Solanum Sarrachoides Research Articles

Solanum sarrachoides (green nightshade)

This datasheet on Solanum sarrachoides covers Identity, Overview, Associated Diseases, Pests or Pathogens, Distribution, Biology & Ecology, Uses, Management, Genetics and Breeding, Food Quality, Food Safety, Economics, Further Information.

Phytophthora infestans: An Overview of Methods and Attempts to Combat Late Blight.

Phytophthora infestans (Mont.) de Bary is one of the main pathogens in the agricultural sector. The most affected are the Solanaceae species, with the potato (Solanum tuberosum) and the tomato (Solanum lycopersicum) being of great agricultural importance. Ornamental Solanaceae can also host the pests Petunia spp., Calibrachoa spp., as well as the wild species Solanum dulcamara, Solanum sarrachoides, etc. Annual crop losses caused by this pathogen are highly significant. Although the interaction between P. infestans and the potato has been investigated for a long time, further studies are still needed. This review summarises the basic approaches in the fight against the late blight over the past 20 years and includes four sections devoted to methods of control: (1) fungicides; (2) R-gene-based resistance of potato species; (3) RNA interference approaches; (4) other approaches to control P. infestans. Based on the latest advances, we have provided a description of the significant advantages and disadvantages of each approach.

Tuta absoluta (Lepidoptera: Gelechiidae) Success on Common Solanaceous Species from California Tomato Production Areas.

Tuta absoluta (Meyrick) is a devastating pest of tomato that has invaded many regions of the world. To date, it has not been detected in North America, but the pest reached Costa Rica in 2014 and seriously threatens the southern, southwestern, and western United States including California. Although the primary host of T. absoluta is tomato, several other species of Solanaceae may serve as alternative hosts. In our study, we aimed to assess the potential risk that other solanaceous crops and wild species that are often present in and around California tomato fields could serve as hosts. To accomplish this, we conducted greenhouse and laboratory studies to determine whether two common cultivars of fresh market tomato, two common cultivars of tomatillo, and the wild plants, Solanum nigrum L., Solanum sarrachoides (Sendtner), and Datura stramonium L., are suitable hosts for reproduction and development of the pest. According to our results, D. stramonium and tomatillo were unable to sustain T. absoluta larval development in either greenhouse studies or laboratory studies, and therefore, they are not likely to contribute to T. absoluta establishment during an invasion. On the contrary, the two other solanaceous weeds, S. nigrum and S. sarrachoides, share a similar potential as tomato to be reproductive and developmental hosts of T. absoluta, and might play an important role in the establishment of the pest in California.

Effect of Potato virus Y Presence in Solanum tuberosum (Solanales: Solanaceae) and Chenopodium album on Aphid (Hemiptera: Aphididae) Behavior.

This study establishes the effect of Potato Virus Y (PVY; Potyvirus) in potatoes, Solanum tuberosum L. (Solanales: Solanaceae) and in common-lambs' quarter Chenopodium album L. (Amaranthaceae) on Macrosiphum euphorbiae Thomas (Hemiptera: Aphididae) and Myzus persicae Sulzer (Hemiptera: Aphididae) behavior, host preference, transmission, and fitness under field and laboratory studies. In the field, several weeds, besides C. album, were collected, including: Sisymbrium altissimum L. (Brassicaceae), Erodium cicutarium L., Lactuca serriola L., Solanum sarrachoides Sendtner (Solanaceae), and S. dulcamara L. (Solanaceae). All weeds were serologically tested for the presence of PVY. From all weeds collected, 2.3 and 34% of C. album and S. sarrachoides, respectively, were PVY-positive. From those positive samples, 72% of the PVY found were PVYN; the remaining 28% was PVYO. In addition, several aphid species were collected from those weeds: Ovatus crataegarious Walker, Macrosiphum euphorbiae (Hemiptera: Aphididae), Hyalopterus pruni Geoffroy (Hemiptera: Aphididae), Rophalosiphum madis Fitch, and 'others aphid' species were collected. The highest number of aphids were collected in E. cicutarium, followed by S. dulcamara, L. serriola, S. altissimum, and C. album. In laboratory studies, PVY-infected C. album does not induce the production of aphids. Moreover, M. persicae did not appear to have a strong preference for either healthy or PVY-infected potato plant, but they did develop a preference for infected plants after prolonged feeding. M. persicae and M. euphorbiae transmitted PVY from C. album to S. tuberosum, 44 and 37.5 % of the time. Future research should seek to identify not only other sources and prevalence of PVY in the field but vector relationships. In insect-pathogen complex continues to persist in solanaceous field crops around the world.

