. The study found that the fixed-wing hybrid drone with an MS of 1.97 is the most commonly used drone type. Lastly, the study showed that lack of public awareness (MS = 4.81) is rated as the most significant factor that limits its use. Few professionals have practically used drones to solve tasks faced in the building industry. Thus, there is a need to further sensitize built environment professionals to the benefits associated with its wider adoption and applications. Also, the importance of drones and their associated managerial and practical implications in solving relevant built environment tasks can be initiated by deepening their relevance in the curriculum of building industry programs at the professional and academic levels.

Spectral analysis of aeromagnetic data over parts of Southwestern Nigeria

This study endeavors to assess spectral depths, explore Basement structure variability, and deduce geothermal heat distribution by determining Curie point depth (Zb) through aeromagnetic data analysis across 14 sheets in Southwestern Nigeria. The depths to the shallow magnetic source (Zt) range from 0.14286 km to 1.02632 km, indicating sediment thickness, with the deepest point situated in the Northwestern region and progressively shallower towards the central and Southern portions of the study area. Depths to the deeper magnetic source (Z0) span from 1.08333 km in the North-central part to 3.23529 km in the Southwestern part. The primary sources of the first layer (Zt) depth are intrusions/outcropping Basement rocks, while the second layer (Z0) results from the intrusion of magnetic rocks into the basement, intra-Basement fissures, and deeper magma intrusions below the bedrock. Curie point depth ranges from 1.87380 km to 6.25629 km, with the North-central region exhibiting the shallowest depths, followed by the Northeast, Northwest, and Southeast. Shallow Curie point depth is attributed to magma upwelling and magmatic intrusion in highly fractured quartzite units and older granite units, while deeper Curie point in the Southwestern part may result from isostatic compensation/recovery. Given that Curie point depths are shallower than 10 km, the study area holds geothermal resource potential, particularly in the North-central region. The correlation between estimated spectral depths from aeromagnetic data and observed geothermal signatures in the study area promises to be advantageous in the pursuit of alternative energy generation, potentially mitigating the effects of global warming.

PHYTOCHEMICAL AND ANTICONVULSANT SCREENING OF THREE MEDICINAL PLANTS USED IN THE TREATMENT OF EPILEPSY IN THE SOUTH-WESTERN PART OF NIGERIA

The burden of epilepsy in developing countries made medicinal plants like Xylopia aethiopica fruit; Khaya grandifoliola, Alstonia boonei etc an alternative source in epilepsy management in the south-western part of Nigeria. The aim of the study was to provide pharmacological rationale for the ethnomedicinal use of the plants in epilepsy management. The oral medial lethal dose of methanol stem bark extracts of Alstonia boonei (MEAB) and Khaya grandifoliola (MEKG) and methanol fruit extract of Xylopia aethiopica (MEXAF) were done in accordance with the Organization for Economic Cooperation Development guideline. Quantitative and qualitative phytochemical profiling of the extracts was done. Anticonvulsant screening was carried out on the extracts (doses: 75, 150 and 300 mg/kg) using the pentylenetetrazole (PTZ)-induced seizure and maximum electroshock tests (MEST). Results showed that the MEXAF has the highest amount of phytochemicals except for saponins in MEKG; and MEAB with the least amount (but higher alkaloid) than MEKG. The TLC showed different bands of spots of the extracts. In the PTZ test, MEXAF showed 100 % protection against mortality at 300 mg/kg; MEAB with 66.67 % protection at 75 mg/kg and MEKG 0 % protection. MEAB, MEKG and MEXAF nonsignificantly increased the onset of seizure and latency to death. In the MEST, MEXAF, MEKG and MEAB at 75 mg/kg protected 50, 33.3 and 16.67% of the animals against tonic hind limb extension respectively and nonsignificantly (p˃0.05) decreased recovery time except MEXAF which significantly (p<0.05) decreased the recovery time at a dose of 75 mg/kg. It was concluded that the extracts possess anticonvulsant activities hence, the pharmacological credence for the ethnomedicinal use of these plants in treating epilepsy.

Comparative Study on Phytochemical and Mineral Content of Three Leafy Vegetables Commonly Consumed in Selected Local Government Area of Ogun State, South Western Part of Nigeria (Launaea taraxacifolia, Conyza sumatrensis and Bidens pilosa)

Comparative Study on Phytochemical and Mineral Content of Three Leafy Vegetables Commonly Consumed in Selected Local Government Area of Ogun State, South Western Part of Nigeria (Launaea taraxacifolia, Conyza sumatrensis and Bidens pilosa)

Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.

Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility. The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria. This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria. The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old. Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation. Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles. Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer. The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A>T /T>A) 6 (6.6%), rs1382451565 (C>T) 5 (5.4%), and rs935520555 (G>C) 5 (5.4%), rs1479789045 (G/C>A/ A>G) 4 (4.3%), rs570570800 (C>T/ G>T) 3 (3.3%), rs1281533806 (C>A) 3 (3.3%), rs1434703461 (C>T/ G>T) 3 (3.3%), rs2069881018 (G>C) 3 (3.3%), rs549835830 (G>C) 2 (2.2%), rs2069880888( C>T ) 2 (2.2%), rs997110743 (G>C/C>G), rs1236501997 1 (1.1%), rs119399669 (C>T) 1 (1.1%), and rs1052575569 (G>A/C>A) 1 (1.1%). In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.

Towards Transformation of the Nigerian Youths: The Place of Yoruba Popular Music

Since the year 2012, West Africans, especially the Nigerian government and citizens have been witnessing an increase in civil crisis because of different crimes committed in African society and the involvement of the youths in these negative activities. Since music is said to have an emotional and psychological influence on human minds, this paper, therefore, examines the text content of and relevance of popular music in Nigerian society and highlights the role played by popular musicians as agents for positive transformation of the youths among the Southwestern part of Nigeria. Relying on Femi Adedeji’s Transformation musicological theory, this work explicates the song themes and other lyrical contents of selected popular music in the Yoruba language fashioned towards positive transformative direction, for the purpose of socio-cultural analysis. The research findings show that some Nigerian popular musicians have for over three decades, been making use of the message in their music to sustain the positive transformation of lives and behavior of people of Nigeria, especially the youths. The song lyrics by the old juju, fuji, apala, sakara, and Pop musicians are found to be more effective because of the Yoruba cultural concepts and moral values inherent in them. This essay concludes that music has an affective mechanism that positively influences the lives, personalities, and world-views of Nigerian youths in general if properly channeled towards a positive dimension. This paper concludes that the Nigerian government should use appropriate agencies like the National Film and Records Censor Board and Nigerian Copyright Council to prevent music that contains lyrics that can encourage violence and criminal acts circulated into Nigerian markets.

Effects of Relationship Marketing on Organizational Performance in The Nigerian Telecommunication Industry. A Case of Airtel Telecommunication Company in Nigeria

In the current business world, organizational performance depends on identifying, attracting, acquiring and maintaining customers in the highly intensive competitive environment. This study identifies how organizational performance can be enhanced through customer relationship marketing capabilities. Population of this research was Airtel Telecommunication Company in the South-western part of Nigeria. Population of this research consists mainly of customers of Airtel Telecommunication Company in the South-western part of Nigeria. The data collection was done through the distribution of online and offline questionnaires on organizational performance and competition intensity. Logistic regression analysis test was used for further analysis. Findings revealed that good relationship with their customers, help the organizations to enhance their profitability and get the competitive advantage in the market place. This paper will enable organizations (especially organizations in the telecommunications sector) to understand and use their customers relation marketing capabilities in a good way.

Effect of Forced Interest and Academic Discipline on Second Year Science Students’ Academic Performance in Colleges of Education, South-West, Nigeria

The study aimed at exploring the effect of forced interest on academic achievement of second year NCE students using academic discipline as a moderating variable. An expo-facto research design of a 2 X 3 factorial matrix was adopted for the study on a population of all second year (200 Level) science students in Colleges of Education in the south-western part of Nigeria. A total of purposively and randomly selected 248 students from six Colleges of Education took part in the study while a self-designed questionnaire tagged Forced Interest and Academic Discipline Questionnaire (FIADQ) was the main instrument used for data collection. Data collected were analysed with ANCOVA and Scheffe Post-hoc statistical tools. Finding of the study reported a no significant main effect of forced interest on the academic achievement of students while there was a significant main effect of academic discipline on academic achievement of second year NCE students. Students of Biology discipline performed significantly better than their counterparts in Physics. Physics discipline recorded the lowest GPA. Based on this finding, it is recommended among others that Nigerian Ministry of Education should come up with a policy that irrespective of students’ first choice, any other available relevant course should be given to them provided they cannot be offered admission with their courses of first choice.

