Solid-phase Synthesis Of Oligoribonucleotides Research Articles

RNA synthesis via dimer and trimer phosphoramidite block coupling

The solid-phase synthesis of oligoribonucleotides using dimer and trimer phosphoramidite blocks is described. This method significantly reduces the total number of steps required in the synthesis of a target RNA sequence, provides more material, and simplifies separation of the product from shorter failure sequences. The procedure is illustrated by the synthesis of UpU, ApA, and UpUpU phosphoramidite blocks and their use in the rapid synthesis of oligoribonucleotides on a solid support. Dimer and trimer amidite blocks will likely find use in the large scale solution (or solid)-phase synthesis of siRNA drugs.

Chemical Synthesis of Oligoribonucleotides with 2′‐O‐(2‐Cyanoethoxymethyl)‐Protected Phosphoramidites

An RNA synthetic method with 2-cyanoethoxymethyl (CEM) as the 2'-hydroxyl protecting group allows the synthesis of long oligoribonucleotides from CEM-amidites with an efficiency and final purity comparable to that obtained in DNA synthesis. The CEM-amidites give a high coupling efficiency, because the CEM group minimizes steric hindrance in the coupling reaction. The CEM group shows satisfactory stability under solid-phase synthetic conditions, avoids the generation of asymmetric centers, and is easily cleaved to give the final product. This unit describes the synthesis of the four CEM-amidites, the preparation of reagents, the solid-phase synthesis of oligoribonucleotides on an automated DNA synthesizer, and their deprotection.

The 4-(N-Dichloroacetyl-N-methylamino)benzyloxymethyl Group for 2‘-Hydroxyl Protection of Ribonucleosides in the Solid-Phase Synthesis of Oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

Facile preparation of acetals and enol ethers derived from 1-arylpiperidin-4-ones

M. Faja, C. B. Reese, Q. Song and P. Zhang, J. Chem. Soc., Perkin Trans. 1, 1997, 191 DOI: 10.1039/A606191E

Methylamine deprotection provides increased yield of oligoribonucleotides

Use of methylamine or methylamine/ammonium hydroxide as a cleavage and deprotection reagent for the solid phase synthesis of Oligoribonucleotides has significantly increased the yield of the full length Oligoribonucleotides as compared to the use of conventional ammonium hydroxide/ethanol.

Solid phase synthesis of oligoribonucleotides by the phosphoramidite approach using 2′-O-1-(2-chloroethoxy)ethyl protection

The new type protecting group, 1-(2-chloroethoxy)ethyl (Cee) group has been employed for the protection of the 2′-OH groups of ribonucleoside residues in the synthesis of oligoribonucleotides by the phosphoramidite approach en a solid support, using the acid-labile 5′-O-dimethaxytrityl (DMTr) group. This group is completely stable under the acidic conditions required to remove the 5t́-terminal protecting groups in oligonucleotide synthesis on a solid support, and yet is easily removable under mild condition of acidic hydrolysis (pH 2.0) for the final unblocking step. The Cee-protected ribonucleoside 3′-phosphoramidite units were evaluated in the synthesis of a series of oligoribonucleotides consisting of the homopolymers of cytidine, the box 9R and 9R' sequences of Tetrahymena rRNA, and a leader sequence of phage Qβ-A protein mRNA. A full data for the deprotection and purification of synthetic oligoribonucleotides are also described.

ChemInform Abstract: N‐Phenoxyacetylated Guanosine and Adenosine Phosphoramidites in the Solid Phase Synthesis of Oligoribonucleotides: Synthesis of a Ribozyme Sequence.

AbstractAdenosine (I) is converted to the N6‐phenoxyacetyl derivative (III) which undergoes consecutive O‐protection and coupling with the chloride (VI), producing the phosphoramidite (VII).

Solid phase synthesis of oligoribonucleotides using the l-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (Ctmp) group for the protection of the 2′-hydroxy functions and the H-phosphonate approach

The solid phase synthesis of oligoribonucleotides using the H-phosphonate approach and the 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (Ctmp) and dimethoxytrityl (DMTr) groups, respectively, for the protection of the 2'- and 5'-hydroxy functions is described. The use of a new reagent, tris-(1,1,1,3,3,3-hexafluoro-2-propyl) phosphite for the preparation of nucleoside H-phosphonate units is also discussed in detail.

ChemInform Abstract: Enhanced Coupling Efficiency Using 4‐Dimethylaminopyridine (DMAP) and Either Tetrazole, 5‐(o‐Nitrophenyl)tetrazole, or 5‐(p‐Nitrophenyl)tetrazole in the Solid Phase Synthesis of Oligoribonucleotides by the Phosphoramidite Procedure.

Abstract 5-( p -nitrophenyl) tetrazole/DMAP mixtures are more effective phosphoramidite activators than either tetrazole, 5-( o -nitrophenyl) tetrazole or 5-( p -nitrophenyl) tetrazole for solid phase oligonucleotide synthesis.