Two new non-spiny Solanum (Solanaceae) from the Gran Chaco Americano and a key for the herbaceous glandular-pubescent solanums from the region.

The Gran Chaco Americano is a major savanna woodland system in South America that harbours great plant and animal diversity. Two new herbaceous species of the Morelloid clade of Solanum (largely corresponding to the traditional Solanum section Solanum) are described here from the Bolivian Chaco. Both species are morphologically similar to a group of related species with glandular pubescence and enlarged, foliaceous calyces that includes Solanum atriplicifolium Gillies ex Nees, Solanum nitidibaccatum Bitter, Solanum physalifolium Rusby, Solanum sarrachoides Sendtn. and Solanum tweedianum Hook. Solanum woodii Särkinen & S.Knapp, sp. nov. is unusual in the Morelloid clade in having tapering anthers on short filaments, and is superficially similar to the unrelated Solanum anomalostemon S.Knapp & M.Nee from dry forests in Peru. Solanum michaelis Särkinen & S.Knapp, sp. nov. is distinct in its enlarged calyx with a short tube and long lobes that apparently reflex at fruit maturity. Both new taxa are illustrated, their conservation status assessed, and their distributions mapped. We also provide a key to the glandular-pubescent herbaceous Solanum species of the Chaco vegetation to aid in identification of these taxa.

Steroidal glycoalkaloids: chemical defence of edible African nightshades against the tomato red spider mite, Tetranychus evansi (Acari: Tetranychidae).

Tetranychus evansi is an invasive pest of solanaceous crops in Africa, and in the field it differentially attacks edible African nightshades. The chemical basis for the differential attack on these plant species is largely unknown. Using bioassays and chemical analysis, we investigated the differential bioactivity of leaf extracts of three edible African nightshade species, Solanum sarrachoides, S. scabrum and S. villosum, on adult T. evansi females. Only the bioactivity of the leaf extract of S. sarrachoides (LC50 7.44 mg mL(-1)) and that of its most polar fraction (LC50 5.44 mg mL(-1)) paralleled that of the positive control, neem oil (LC50 1.89 mg mL(-1)), across all doses tested. Liquid chromatography-quadruple time of flight-mass spectrometry identified a mixture of steroidal glycoalkaloids (SGAs), including α-solasonine, α-solamargine and derivatives of tomatine and demissine, which were neither detected in the crude extract nor in any of the fractions obtained from S. scabrum and S. villosum. Our results suggest that the presence of SGAs may play a key role in the differential defence of edible African nightshades against attack by T. evansi. These findings may add to the plethora of environmentally friendly tools from natural plant products for management of T. evansi.

Differences in essential oil content of berries and leaves of Solanum sarrachoides (Solanaceae) and the effects on oviposition of the tomato spider mite (Tetranychus evansi)

Essential oils from leaves and berries of Solanum sarrachoides were obtained by hydro-distillation, analyzed by GC–MS and tested for oviposition deterrence against Tetranychus evansi. Plant oils comprised mainly of monoterpenes and fatty acids, but differed in terms of their relative abundance. The leaf oil contained mainly camphor (34.1%), limonene (8%), decanoic acid (9.3%) and hexadecanoic acid (7.3%). The berry oil contained mainly fatty acids (>20%) including hexadecanoic acid (9.8%) and dodecanoic acid (5.9%), hydrocarbons (>10%) and (E)-β-linalool (3.1%). In oviposition deterrence assays, the leaf essential oil and individual major monoterpenes compared favorably with the two positive controls, neem oil and cinnamaldehyde at varying concentrations [incidence ratio (IR)<1]. Compared to the fatty acid blend, the monoterpene blend exhibited strong oviposition deterrence (IR<1) across all concentrations. Our results show that essential oils of S. sarrachoides and their monoterpene constituents play a role in regulating oviposition in T. evansi.

