Small Acreage Research Articles

Open conversations: Finding ways to improve communication between family forest landowners and consulting foresters

Alabama is comprised of 23 million acres of forestland, of which family forest landowners (FFLs) own 56 % of that acreage. Therefore, FFLs are vital to maintaining the quality and diversity of Alabama's forests. However, FFLs possess varying attitudes towards management, value their land for different reasons, and have differing management objectives. In addition, FFLs are comprised of diverse backgrounds, own vastly different acreages, and fall within differing income brackets, all of which have been shown to affect management usage. This research aims to assess consulting foresters and FFLs in Alabama to learn why FFLs are hesitant to use consulting foresters for land management. It also aims to educate FFLs and consulting foresters in Alabama on better communicating their needs, services, and benefits. To study these two groups, a set of interviews and two surveys were used to collect perceptions, experiences, and needs. While consulting foresters are willing to work with smaller acreage, there are still constraints preventing management, and cost was mentioned by both groups. Still, FFLs are interested in consulting foresters' services, but many do not actively market FFLs. As a result, FFLs are unaware of the different types of forestry professionals, causing competition for consulting foresters who must be registered. Both consulting foresters and FFLs need to become more active in organizations, and consulting foresters need to adopt newer marketing techniques, while FFLs should seek more educational opportunities and opportunities to interact with consulting foresters directly.

Conservation status of three rare endemic Phaseolus bean (Leguminosae, Phaseoleae) species of Costa Rica

We aimed at an inventory of all populations of wild Phaseolus (bean) species in Costa Rica, in relation to future plant breeding. During the field work in 2003–2018, three new and rare bean species (i.e. P. albicarminus, P. angucianae and P. hygrophilus) were found in different montane forest habitats which originally occupy a small acreage. Field observations, together with satellite images, indicate deforestation due to coffee plantations or pastures. To date only eleven populations of these species are known, distributed along the Talamanca and Fila Cruces mountainous ranges, making them endemic. Their narrow distribution, deforestation affecting the original habitats, and occurrence outside established and enforced protected areas motivate the assessment of their conservation status as ‘Endangered' (EN).

The Utah Urban and Small Farms Conference: A Model for Small Acreage Producer Extension Programming

The Utah Urban and Small Farms Conference: A Model for Small Acreage Producer Extension Programming

The amplified effect of market size on innovation: A comparative analysis of pea and wheat seed value chains in France

CONTEXTDespite their interest for agro-ecological transition, grain legumes remain poorly cultivated in France. One reason is the low availability of seed innovations for farmers which, to a large extend, is related to the low incentives to innovate for these crops which represent a small acreage. OBJECTIVEIn this article, we analyze the link between market size and the efforts made to create, diffuse and value innovation. We compare two value chains related to two field crops in France that mainly differ in terms of market size, namely, pea and wheat. Our analysis focuses more specifically on the seed-related innovations created in the upstream part of these value chains. In both of these cases, innovation relies on multiple complementary activities carried out by different actors, including the creation of the innovation, the production and diffusion of technical knowledge, the production and distribution of the innovation, and its valorization by downstream users. METHODSThe two case studies on the pea and wheat sectors were conducted using a qualitative approach based on public documentation, 16 semistructured interviews with various actors in the innovation system of the two value chains and data on commercialized pea and wheat varieties. RESULTS AND CONCLUSIONWe show that the level of investment in each of these activities is highly related to market size. This result is first explained by the fact that part (if not all) of the cost of these activities is fixed; that is, these activity costs do not depend on the diffusion of innovation. This result is also explained by the complementarity of these activities, which makes the investment in one activity less beneficial if the investment in complementary activities is low. As a consequence, the effect of market size on innovation is self-reinforcing in those cases where innovation relies on different activities managed by different actors. SIGNIFICANCEIn agricultural sectors, where there is a need for innovations in both large and small markets, this result calls for an evolution of innovation funding mechanisms to attenuate the impact of market size.

Economic comparison of loblolly pine and solar power in South Georgia, United States

