Somatic Cell Nuclear Transfer Technique Research Articles

Advancing primatology through ethical and scientific perspectives on rhesus monkey (Macaca mulatta) cloning.

A critical turning point was reached in research with the recent success in cloning rhesus monkeys (Macaca mulatta), a major advancement in primatology. This breakthrough marks the beginning of a new age in biomedical research, ushered by improved somatic cell nuclear transfer techniques and creative trophoblast replacement strategies. The successful cloning of rhesus monkeys presents the possibility of producing genetically homogeneous models that are highly advantageous for studying complex biological processes, testing drugs, and researching diseases. However, this achievement raises important ethical questions, particularly regarding animal welfare and the broader ramifications of primate cloning. Approaching the future of primate research with balance is critical, as the scientific world stands on the brink of these revolutionary breakthroughs. This paper aims to summarise the consequences, ethical challenges and possible paths forward in primatology arising from rhesus monkey cloning.

Distinct properties of putative trophoblast stem cells established from somatic cell nuclear-transferred pig blastocysts

BackgroundGenetically modified pigs are considered ideal models for studying human diseases and potential sources for xenotransplantation research. However, the somatic cell nuclear transfer (SCNT) technique utilized to generate these cloned pig models has low efficiency, and fetal development is limited due to placental abnormalities.ResultsIn this study, we unprecedentedly established putative porcine trophoblast stem cells (TSCs) using SCNT and in vitro-fertilized (IVF) blastocysts through the activation of Wing-less/Integrated (Wnt) and epidermal growth factor (EGF) pathways, inhibition of transforming growth factor-β (TGFβ) and Rho-associated protein kinase (ROCK) pathways, and supplementation with ascorbic acid. We also compared the transcripts of putative TSCs originating from SCNT and IVF embryos and their differentiated lineages. A total of 19 porcine TSCs exhibiting typical characteristics were established from SCNT and IVF blastocysts (TSCsNT and TSCsIVF). Compared with the TSCsIVF, TSCsNT showed distinct expression patterns suggesting unique TSCsNT characteristics, including decreased mRNA expression of genes related to apposition, steroid hormone biosynthesis, angiopoiesis, and RNA stability.ConclusionThis study provides valuable information and a powerful model for studying the abnormal development and dysfunction of trophoblasts and placentas in cloned pigs.

Effects of extracellular vesicles derived from steroids-primed oviductal epithelial cells on porcine in vitro embryonic development

Extracellular vesicles (EVs) play an active role in regulating different physiological events, however, endocrine control of EVs cargo contents remain poorly understood. In this study, we aimed to isolate EVs from the porcine oviductal epithelial cells (POECs) that were primed with steroid hormones including estradiol (E2) and progesterone (P4), mimicking the in vivo conditions of the reproductive cycle and studied their effects on in vitro produced embryonic development. For this purpose, POECs were treated either with 0 concentration (control) or two different combinations of E2 and P4 including 50 pg/mL E2 + 0.5 ng/mL P4 (group H1), and 10 pg/mL E2 + 35 ng/mL P4 (group H2). Embryos were prepared after in vitro maturation either by parthenogenetic activation or somatic cell nuclear transfer (SCNT) technique. Treating parthenogenetic embryo with EVs, led a significantly higher rate of the blastocyst formation in the group supplemented with each EVs, compared to the control group. In addition, TUNEL assay and gene expression level analysis revealed that apoptosis was significantly reduced in the H2 EVs group. Furthermore, EVs from hormone-primed POECs improved the formation rate of porcine SCNT embryos compared to the control group. While in each EVs supplemented group (control EVs, H1 EVs, H2 EVs), the expression of cell reprogramming-related genes in cloned embryos showed a tendency of increase, the effect was stronger in H1 EVs and H2 EVs. In conclusion, EVs derived from POECs cultured in hormonal conditions simulating the in vivo environment had a positive effect on porcine blastocysts formation, which will likely facilitate in the production of cloned embryos.