The effect of an alternate weed host, hairy nightshade, Solanum sarrachoides (Sendtner) on green peach aphid distribution and Potato leafroll virus incidence in potato fields of the Pacific Northwest

Hairy nightshade, Solanum sarrachoides (Sendtner) is an annual solanaceous weed prevalent in potato farmlands of the Pacific Northwest. S. sarrachoides is also a reservoir for Potato leafroll virus (PLRV) and its most important vector, the green peach aphid, Myzus persicae (Sulzer). Green peach aphids prefer S. sarrachoides than potato, Solanum tuberosum (L.), and produce more nymphs on S. sarrachoides than on potato. Increased green peach aphid preference for S. sarrachoides and greater fecundity on this plant could lead to overcrowding and movement toward neighboring potato plants. To test our hypothesis, field trials were conducted at Kimberly, Idaho during the summers of 2003 and 2004. A row of S. sarrachoides seedlings was planted in the middle of potato plots and naturally occurring green peach aphid populations were monitored weekly on potato plots with and without S. sarrachoides. More aphids were consistently found on S sarrachoides plants than on potato plants. More aphids were found on potato plants in plots with S. sarrachoides plants than without S. sarrachoides. Targeted insecticide applications on S. sarrachoides rows alone reduced the number of aphids on potato plants in those plots, suggesting that insecticide sprays prevented aphid movement from S. sarrachoides to potato. Testing of potato tuber sprouts 90 days after harvest by double antibody sandwich ELISA indicated a greater PLRV infection rate on plots with S. sarrachoides than plots without S. sarrachoides. Therefore, the presence of S. sarrachoides in potato plots will likely increase aphid populations and PLRV incidence on neighboring potato plants.

Differential effects of various African nightshade species on the fecundity and movement of Tetranychus evansi (Acari: Tetranychidae)

The tomato red spider mite Tetranychus evansi Baker & Pritchard is a serious pest of solanaceous plants worldwide. Management of this oligophagous pest in African nightshades has been a challenge to smallholder African farmers due to its high reproductive rate and rapid development of resistance to synthetic pesticides. The aim of the present study was to determine the influence of leaf trichomes on T. evansi by comparing its fecundity and movement on the leaf surfaces of five African nightshade species, namely Solanum sarrachoides Sendter, S. villosum Miller, S. tarderemotum Bitter, S. americanum Miller and S. scabrum Miller. Data were recorded in the laboratory at 23 ± 1°C, 50–70% relative humidity and a 12 h light:12 h dark photoperiod for the effect of trichome type and density of the abaxial leaf surface on mite fecundity. Distances travelled by mites on the leaf surface from the edge of a thumbtack pin inserted on the leaf were also recorded. Different trichomes, glandular and non-glandular types, were identified. There was a significant negative correlation of fecundity and distance walked by mites with the density of glandular trichomes. Significantly fewer eggs were laid on S. sarrachoides in comparison with the other Solanum species. The distance walked by mites was also significantly shorter in this species, indicating that higher densities of glandular trichomes interfere with mite movements. These results suggest that African nightshade genotypes differ in their levels of resistance to T. evansi, which is partially associated with differences in trichome types and their densities.

Factors influencing plant regeneration from seedling explants of Hairy nightshade (Solanum sarrachoides)

Hairy nightshade (Solanum sarrachoides) has the potential to be a model system for the study of plant-pathogen interactions, however, the availability of tissue culture and transformation methods would strengthen its utility. For the development of tissue culture methods, we investigated, explant type (cotyledons, hypocotyls, roots), hypocotyl explant origin, cotyledon orientation (abaxial vs. adaxial) in direct contact with the medium, gelling agents (agar and agargel) and cytokinins (zeatin and 6-benzyladenine) at different concentrations. Cotyledon explants resulted in the greatest biomass as compared to root and hypocotyl. As for hypocotyl explant origin, explants proximal to the cotyledons had a significant effect on plant regeneration. However, cotyledon orientation and gelling agent had no effect on plant regeneration. Medium supplemented with either zeatin or 6-benzyladenine at 1 mg L−1 resulted in significant shoot regeneration. Shoots rooted readily when cultured on a non-hormone based rooting medium.

Amplified fragment length polymorphisms (AFLPs) analysis of species of Solanum section Solanum (Solanaceae ) from Uganda

The taxonomy of species belonging to Solanum section Solanum (sometimes referred to as the Solanum nigrum complex or black nightshades) is known to be difficult and has resulted in extensive synonymy. Yet, these species play a significant role in nutrition and food security, especially in developing countries. The amplified fragment length polymorphisms (AFLPs) technique was used to assess the genetic relationships among 107 accessions representing eight species of the section Solanum and to obtain new insight into the taxonomic status of the S. nigrum complex. Four primer combinations yielded 510 AFLP bands, only 29 of which were monomorphic. Neighbor-joining and principal coordinates analyses were performed. The AFLP data only partially correlated with earlier classifications based on morphology. We have been able to confirm the presence of only 5 out of eight species of this complex previously recognized from Uganda, that is, Solanum americanum, Solanum scabrum, Solanum hirsutum, Solanum florulentum/Solanum tarderemotum and Solanum villosum . In addition, S. villosum did not separate in accordance with previous subspecific ranks. It is likely that neither Solanum grossidentatum, S. nigrum nor Solanum sarrachoides occurred in Uganda. Also, there was no correlation between geographic localities for the Ugandan material and the AFLP results, indicating that most of the studied species are introduced. Key words: Amplified fragment length polymorphisms (AFLPs), Solanum nigum complex, Africa, genetic variation, taxonomy, Uganda.