In the face of deforestation from urbanization and population growth, there is a potential for an additional loss of forests from solar power generation as forest landowners may look to alternative sources of income. We compare the profitability of loblolly pine (Pinus taeda) plantations and solar power generation in South Georgia. The analysis was completed at two different scales, one acre (0.405 ha) and five acres (2.02 ha), based on the large number of small acreage forest landowners in the state. The Land Expectation Values (LEVs over 25 years project cycle) for a 350 kW (occupying one acre or 0.405 ha) and a 1 MW (occupying five acres or 2.02 ha) solar power systems are -$30,183 and $29,607 at an 8 % interest rate, respectively. In comparison, LEVs for one acre (0.405 ha) and five acre (2.02 ha) loblolly pine stands (at the site index 80 ft/24.4 m) for the same rotation cycle are $1,380 and $6,900 at a 6 % interest rate and $611 and $3,055 at an 8 % interest rate, respectively. The potential profitability of solar power systems varies, depending on whether the solar generation and pricing are high enough to overcome the significant installation, upkeep, and recycling costs. Since the potential profitability of the larger-scale solar power systems is significantly higher than loblolly pine stands at around five acres, there is a chance that small family forest landowners could convert their forestlands into solar farms, especially if their forestlands are close to a high-capacity power transmission line. This information could feed into ongoing policy deliberations on promoting conservation and renewable energy generation at the state level and beyond.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

A crop water stress index based internet of things decision support system for precision irrigation of wine grape

The goal of irrigation for wine grape grown in arid or semiarid regions is to sustain vine survival and to optimize berry attributes for quality wine production. Precision irrigation of wine grape is impeded by the lack of a smart, decision support system (DSS) to remotely monitor vine water status. The objectives of this study were to: develop and field test an Internet of Things (IoT) DSS system for precision irrigation of wine grape. The IoT system was comprised of a suite of in situ sensors used to monitor real-time weather conditions, grapevine canopy temperature, soil moisture, and irrigation amount. Sensor data were collected and stored on a field deployed data logger that calculated a daily thermal Crop Water Stress Index (CWSI) for grapevine using a neural network model with real-time sensor data model inputs. The data logger also hosted, via a cellular modem, webpages showing a running, 12-day history of daily CWSI, fraction of available soil moisture (fASW), irrigation amount, and other sensor data. The webpages were accessible to vineyard managers via cell phone or computer. The CWSI based IoT DDS system was installed at two small acreage, commercial estate vineyards in southwestern Idaho USA over four growing seasons. At each vineyard site, the DSS was used daily by the vineyard irrigation manager to schedule irrigation events. Neither vineyard manager used any other quantitative vine water status monitoring tool for irrigation management decisions. The midday leaf water potential (LWP) of grapevines was routinely measured by research project personnel. Data collected over the study period at each vineyard showed a significant (p < 0.001) correlation with LWP and fASW, providing evidence that, under the conditions of this study, the daily CWSI based IoT provided automated, remote monitoring of vine water status. Both vineyard managers reported daily use of the DSS for irrigation scheduling decisions. Over the four-year study, each vineyard manager was able to maintain consistent seasonal average CWSI daily values and irrigation application amounts, despite yearly differences in climatic conditions. The results of this study demonstrate that a CWSI based IoT DSS can be used for precision irrigation of wine grape in a commercial vineyard under semiarid growing conditions. The CWSI based IoT DSS used a unique combination of neural network modeling, edge computing, and IoT for real-time vine water stress monitoring for precision irrigation.

Adapting to Social–Ecological Risks to the Conservation of a Muskmelon Landrace in India

Crop landraces are vanishing alarmingly worldwide, posing serious risks to the livelihoods of the resource-poor farmers; this study, conducted using ‘vulnerability’ and ‘resilience theory’ frameworks, sought to delineate social–ecological, climatic and policy hindrances to the conservation of a muskmelon landrace ‘Jaunpuri Netted’ traditionally grown in eastern Uttar Pradesh, India. Our results showed that the blue bull menace, market constraints and erratic rainfall have gradually emerged as severe stresses to the conservation of this muskmelon landrace. Yet, a set of enablers including relative ease in crop management, pleasant fruit taste, perceived livelihood opportunities and the cultural legacy seem to offset these stresses, at least partly, keeping the farmers engaged in muskmelon cultivation. The Tobid regression analysis revealed that educated farmers with large landholdings were likely to grow muskmelon on relatively small acreages, and that market constraints, blue bull menace and erratic rainfall are the major future risks to the muskmelon-based livelihoods. A growing obsession with higher fruit yields has led to the virtual eclipse of traditional crop management practices, further enhancing the vulnerability of muskmelon growers. Addressing these challenges requires some major changes to the ways in which the muskmelon crop is managed and traded. While muskmelon growers need to revisit the present chemical-intensive practices, adequate research and policy support remain requisite to unveiling the unique nutraceutical properties of this muskmelon landrace, promoting organic farming, reviving seed-based business opportunities, and creating strong market linkages to enhance the livelihood resilience of the muskmelon growers.