Cloning horses by somatic cell nuclear transfer: Effects of oocyte source on development to foaling

The cloning of horses is a commercial reality, yet the availability of oocytes for cloned embryo production remains a major limitation. Immature oocytes collected from abattoir-sourced ovaries or from live mares by ovum pick-up (OPU) have both been used to generate cloned foals. However, the reported cloning efficiencies are difficult to compare due to the different somatic cell nuclear transfer (SCNT) techniques and conditions used. The objective of this retrospective study was to compare the in vitro and in vivo development of equine SCNT embryos produced using oocytes recovered from abattoir-sourced ovaries and from live mares by OPU. A total of 1,128 oocytes were obtained, of which 668 were abattoir-derived and 460 were OPU-derived. The methods used for in vitro maturation and SCNT were identical for both oocyte groups, and the embryos were cultured in Dulbecco's Modified Eagle's Medium/Nutrient Mixture F-12 Ham medium supplemented with 10% fetal calf serum. Embryo development in vitro was assessed, and Day 7 blastocysts were transferred to recipient mares. The embryos were transferred fresh when possible, and a cohort of vitrified-thawed OPU-derived blastocysts was also transferred. Pregnancy outcomes were recorded at Days 14, 42 and 90 of gestation and at foaling. The rates of cleavage (68.7 ± 3.9% vs 62.4 ± 4.7%) and development to the blastocyst stage (34.6 ± 3.3% vs 25.6 ± 2.0%) were superior for OPU-derived embryos compared with abattoir-derived embryos (P < 0.05). Following transfer of Day 7 blastocysts to a total of 77 recipient mares, the pregnancy rates at Days 14 and 42 of gestation were 37.7% and 27.3%, respectively. Beyond Day 42, the percentages of recipient mares that still had a viable conceptus at Day 90 (84.6% vs 37.5%) and gave birth to a healthy foal (61.5% vs 12.5%) were greater for the OPU group compared with the abattoir group (P < 0.05). Surprisingly, more favourable pregnancy outcomes were achieved when blastocysts were vitrified for later transfer, probably because the uterine receptivity of the recipient mares was more ideal. A total of 12 cloned foals were born, 9 of which were viable. Given the differences observed between the two oocyte groups, the use of OPU-harvested oocytes for generating cloned foals is clearly advantageous. Continued research is essential to better understand the oocyte deficiencies and increase the efficiency of equine cloning.

2-Cell-like Cells: An Avenue for Improving SCNT Efficiency.

After fertilization, the zygote genome undergoes dramatic structural reorganization to ensure the establishment of totipotency, and then the totipotent potential of the zygote or 2-cell-stage embryo progressively declines. However, cellular potency is not always a one-way street. Specifically, a small number of embryonic stem cells (ESCs) occasionally overcome epigenetic barriers and transiently convert to a totipotent status. Despite the significant potential of the somatic cell nuclear transfer (SCNT) technique, the establishment of totipotency is often deficient in cloned embryos. Because of this phenomenon, the question arises as to whether strategies attempting to induce 2-cell-like cells (2CLCs) can provide practical applications, such as reprogramming of somatic cell nuclei. Inspired by strategies that convert ESCs into 2CLCs, we hypothesized that there will be a similar pathway by which cloned embryos can establish totipotent status after SCNT. In this review, we provide a snapshot of the practical strategies utilized to induce 2CLCs during investigations of the development of cloned embryos. The 2CLCs have similar transcriptome and chromatin features to that of 2-cell-stage embryos, and we propose that 2CLCs, already a valuable in vitro model for dissecting totipotency, will provide new opportunities to improve SCNT efficiency.

Global DNA methylation profiles of\xa0buffalo (Bubalus bubalis)\xa0preimplantation embryos produced by handmade cloning and in vitro fertilization

Somatic cell nuclear transfer technique (SCNT) has proved to be an outstanding method of multiplication of elite animals but accompanied with low efficiency and live birth rate of cloned animals. Epigenetic alterations of DNA has been one of the culprits behind this issue. Cloned embryos are found to deviate slightly from regular pattern of demethylation and re-methylation at the time of nuclear reprogramming and embryonic development when compared with embryos produced by in vitro fertilization (IVF). Thus, the present study was aimed at evaluating global DNA methylation profiles of cloned embryos at 2-cell, 8-cell and blastocyst stages and compare it with corresponding stages of embryos produced by IVF by using MeDIP-Sequencing on Illumina-based platform. We found out that cloned embryos exhibited significantly different DNA methylation pattern as compared to IVF embryos with respect to distribution of differentially methylated regions in different components of genome, CpG islands distribution and methylation status, gene ontological profiles and pathways affected throughout the developmental stages. The data generated from MeDIP-Seq was validated at blastocyst stage cloned and IVF embryos by bisulfite-sequencing PCR on five randomly selected gene regions.