Within plant distribution of Potato Virus Y in hairy nightshade ( Solanum sarrachoides): An inoculum source affecting PVY aphid transmission

Potato virus Y (PVY) is vectored by several potato-colonizing and non-colonizing aphid species in a non-persistent manner and has a wide host range. It occurs naturally in several plant families. Myzus persicae and Macrosiphum euphorbiae are the most efficient potato-colonizing aphid vectors of PVY. Rhopalosiphum padi, a cereal aphid that migrates in large numbers through potato fields during the middle of the growing season, does not colonize potato plants but can transmit PVY. Hairy nightshade, Solanum sarrachoides, a prevalent annual solanaceous weed in the Pacific Northwest (PNW) of the United States, is an alternative host for PVY and a preferred host for M. persicae and M. euphorbiae. Hence, hairy nightshade plants might play an important role as an inoculum source in the epidemiology of PVY. We looked at titre accumulation and distribution of PVY O, PVY N:O and PVY NTN in S. sarrachoides and potato after aphid inoculation with M. persicae and studied the transmission of PVY O and PVY NTN, by M. persicae, M. euphorbiae and R. padi from hairy nightshade to potato plants. Virus titre at different positions on the plant was similar in S. sarrachoides and potato plants with strains PVY O and PVY N:O. Titres of PVY NTN were similar in S. sarrachoides and potato but differences in titre were observed at different positions within the plant depending on the plant phenology. Percentage transmission of PVY NTN by M. persicae and M. euphorbiae was twice as high (46 and 34%, respectively) from hairy nightshade to potato than from potato to potato (20 and 14%). Percentage transmission of PVY O by M. persicae and M. euphorbiae was not affected by the inoculum source. No effect of the inoculum source was observed in the transmission of either PVY strain by R. padi. These results show that hairy nightshade may be an equal or better virus reservoir than potato and thus, important in the epidemiology of PVY.

Specialized Host Utilization of &lt;I&gt;Macrosiphum euphorbiae&lt;/I&gt; on a Nonnative Weed Host, &lt;I&gt;Solanum sarrachoides&lt;/I&gt;, and Competition With &lt;I&gt;Myzus persicae&lt;/I&gt;

The potato aphid, Macrosiphum euphorbiae (Thomas), (Homoptera: Aphididae), is a polyphagous aphid known to feed on over 200 plant species across 20 families. Although this aphid is known as one of the potato (Solanum tuberosum L.) colonizing aphids, field observations for populations of M. euphorbiae in southern Idaho indicated that they preferentially settled and colonized hairy nightshade, Solanum sarrachoides (Sendtner), plants rather than potato plants. Laboratory investigations revealed that M. euphorbiae survived only on S. sarrachoides and not on potato. A series of subsequent laboratory experiments conducted using laboratory-reared and field-collected aphids confirmed that M. euphorbiae survived only on S. sarrachoides. Experiments also showed that M. euphorbiae produced more winged morphs (alatae) than Myzus persicae on S. sarrachoides when reared alone under similar conditions. Furthermore, we documented intraguild competition between M. euphorbiae and M. persicae on S. sarrachoides. Results suggested that M. euphorbiae can potentially suppress M. persicae on S. sarrachoides. Competition studies reiterated that M. euphorbiae produced more alatae than M. persicae. Results also indicated that M. euphorbiae may have specialized on S. sarrachoides. The loss of polyphagous abilities of this M. euphorbiae “biotype” is intriguing and the factors responsible for specialized host utilization pattern remain to be elucidated.