Spatial distribution of the relationship between nitrate residues in soil and surface water quality revealed through attenuation factors

Thanks to the intense efforts over the past decades to reduce nutrient losses, the annual average nitrate (NO3-) concentrations in the European surface waters have decreased between 1990 and 2010, but the reduction has levelled off since then. Nitrogen (N) mitigation measures adapted to the local conditions are needed to further reduce the N pressure from agriculture on surface water quality. The NO3--N residue measured before the onset of winter has been used as a simple indicator of the N pressure from agriculture. However, the vulnerability of a stream to NO3- inputs depends on dilution and reduction of NO3- during its transport towards the surface water, which can be expressed by the attenuation factor for surface water (AFsw), i.e. the ratio of the average NO3- concentration at the bottom of the rooting zone and the average NO3- concentration in the surface water. In this study, we combined NO3--N measurements in the soil in autumn, NO3- concentrations measured in the surface water during the winter period and a relatively simple soil-crop model to calculate AFsw at subcatchment level, in order to estimate the effect of mitigation measures without collecting detailed information on the subsoil and groundwater processes. Simulations demonstrated that in Flanders (the northern part of Belgium) the further optimisation of the N fertilisation rate is the most effective measure to reduce surface water NO3- concentrations. Maximising the acreage of catch crops had a limited additional effect on the NO3- concentrations in surface water given that this is already widely practiced at present. Although the removal of N rich crop residues is highly effective at field level, it contributed little to the reduction of NO3- concentrations in the surface water because of the small acreage of these crops. The implemented scenarios show that in subcatchments with low AFSw, targeted and subcatchment-specific combinations of measures, but including the trade-off with the potential economic and other negative effects, may not be sufficient to obtain acceptable NO3- concentrations in the surface water at subcatchment level. In regions with low AFsw, end–of-pipe technologies might be more cost-effective and even imperative to avoid the risk of eutrophication and a low surface water quality.

ASSESSING THE CONTRIBUTION OF DOLICHOS BEAN (Lablab purpureus L. (Sweet)) TO FOOD SECURITY IN A CHANGING CLIMATE IN KENYA

Lablab pupureus (L.), is a multipurpose drought tolerant legume which is considered as a minor crop in Kenya, hence, it is underutilized. In Kenya there are few known Lablab genotypes for specific environments. Choice of genotypes to grow is based on colour preference and seed availability, thus low yields are obtained. To assess the status of Lablab production in Kenya, a baseline survey was conducted in Lablab growing localities. A disproportionate stratified sampling was used and a questionnaire was administered to 108 respondents from diverse Lablab growing regions of Kenya. Performance of Lablab genotypes under different environmental conditions was also evaluated. Field trials of forty five (45) accessions of Lablab collected from Rift Valley, Eastern, Coast and Central regions of Kenya were established in three locations with different agro-ecological environments; (Nakuru, Uasin Gishu and Bungoma). The 45 accessions and three environments were factorially combined and replicated three times in a randomized complete block design (RCBD). Results from the survey indicate that most farmers (84.3%) grew Lablab in small acreage of less than 1.0 acre, and only 44.4% of the respondents used the improved Lablab cultivars which were obtained from the Ministry of Agriculture or research stations. Majority (88%) preferred Lablab to common beans and all respondents noted that Lablab fetched more income per unit quantity than common bean. All respondents utilized Lablab dry beans as food. The crop was also utilized as a livestock feed especially during the dry season when no other crops are in the farms by 51.9% of the respondents while 25% used it in conservation agriculture and for soil erosion control. About 20.4% of farmers used the leaves and green pods as vegetables. The study identified accessions that are suitable for different agroecological zones. In conclusion, Lablab is a crop that is climate resilient and contributes to food security in communities that grow it. It is recommended that dolichos should be promoted in Kenya as a climate change adaptation measure and for enhancing food security.

Insect Management for Onions, Leek, and Garlic

&#x0D; &#x0D; &#x0D; &#x0D; &#x0D; Sweet varieties of bulbing onions, which make bulbs under short day conditions and do not store well, are by far the most common onions grown in Florida. They are generally grown on small acreages in the winter for local and farmers markets. In Hillsborough County and in the Suwannee Valley, strawberry growers are the major producers of onions, many of which are harvested green. This 2-page fact sheet written by Xavier Martini and Susan Webb and published by the UF/IFAS Entomology and Nematology Department reviews the management of the two major onion pests in Florida: thrips and seedcorn maggot. https://edis.ifas.ufl.edu/ig153&#x0D; Previous versions:&#x0D; Webb, Susan. 2002. “Insect Management for Onions, Leek, and Garlic”. EDIS 2002 (1). https://doi.org/10.32473/edis-ig153-2002.&#x0D; Webb, S. 2005. “Insect Management for Onions, Leek, and Garlic”. EDIS 2005 (15). https://doi.org/10.32473/edis-ig153-2005.&#x0D; &#x0D; &#x0D; &#x0D; &#x0D;