Generation of a Dystrophin Mutant in Dog by Nuclear Transfer Using CRISPR/Cas9-Mediated Somatic Cells: A Preliminary Study.

Dystrophinopathy is caused by mutations in the dystrophin gene, which lead to progressive muscle degeneration, necrosis, and finally, death. Recently, golden retrievers have been suggested as a useful animal model for studying human dystrophinopathy, but the model has limitations due to difficulty in maintaining the genetic background using conventional breeding. In this study, we successfully generated a dystrophin mutant dog using the CRISPR/Cas9 system and somatic cell nuclear transfer. The dystrophin mutant dog displayed phenotypes such as elevated serum creatine kinase, dystrophin deficiency, skeletal muscle defects, an abnormal electrocardiogram, and avoidance of ambulation. These results indicate that donor cells with CRISPR/Cas9 for a specific gene combined with the somatic cell nuclear transfer technique can efficiently produce a dystrophin mutant dog, which will help in the successful development of gene therapy drugs for dogs and humans.

Preparation and Property of Antibacterial Nucleus with the Combination of Nano-Silver and Antibiotics

To improve the yield and quality of pearls in freshwater pearl culture and the survival rates after nucleus implanting surgery, pearl farmers used artificial pearl nuclear transplantation techniques to raise pearls. To address the common problem of Staphylococcus aureus and Escherichia coli infection in oyster farming, a new prophylactic method by using compound antibiotics to prepare the medicine coated pearl nucleus was put forward based on existing research results of the nanosilver antibacterial nucleus. Single-factor experiment, multi-factor experiment, orthogonal experiment, SPSS analysis of variance was used to optimize the antibacterial formulation on the assumption that the contaminated probability of these two pathogenic bacteria was the same. The result showed that the optimal ratio of compound antibiotics was 0.0075g/ml of the flavomycin solution and 0.01g/mL of the terramycin solution; the inhibition zones diameter of both pathogenic bacteria was more than 2.6cm in vitro, which was higher than the nanosilver antibacterial nucleus of 0.9cm in vitro. Indicating that the addition of this compound antibiotic formula for the nanosilver antibacterial nucleus could reduce the usage of antibiotics under the premise of maintaining antibacterial effectiveness, and could preferably inhibit the pathogenic microorganisms in the postoperative infection period. This also indicates that compound antibiotics coated antibacterial nanosilver nucleus would be applied more widely.

Characteristics of SP600125 Induced Tetraploid Cells in Comparison With Diploid and Tetraploid Cells of Fish.

In our previous research, SP600125 (Anthrapyrazolone) was used to induce autotetraploid of crucian carp cells (SP4N cells), and tetraploid fry was generated from the SP4N cells by somatic cell nuclear transfer technique. However, it is still unclear about biological characteristics of the SP4N cells. In this article, the cytological characteristic and gene expression profiles of the SP4N cells are investigated in comparison with the crucian carp cells (2N cells) and the tetraploid crucian carp cells (CC4N cells). The SP4N cells have tetraploid characteristics in terms of morphology and DNA ploidy levels, and their chromosome behavior is stable during the cell proliferation. The migration ability and the mtDNA copy number of SP4N cells are both lower than those in the CC4N cells and the 2N cells, but there exist giant mitochondria in the SP4N cells. The similar expression trends in the cell cycle regulation genes of the SP4N cells and 2N cells, while the corresponding expression profiles are clearly different between the SP4N cells and the CC4N cells. Moreover, the significant difference genes are associated with energy metabolism pathways among the SP4N cells, 2N cells and CC4N cells. These results can provide deeper understanding of SP600125 induction, as well as finding applications in polyploidization breeding of fish species.

Production of a Cloned Offspring and CRISPR/Cas9 Genome Editing of Embryonic Fibroblasts in Cattle

Somatic Cell Nuclear Transfer (SCNT) technique was used to produce the first viable cloned cattle offspring in Russia. Whole-genome SNP genotyping confirmed that the cloned calf was identical to the fibroblast cell line that was used for SCNT. CRISPR/Cas9 approach was subsequently used to knock out genes for beta-lactoglobulin gene (PAEP) and the beta-lactoglobulin-like protein gene (LOC100848610) in the fibroblast cells. Gene editing (GE) efficiency was 4.4% for each of these genes. We successfully obtained single-cell-derived fibroblast colonies containing PAEP and LOC100848610 knockouts, which will be used to produce beta-lactoglobulin-deficient cattle.