Hairy Nightshade (Solanum sarrachoides) Competition with Two Potato Varieties

Greenhouse and field trials were conducted at the Aberdeen Research and Extension Center to determine the effect of hairy nightshade competition on two potato varieties with different growth habits. Greenhouse replacement trials included treatments of three plants total in each pot with potato : hairy nightshade ratios of 3 : 0, 2 : 1, 1 : 2, or 0 : 3. Varieties tested were ‘Russet Burbank’ and ‘Russet Norkotah’. Greenhouse-grown hairy nightshade (cotyledon to one-leaf stage) were transplanted into pots earlier than or at the same time as potato plant emergence. As the number of Russet Burbank plants per pot decreased, potato plant biomass dry weight (average per plant) increased, regardless of hairy nightshade number or transplant time. When hairy nightshade were transplanted before Russet Norkotah emergence, potato plant biomass dry weight per plant was similar, regardless of potato : nightshade ratio. Field trials were conducted with Russet Burbank and Russet Norkotah in 2004 and 2005. At potato emergence, greenhouse-grown hairy nightshade plants (one- to two-leaf) were transplanted in between potato rows at densities of 0, 1, 2, or 3 plants m−1row, and solid-seeded at approximately 100 plants m−1row. Hairy nightshade biomass, stem and berry number, and seeds per berry were reduced by competition from Russet Burbank due to the amount and duration of shading, as compared with Russet Norkotah. Russet Burbank U.S. No. 1 and total tuber yields in plots with 1 hairy nightshade plant m−1row were similar to weed-free control yields, whereas yields in plots with 2, 3, or 100 m−1row were reduced in comparison. In contrast, Russet Norkotah yields were reduced when only 1 hairy nightshade plant m−1row was present. Overall, Russet Norkotah were less competitive with hairy nightshade than Russet Burbank in both the greenhouse replacement and field trials.

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State.

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5' TAACACAACACAAAGCAAACC 3' and reverse: 5' CCAAATACTACTTTAACCGCA 3') (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings.

Role of Hairy Nightshade in the Transmission of Different Potato virus Y Strains on Solanum tuberosum (L.)

The complexity of the Potato virus Y (PVY) (Potyviridae: Potyvirus) pathosystem is affected by the presence of several virus strains that differ in their ability to produce tuber necrosis and by the presence of an alternate host that could increase the amount of inoculum in potato fields. Solanum sarrachoides (Sendtner) is an invasive weed from South America present in Pacific Northwest potato agro-ecosystems. It serves as reservoir of PVY and its most efficient vectors: the green peach aphid, Myzus persicae (Sulzer), and the potato aphid, Macrosiphum euphorbiae (Thomas). The role of S. sarracoides as vector and virus reservoir in PVY epidemiology was investigated through a series of laboratory and greenhouse experiments. We studied the symptoms produced in S. sarracoides upon infection with necrotic and non-necrotic strains of PVY and looked at the percentage of infection and titer accumulation of these strains. PVY infection in S. sarrachoides produced symptoms similar to those produced in PVY-infected potato plants. Mottling and yellowing were the main symptoms of infection observed in S. sarrachoides plants, especially by PVYO and PVYNTN infection. Greenhouse transmission studies revealed that PVY-infected S. sarrachoides increased the transmission rate of PVY necrotic strains by M. persicae. The necrotic strain PVYNTN reached higher titer in S. sarrachoides than in potato plants when compared to PVYO and PVYN:O These findings have broadened our understanding of the role and importance of S. sarrachoides in the PVY epidemiology in the potato ecosystems and could potentially be included in the development or optimization of virus management programs. Accepted for publication 15 March 2010. Published 26 May 2010.

Infection Potential of Hairy Nightshade (Solanum sarrachoides) by Phytophthora infestans and Late Blight Implications of the Alternate Host

AbstractInfection of hairy nightshade (Solanum sarrachoides Sendt.) by Phytophthora infestans has been reported. However, the epidemiological significance of hairy nightshade to potato late blight is not well known. Disease development and infection rates of P. infestans were quantified on hairy nightshade relative to tomato (cv. Brandywine) and potato (cv. Shepody) hosts to evaluate infection potential at 14, 18, 22 and 26°C and 72, 82, 87, and 92% relative humidity (RH). The susceptibility of hairy nightshade to inoculum levels, weed ontogeny, and sporangia production potential were also investigated. Late blight development varied among hairy nightshade, tomato and potato hosts. Pathogen infection rates ranged from 0.0325 to 0.4674 gompits/day (unit for quantifying infection rates), and were significantly (P &lt; 0.05) greater on potato and tomato than on hairy nightshade. Late blight severity was variably affected by RH. Disease levels on hairy nightshade varied with inoculum load; and ranged from 9 to 26% and 26 to 37% at low (5 × 103) and high (25 × 103) sporangia concentrations, respectively. Late blight was recorded irrespective of hairy nightshade ontogeny, and was significantly greater on 8–10 than 4–6‐week‐old plants. These results indicate that pathogen, environmental and host factors affect late blight development on hairy nightshade.