Physicians’ Response on Haemophilia Care in South Western Nigeria

Introduction: Haemophilia is a rare inherited bleeding disorder that affects predominantly male because it is an X chromosome linked disorder. The severity of the disease is determined by the percentage of Factors VIII and IX activity in the individuals with Haemophilia.
 Objective: The objective of this study was to determine the extent of haemophilia care in the southwestern part of Nigeria. This forms part of a nationwide survey in 2016, focusing especially on whether or not physicians in specific hospitals in the states in south west had ever managed a haemophiliac.
 Methods: A self-administered questionnaire titled “Survey on Haemophilia Care in Nigeria” was developed for physicians in order to assess their experience on Haemophilia care in Nigeria. The responses from the Doctors were entered into SPSS (version 23) using the Data Dictionary (on survey of haemophilia) coded table prepared along with the questionnaire.
 Results: The self-administered questionnaires were retrieved from 215 physicians in south west, Nigeria. Most of the respondents are from Oyo state, no respondent from both Osun and Ondo states. Also, about two-thirds of the respondents work in a teaching hospital, with majority having Bachelor of Medicine, Bachelor of Surgery (MBBS) as the highest qualification.
 Conclusion: The care of haemophiliacs in the south western part of Nigeria needs to be standardized as the study showed that most physicians have no contact with Haemophiliacs.

Morphological features and length-weight relationships of <i>Sarotherodon galilaeus</i> from Oyan Lake, Southwestern Nigeria

Oyan Lake is one of the major sources of fish protein supply to many parts of Southwestern Nigeria. Investigation was conducted on the biometrics, length-weight relationship and condition factor of Sarotherodon galilaeus in Oyan Lake. Fish samples were obtained from fishermen using gillnets, hook and line, cast nets and traps. One hundred and thirty samples of S. galilaeus were collected for the study, comprising eighty-three (83) males and forty-seven (47) females with sex ratio of 1:0.57 (male:female). The mean total lengths for combined sexes, males and females were 15.5±0.15, 15.7±0.19 and 15.3±0.26cm while the mean total weights were 81.0±2.78, 83.8±0.56 and 75.9±4.70g, respectively. No significant difference (p>0.05) was observed between mean total lengths of males and females. However, mean weight of males was significantly higher (p<0.05) than females. Mean eye diameter (EYD) and length of caudal peduncle (LCP) were significantly higher (p<0.05) in females. The range of number of pectoral rays (PRA) (12-14), number of pelvic rays (PVR) (4-5), number of anal spines (ANS) (2-3) and number of pelvic spines (PEVS) (1, no range) were the same in both sexes. There was strong correlation between weight/total length (r=0.93) and total length/length of dorsal fin base (r=0.72), while there was no correlation between body depth/head length. The mean condition factor (k) were 2.07±0.02 (combined sexes), 2.08±0.03 (males) and 2.03±0.03 (females). Growth was isometric for both sexes: males, 3.24 and females, 3.06. The results suggested that Oyan Lake is suitable for S. galilaeus.

Prioritizing the survival determinants of quantity surveying firms in economic contraction

PurposeMicro, small and medium-sized enterprises are the live wire of construction industry in developing countries. These classes of establishments are most affected by economic contraction and turmoil, thus affecting their performance and survivability. Hence, the purpose of this study is to investigate and prioritize the survival determinants of construction consulting organization during economic contraction in Nigeria using quantity surveying firms as a focal point.Design/methodology/approachThe study adopted the descriptive-survey design and quantitative data were collected through questionnaire purposely administered to quantity surveying firms in the Southwestern part of Nigeria. The data obtained from 99 quantity surveying firms on survival determinants were analysed using various statistical analysis such as mean score, standard deviation, Mann–Whitney U test, Kruskal–Wallis H test, and so on. Principal component analysis was used to identify the principal components of survival determinants, while the factors were prioritized using fuzzy synthetic evaluation (FSE).FindingsThe result of the analysis reveals eight factors that significantly determines the survival of firms during the period of economic contraction. Furthermore, the eight grouped factors were prioritized accordingly namely firm's innovation and diversification, ownership structure and networking, education level and management skills, and so on.Practical implicationsThis study investigated the survival determinants of quantity surveying firms and prioritized it with the opinions of principal partners in quantity surveying establishments. As against obtaining large survey responses from all quantity surveyors in the study area that may not have practical experience of managing firms, the limited responses received provide valid basis to broaden the horizon of professionals and other stakeholders on the key determinants for firms to survive economic turmoil.Originality/valueThis study contributes to the body of knowledge by providing information on prioritized factors that must be considered in an appropriate order by quantity surveying firms to survive economic contraction.

Residents’ perception of housing quality in selected informal settlement in a part of Southwestern Nigeria

Residents’ perception of housing quality in selected informal settlement in a part of Southwestern Nigeria