95 Invitro correction of F508del and G542X mutations in sheep fibroblasts of cystic fibrosis models

Cystic fibrosis (CF) is a human genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. Among the ∼2000 known CF mutations, the F508del mutation is found in 84% and G542X in 4.6% of the CF patients in the United States. The F508del mutation occurs in exon 11 and is characterised by deletion of the “CTT” nucleotides, resulting in deletion on the phenylalanine residue at the position 508 of CFTR. This causes misfolding of the CFTR protein, which is further degraded by proteases. The G542X mutation is a nonsense mutation found in exon 12 and associated with nonsense-mediated decay of the mutant transcript causing the absence of protein production. Previously, we generated CFTRF508del/F508del and CFTRG542X/G542X lambs (unpublished) using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We hypothesised that gene editing may be an effective tool to correct these mutations and permanently cure this genetic disease. Thus, in this study, we evaluated the efficiency of CRISPR/Cas9-meditated gene knock-in to correct the F508del and G542X mutations in sheep fibroblasts invitro. We designed single guide (sg)RNAs using the Benchling software (https://benchling.com/academic) and approximately 100bp of single-stranded oligodeoxynucleotides (ssODNs) targeting the mutation sites at exon 11 and 12 to introduce either “CTT” or change the “T” to “G” nucleotide in genome of F508del or G542X CF sheep cells, respectively. Each of Cas9/sgRNA ribonucleoproteins was transfected into sheep fibroblast cells along with ssODNs using the Lonza-4D-NucleofectorTM (Lonza) system for homology-directed repair. The transfected cells were subsequently cultured in Dulbecco’s modified Eagle medium, supplemented with 15% fetal bovine serum and 1% penicillin, and incubated at 38.5°C. DNA was extracted 48h post-transfection to validate mutation efficiency. PCR products of the exons 11 and 12 were ligated into T-vector, and bacterial colonies were selected based on blue/white screening. In total, we isolated 32 single cell bacterial colonies for each mutant. Sequencing results indicate that “CTT” was introduced in 4/26 (15.3%) plasmid colonies, and “T to G” replaced in 13/31 (41.9%) colonies. Therefore, our results indicate that the F508del and G542X mutations can be effectively corrected in CF sheep fibroblasts invitro using a CRISPR/Cas9 approach.

Global DNA methylation: role, status and genome-wide approaches to study epigenetic mark in cloned embryos

Somatic cell nuclear transfer (SCNT) technique has been proving its worth for more than two decades now as over 20 different species have been successfully cloned. SCNT protocol for cloning is well established but efficiency in terms of live birth rate is still low. Epigenetic abnormality following nuclear reprogramming is considered as the main culprit behind its low efficiency. DNA methylation is one of the most important epigenetic modifications that directly or indirectly regulate gene expression pattern, development and genome stability. Embryos produced through SCNT are found to express abnormal DNA methylation profile in comparison with in vivo or in vitro produced embryos. In order to improve DNA methylation profile in cloned embryos, a complete database of whole genome is required to find out specific faulty targets. Many techniques including low throughput and high throughput approach has been used to profile DNA methylation pattern in bovine embryos throughout the developmental stages. In the present review, we have compiled the overall status of global DNA methylation, the effect of aberrant DNA methylation on development and evolution in methodologies used for profiling global DNA methylome in cloned embryos.

The perspective of the incompatible of nucleus and mitochondria in interspecies somatic cell nuclear transfer for endangered species.