Solid phase synthesis of oligoribonucleotides using [formula omitted]-nitrobenzyl protection of 2'-hydroxyl via a phosphotriester approach

Oligoribonucleotides with chain length of 6–9 were synthesized on a polystyrene support using o -nitrobenzyl protection of 2'-hydroxyls via phosphotriester method. The condensation reactions between N -acyl-5'- O -monomethoxytrityl-2'- O -( o -nitrobenzyl) nucleoside 3'-( o -chlorophenyl) phosphate and nucleoside bound to the resin using l-mesitylenesulfonyl-3-nitro-1 H -1,2,4-triazole (MSNT) as a condensing agent were examined. It was found that the condensation reaction using MSNT was promoted in the presence of 1-methylimidazole as a catalyst. A mixture of MSNT and 1-methylimidazole was also found to be effective in the condensation reaction involving a dinucleotide with 3'-phosphodiester. The fully protected oligomer were deblocked and purified by chromatography in total yields of 3–21 % based on initial nucleoside bound to the support.

N-Phenoxyacetylated guanosine and adenosine phosphoramidites in the solid phase synthesis of oligoribonucleotides: Synthesis of a ribozyme sequence

Phosphoramidites for guanosine and adenosine nucleosides with phenoxyacetyl as N-acyl protecting group were prepared. These nucleoside phosphoramidites, together with previously reported uridine and N-benzoyl cytidine phosphoramidites have been applied to the efficient solid phase synthesis of a trideca and a nonadecaribonucleotide. The later molecule has the sequence corresponding to a ribozyme.

ChemInform Abstract: Nucleoside H‐Phosphonates. Part 3. Chemical Synthesis of Oligodeoxyribonucleotides by the Hydrogenphosphonate Approach. Nucleoside H‐Phosphonates. Part 4. Automated Solid Phase Synthesis of Oligoribonucleotides by the Hydrogenphosphonate Approach.

AbstractThe synthesis of oligodesoxy‐ribonucleotides such as (III) by the hydrogenphosphonate approach is described.

Enhanced coupling efficiency using 4-dimethylaminopyridine (DMAP) and either tetrazole, 5-( [formula omitted]-nitrophenyl) tetrazole, or 5-( [formula omitted]-nitrophenyl) tetrazole in the solid phase synthesis of oligoribonucleotides by the phosphoramidite procedure.

5-( p -nitrophenyl) tetrazole/DMAP mixtures are more effective phosphoramidite activators than either tetrazole, 5-( o -nitrophenyl) tetrazole or 5-( p -nitrophenyl) tetrazole for solid phase oligonucleotide synthesis.

A new solid-phase synthesis of oligoribonucleotides by the phosphoro-p-anisidate method using tetrahydrofuranyl protection of 2'-hydroxyl groups.

Six nonaribonucleotides containing the 5'-splice site, one complementary nonamer and an octadecamer containing the 3'-splice site have been synthesized on a polymer support using the phosphoro-p-anisidate method. A 5'-linked 2'-O-tetrahydrofuranyl-N-protected nucleoside 3'-(o-chlorophenyl)phosphoro-p-anisidate was used as the starting nucleotide, and the chain elongated in the 3'-direction by removing the p-anisidate protecting group with isoamyl nitrite under neutral conditions. The octadecamer has been synthesized using dinucleotide blocks and a 3'-terminal trinucleotide.

A New 5′-Protecting Group for Use in Solid-Phase Synthesis of Oligoribonucleotides

Abstract The 2-(2,4-dinitrobenzenesulphenyloxymethyl)benzoyl (DNBSB) group is proposed as a protecting group for the 5′-position of nucleosides. The DNBSB group may be removed under mild non-acidic conditions and may have potential in solid-phase synthesis of oligoribo- and oligodeoxyribonucleotides.

Solid phase synthesis of oligoribonucleotides using o-nitrobenzyl protection of 2'-hydroxyl via a phosphite triester approach.

The hepta and undecaribonucleotide were synthesized on a controlled pore glass beads using o-nitrobenzyl protection of 2'-hydroxyls via a phosphite approach. By using 5-p-nitrophenyltetrazole for the activation of nucleoside-phosphoramidite, the condensation reaction was carried out very rapidly (2.5 min). The time required for one cycle was only 16 min. The hepta-(UACUAAC) and undecaribonucleotides (GUAUGUUAAUA) were obtained in yields of 28 and 17% respectively from the original resin.

Nucleoside H-phosphonates. IV. Automated solid phase synthesis of oligoribonucleotides by the hydrogenphosphonate approach

A rapid and efficient synthesis of oligoribonucleotides on solid support is described via coupling of 5′- O -dimethoxytrityl-2′- O -t-butyldimethylsilyl ribonucleoside 3′-H-phosphonates II to the polymer bound nucleoside in the presence of pivaloyl chloride as coupling agent.

Automated Solid Phase Synthesis of Oligoribonucleotides. The Synthesis of a tRNA Anticodon Loop from Nucleoside-3'-chlorophosphite Derivatives.

Abstract A heptadecaribonucleotide corresponding to positions #28–44 of E. coli's N-formylmethionine initiator tRNA was synthesized on a silica gel support. Methyl dichlorophosphite was used as the coupling reagent.