The potential role of native weed species and bumble bees (Bombus impatiens) on the epidemiology of Pepino mosaic virus

Surveys of native weed species growing in and within 30 m of tomato greenhouses infected with Pepino mosaic virus (PepMV) identified Solanum dulcamara (climbing nightshade), Solanum nigrum (black nightshade), and Solanum ptycanthum (eastern black nightshade) as susceptible host plants. All plants exhibited mild mosaic symptoms and virus was back-inoculated and confirmed in tomato (Lycopersicon esculentum). In transmission tests using both mechanical methods and bumblebees (Bombus impatiens), S. ptycanthum, Solanum sarrachoides (hairy nightshade), and Datura stramonium (jimsonweed) were infected. Weak positive assays by ELISA or DRT-PCR for Amaranthus blitoides (prostrate pigweed), Chenopodium album (lamb’s-quarters), and Plantago lanceolata (narrow-leaved plaintain) were possibly a result of either a hypersensitive localized response to infection or low level virus contamination by bees since the virus could not be recovered by back-inoculation into tomato. Bumblebees exposed to PepMV infected D. stramonium, S. ptycanthum, and S. sarrachoides successfully transmitted the virus back into the tomato. No over wintering perennial weed species were found to be natural hosts of PepMV, and build up of inoculum in the field is unlikely. Weeds do not appear to represent a significant role in the epidemiology of this disease in Ontario.

The C Terminus of the Polerovirus P5 Readthrough Domain Limits Virus Infection to the Phloem

Poleroviruses are restricted to vascular phloem tissues from which they are transmitted by their aphid vectors and are not transmissible mechanically. Phloem limitation has been attributed to the absence of virus proteins either facilitating movement or counteracting plant defense. The polerovirus capsid is composed of two forms of coat protein, the major P3 protein and the minor P3/P5 protein, a translational readthrough of P3. P3/P5 is required for insect transmission and acts in trans to facilitate long-distance virus movement in phloem tissue. Specific potato leafroll virus mutants lacking part or all of the P5 domain moved into and infected nonvascular mesophyll tissue when the source-sink relationship of the plant (Solanum sarrachoides) was altered by pruning, with the progeny virus now being transmissible mechanically. However, in a period of months, a phloem-specific distribution of the virus was reestablished in the absence of aphid transmission. Virus from the new phloem-limited infection showed compensatory mutations that would be expected to restore the production of full-length P3/P5 as well as the loss of mechanical transmissibility. The data support our hypothesis that phloem limitation in poleroviruses presumably does not result from a deficiency in the repertoire of virus genes but rather results from P3/P5 accumulation under selection in the infected plant, with the colateral effect of facilitating transmission by phloem-feeding aphid vectors.

Hairy Nightshade as a Potential Potato leafroll virus (Luteoviridae: Polerovirus) Inoculum Source in Pacific Northwest Potato Ecosystems

Hairy nightshade, Solanum sarrachoides, is a solanaceous weed found abundantly in Pacific Northwest potato ecosystems. It serves as a reservoir for one of the important potato viruses, Potato leafroll virus (PLRV) (Luteoviridae: Polerovirus), and its most important vector, the green peach aphid, Myzus persicae (Homoptera: Aphididae). Laboratory research indicated an increased green peach aphid settling and performance on S. sarrachoides than on potato. It also revealed that green peach aphids transmitted PLRV more efficiently from S. sarrachoides to potato than from potato to potato. To test the efficiency of S. sarrachoides as an inoculum source in the field, a two season (2004 and 2005) trial was conducted at Kimberly, Idaho. Two inoculum sources, PLRV-infected potato and PLRV-infected S. sarrachoides, were compared in this trial. Green peach aphid density and temporal and spatial PLRV spread were monitored at weekly intervals. Higher densities of green peach aphids were observed on plots with S. sarrachoides and inoculum sources (PLRV-infected S. sarrachoides and potato) than on plots without S. sarrachoides and inoculum sources. PLRV infection in plots with PLRV-infected S. sarrachoides was similar to or slightly higher than in plots with PLRV-infected potato as an inoculum source. Temporal and spatial PLRV spread was similar in plots with either inoculum source. Thus, S. sarrachoides is as efficient as or a better PLRV inoculum source than potato.