Taking into account the latest Red List of the International Union for Conservation of Nature in which 25% of all mammals are threatened with extinction, somatic cell nuclear transfer (SCNT) could be a beneficial tool and holds a lot of potential for aiding the conservation of endangered, exotic or even extinct animal species if somatic cells of such animals are available. In the case of shortage and sparse amount of wild animal oocytes, interspecies somatic cell nuclear transfer (iSCNT), where the recipient ooplasm and donor nucleus are derived from different species, is the alternative SCNT technique. The successful application of iSCNT, resulting in the production of live offspring, was confirmed in several combination of closely related species. When nucleus donor cells and recipient oocytes have been used in many other combinations, very often with a very distant taxonomical relation iSCNT resulted only in the very early stages of cloned embryo development. Problems encountered during iSCNT related to mitochondrial DNA (mtDNA)/genomic DNA incompatibility, mtDNA heteroplasmy, embryonic genome activation of the donor nucleus by the recipient oocyte and availability of suitable foster mothers for iSCNT embryos. Implementing assisted reproductive technologies, including iSCNT, to conservation programmes also raises concerns that the production of genetically identical populations might cause problems with inbreeding. The article aims at presenting achievements, limitations and perspectives of iSCNT in maintaining animal biodiversity.

Generation of Transgenic Cloned Buffalo Embryos Harboring the EGFP Gene in the Y Chromosome Using CRISPR/Cas9-Mediated Targeted Integration.

Sex control technology is of great significance in the production of domestic animals, especially for rapidly breeding water buffalo (bubalus bubalis), which served as a research model in the present study. We have confirmed that a fluorescence protein integrated into the Y chromosome is fit for sexing pre-implantation embryos in the mouse. Firstly, we optimized the efficiency of targeted integration of exogenous gene encoding enhanced green fluorescent protein (eGFP) and mCherry in Neuro-2a cells, mouse embryonic stem cells, mouse embryonic cells (NIH3T3), buffalo fetal fibroblast (BFF) cells. The results showed that a homology arm length of 800 bp on both sides of the target is more efficient that 300 bp or 300 bp/800 bp. Homology-directed repair (HDR)-mediated knock-in in BFF cells was also significantly improved when cells were supplemented with pifithrin-μ, which is a small molecule that inhibits the binding of p53 to mitochondria. Three pulses at 250 V resulted in the most efficient electroporation in BFF cells and 1.5 μg/mL puromycin was found to be the optimal concentration for screening. Moreover, Y-Chr-eGFP transgenic BFF cells and cloned buffalo embryos were successfully generated using CRISPR/Cas9-mediated gene editing combined with the somatic cell nuclear transfer (SCNT) technique. At passage numbers 6–8, the growth rate and cell proliferation rate were significantly lower in Y-Chr-eGFP transgenic than in non-transgenic BFF cells; the expression levels of the methylation-related genes DNMT1 and DNMT3a were similar; however, the expression levels of the acetylation-related genes HDAC1, HDAC2, and HDAC3 were significantly higher (p < 0.05) in Y-Chr-eGFP transgenic BFF cells compared with non-transgenic cells. Y-Chr-eGFP transgenic BFFs were used as donors for SCNT, the results showed that eGFP reporter is suitable for the visualization of the sex of embryos. The blastocyst rates of cloned buffalo embryos were similar; however, the cleavage rates of transgenic cloned embryos were significantly lower compared with control. In summary, we optimized the protocol for generating transgenic BFF cells and successfully generated Y-Chr-eGFP transgenic embryos using these cells as donors.

134 Generation of NANOS2 knockout goats using CRISPR/Cas9 and somatic cell nuclear transfer techniques

The NANOS2 gene, encoding an RNA binding protein, is known to play a critical role in the development of germline for all organisms studied to date. The male mice with biallelic NANOS2 knockouts (KOs) are sterile due to apoptosis of prospermatogonia shortly after birth but with morphologically intact seminiferous tubules. Thus, the choice of NANOS2 for targeting could be a viable strategy to develop germline ablated males that would serve as recipients for exogenous spermatogonial stem cell transplantation. The goat is a potential model of human physiology and an agriculturally important species. Here, we report successful generation of NANOS2 KO goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We first designed 4 single-guide RNAs (sgRNAs) specific for the single exon of goat NANOS2 (GenBank: NC_030825.1). The targeting vectors were constructed by using the pX330 plasmid (Addgene: 42230) and transfected into sheep fetal fibroblasts. Mutation efficiency analysis showed that 3 of them (out of 4, 75.0%) were efficient in directing Cas9 to generate targeted cleavages, with mutation efficiencies of 10-30%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with one of targeting vectors (sgRNA: GCTGGAGACCCAAGGGACTG). Colony screening with PCR/restriction fragment length polymorphism (RFLP) assays confirmed that we achieved biallelic mutations in the targeting site in 6 of 89 (6.7%) male and 6 of 172 (3.5%) female colonies. Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of NANOS2. Three male and two female colonies with NANOS2 null mutations were identified and used as cell donors for SCNT. In total, 202 cloned 1-cell stage embryos (130 male or 72 female) were generated and surgically transferred into 12 synchronized recipients. Six of them (6 of 12, 50.0%) were confirmed pregnant by ultrasonography on Day 40-45 of gestation. Four pregnancies developed to term, resulting in six offspring (five males and one female). Sequence analysis and PCR/RFLP assays showed that both male and female offspring carried the mutations in NANOS2, which were identical to the donor colonies from which they originated. Our results indicated that CRISPR/Cas9 combined with SCNT is an efficient system for generating NANOS2 KO goats. The phenotypic analysis to assess the effects of NANOS2 KO on the development of germline in male cloned goats is in progress.

Production of transgenic cattle by somatic cell nuclear transfer (SCNT) with the human granulocyte colony-stimulation factor (hG-CSF).

The hG-CSF (human Granulocyte Colony-Stimulating Factor) is a growth and stimulation factor capable of inducing the proliferation of bone marrow cells, several types of leukocytes, among other hematopoietic tissue cells. hG-CSF is used in used to treat anomalies that reder a small number of circulating white blood cells, which may compromise the immune defenses of the affected person. For these reasons, the production of hG-CSF in a bioreactor system using the mammary gland of genetic modified animals is a possibility of adding value to the bovine genetic material and reducing the costs of hG-CSF production in pharmaceutical industry. In this study, we aimed the production of transgenic hG-CSF bovine through the lipofection of bovine primary fibroblasts with an hG-CSF expression cassette and cloning these fibroblasts by the somatic cell nuclear transfer (SCNT) technique. The bovine fibroblasts transfected with the hG-CSF cassette presented a stable insertion of this construct into their genome and were efficiently synchronized to G0/G1 cell cycle stage. The transgenic fibroblasts were cloned by SCNT and produced 103 transferred embryos and 2 pregnancies, one of which reached 7 months of gestation.

206 Towards the generation of transchromosomic goats for the production of fully human immunoglobulin

We have previously reported that inactivation of endogenous immunoglobulin (Ig) genes can enhance the production of human polyclonal antibodies (hpAb) in transchromosomic (Tc) cattle containing a human artificial chromosome (HAC) comprising the entire human Ig gene repertoire. Goats offer the advantages of having a shorter gestation period and growing to adult size much faster than larger ungulates. Therefore, based upon our previously established Tc cattle platform, in this study, we aimed to generate immunoglobulin lambda light chain knockout (IGLλ −/− )/HAC Tc goats expressing hpAb using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. First, we designed multiple specific single-guide RNAs (sgRNA) targeting the coding sequences of constant regions of goat IGLλ1, IGLλ2 (both in NC_030824.1), and IGLλ3 (NW_017189530.1) and constructed corresponding gene targeting vectors. Gene targeting efficiency analysis in goat fibroblasts showed that the sgRNA were efficient in directing Cas9 to generate targeted indels in corresponding IGLλ genes with efficiencies ranging between 20 and 30%. We then targeted the IGLλ genes and generated a cloned IGLλ −/− fetus by SCNT (first round of cloning; G1) using single cell-derived IGLλ −/− fibroblast colonies as nuclear donors and established IGLλ −/− fetal fibroblast cell lines. Second, we established IGLλ −/− /HAC fibroblast colonies by transferring the isKcHACΔ, a HAC containing the entire unrearranged human immunoglobulin heavy-chain and kappa-chain sequences, into the IGLλ −/− fetal fibroblast cells via microcell-mediated chromosome transfer (MMCT; Matsushita et al. 2014 PLoS One 9, e90383). The resulting IGLλ −/− /HAC fibroblasts were used as nuclear donors for the production of IGLλ −/− /HAC goats by SCNT (second round of cloning; G2). A total of 311 one-cell stage G2 embryos were generated using 4 IGLλ −/− /HAC fetal fibroblast colonies and surgically transferred into 19 oestrus-synchronized recipients. Seven pregnancies were confirmed (7/19; 36.8%) with ultrasonography at Day 60±3 of gestation, and 1 pregnancy (1/7; 14.3%) developed to term, leading to the birth of a live and healthy kid. Genetic and serological characterisation of this Tc goat produced by the second round of SCNT is in progress.

205 Towards the correction of meconium ileus with cystic fibrosis transmembrane conductance regulator (CFTR) intestinal expression in CFTR knockout sheep

Cystic fibrosis (CF) is a human autosomal genetic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is responsible for Cl − anion transport in epithelial cells. We previously generated CFTR +/− and CFTR −/− lambs using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. The CFTR −/− lambs display many features similar to humans with CF, including meconium ileus (MI), pancreatic fibrosis, portal fibrosis and biliary hyperplasia, small gallbladder, and absence of the vas deferens. Although MI affects only 15 to 20% of human babies with CF, it was observed in 100% of newborn CFTR −/− lambs and was the primary cause of death. We here hypothesized that the transgenic expression of ovine CFTR cDNA under regulation of the rat intestinal fatty acid binding protein (iFABP) promoter would promote the correction of MI in CFTR −/− sheep. In this study, we constructed the pcDNA3.1&amp;gt;iFABP&amp;gt;CFTR expression vector in order to generate iFABP&amp;gt;CFTR transgenic CFTR −/− sheep. PCR and sequence analysis of all junction regions confirmed the presence of the inserts in the vector. We transfected male and female CFTR −/− sheep fetal fibroblasts with the construct. Three days after transfection, limiting dilution and G418 selection were used for the isolation of resistant single cell derived colonies. A total of 15 male colonies containing the pcDNA3.1&amp;gt;iFABP&amp;gt;CFTR vector was confirmed by PCR and sequence analysis. Three male cell colonies were used as nuclear donors for SCNT. In total, 129 one-cell-stage cloned embryos were generated and transferred into 11 estrus-synchronized recipients. Four recipients (4/11; 36.3%) were confirmed pregnant at Day 40 to 45 of gestation. One pregnancy went to term and resulted in the birth of a single lamb. The necropsy indicated the same abnormalities, including MI, seen in CFTR −/− lambs. A PCR assay confirmed the presence of the iFABP&amp;gt;CFTR transgene in the genome of the cloned offspring. The lack of MI correction is likely due to the low expression of CFTR in this particular colony. Western blot analysis is in progress. Additional embryo transfers will be performed using different single-cell-derived colonies.

Approaches used to improve epigenetic reprogramming in buffalo cloned embryos.

The reproductive cloning in buffalo in India has been started using a simplified somatic cell nuclear transfer technique named handmade cloning. Since the birth of first cloned female buffalo in 2009, a number of buffalo clones have been produced in India by utilizing different types of donor cells such as ear cells, embryonic stem cells, semen somatic cells and urine somatic cells. The use of buffalo cloning on a large scale is restricted due to low pregnancy rates and poor calf survival. Considerable attempts have been made to improve the overall buffalo cloning efficiency, particularly by modifying epigenetic reprogramming of cloned embryos. Previous studies have demonstrated that chemical epigenetic modifiers such as trichostatin A and 5-aza-2’-deoxycytidine, m-carboxycinnamic acid bishydroxamide can be used to treat donor somatic cells and reconstructed fused embryos to correct the epigenetic reprogramming to enhance the overall cloning efficiency in terms of live birth rates.

Dog cloning-no longer science fiction.

Since the generation of world's first cloned dog, Snuppy, in 2005, somatic cell nuclear transfer (SCNT) in dogs has been widely applied for producing several kinds of dogs with specific objectives. Previous studies have demonstrated that cloned dogs show normal characteristics in growth, blood parameters and behavioural aspect. Also, canine SCNT technique has been applied to propagate working dogs with excellent abilities in fields such as assistance of disabled people, drugs detection and rescue activity. Because dogs have similar habituation properties and share many characteristics including anatomic and physiological aspects with humans, they are also primary candidates for human disease models. Recently, transgenic dogs that express red fluorescent protein gene constitutively and green fluorescent protein gene conditionally have been generated. In addition, transgenic dogs with an overexpression of peroxisome proliferator-activated receptor-alpha in specific muscles were generated to enhance physical performance. In 2017, Snuppy was recloned with markedly increased pregnancy and delivery rates compared to the statistics from when Snuppy was first cloned. Such striking improvements in the cloning of dogs using SCNT procedures suggest that dog cloning could be applied in many fields of biomedical science for human diseases research, and the application of cloning is no longer science fiction.