Reducing postharvest food losses in organic spinach with the implementation of high tunnel production systems

Fresh produce constitutes 44% by weight of the global food losses and waste. Postharvest losses of fresh produce are closely related to the preharvest field conditions during growth. In the Central US, many small acreage vegetable growers are utilizing high tunnels, which have been successful in increasing the yield of several crops. Little is known about the effect of this production system on the postharvest losses. This study tested the hypothesis that the production system will affect the postharvest losses of organic spinach (Spinacia oleracea, “Corvair”) when stored at 3 or 13 °C. Comparative open field and high tunnel trials were conducted from 2015 to 2017. Postharvest losses were evaluated with regard to the spinach quality characteristics and shelf life. During storage at 3 °C, there were no major quality differences between the spinach grown in the two production systems. During storage at 13 °C, in both years, spinach grown in the high tunnels had 1.2 to 2.3% higher water content than spinach grown in the open field. In the second year, high tunnel spinach stored at 13 °C had a lower respiration rate (P < 0.05) and a slower rate of yellowing as indicated by higher chlorophyll content (P < 0.001), significantly lower lightness values, and significantly higher hue values than open field spinach. The high tunnel spinach demonstrated longer shelf life in year 1 and higher quality towards the end of storage in year two when compared to open field spinach when stored at 13 °C. This is the first study to examine the effect of the high tunnel production system on the postharvest quality and losses of spinach. Our results indicate that high tunnels can reduce the postharvest food losses of spinach when stored at 13 °C, due to increased water content and decreased senescence rate.

On the Production of Potassium Carbonate from Cocoa Pod Husks

Cocoa beans are found inside an outer husk; 60% of the cocoa fruit is the outer husk, which is a waste biomass. The husk cannot be used directly as a soil amendment as it promotes the fungal black pod disease, which reduces crop yield. The pods are segregated from the trees, and their plant nutrient value is wasted. This is particularly true for the small acreage farmers in West Africa. Cocoa pod husk is well suited to be used as a biomass source for electricity production. The waste ash is rich in potassium, which can be converted in various chemical products, most notably, high-purity potassium carbonate. This study reviews the information known about cocoa and cocoa pod husk, and considers the socio-economic implications of creating a local economy based on collecting the cocoa pod husk for electricity production, coupled with the processing of the waste ash into various products. The study demonstrates that the concept is feasible, and also identifies the local conditions required to create this sustainable economic process.

Phytotoxic Effect of Herbicides on Various Camelina [Camelina sativa (L.) Crantz] Genotypes and Plant Chlorophyll Fluorescence

Camelina is an oil plant classified as a minor crop. The small acreage is the main cause of the small amount of plant protection products that are registered for use on camelina plantations. This contributes to difficulties in the protection of this plant. In the conducted experiment, the genetic similarity of genotypes of camelina was compared. The effect of selected herbicides (propaquizafop at rate 70 g a.i. ha−1, quizalofop-p-ethyl at rate 50 g a.i. ha−1, clopyralid at rate 90 g a.i. ha−1, and picloram at rate 24 g a.i. ha−1 applied in the three-four-leaves growth stage of camelina) on six individual genotypes of the plant and plant chlorophyll fluorescence after the use of these substances was also determined. The Przybrodzka variety showed the lowest level of damage in the assessment carried out 42 days after herbicide application and the damages of plants after quizalofop-p-ethyl and propaquizafop was completely gone. The variety Przybrodzka had the lowest genetic similarity to all analyzed genotypes. In other cases, genetic similarity of analyzed genotypes could not be linked to herbicide-related damage. Picloram contributed to the greatest damage to test plants and had the greatest impact on the operation of photosystem II (PSII). However, the level of plant chlorophyll fluorescence parameter values indicates small PSII damage for all substances and the possibility of subsequent plant regeneration. The results of the presented research indicate that it is worth referring to several plant varieties in phytotoxicity studies of herbicides towards arable crops.

Phenolic Compounds of Soybean Seeds from Two European Countries and Their Antioxidant Properties.

There is only a small acreage of planted soybeans in northern Europe, as the global production of this crop is mainly dictated by the warmer temperatures needed for bountiful yields. The defense response of soybean plants to a cold climate entails the secretion of specific compounds which help mitigate oxidative stress, i.e., antioxidants, including phenolic compounds. The objective of this study was to examine differences in the concentrations of phenolic compounds, their antioxidant properties, and the concentration of key isoflavones (namely genistein, daidzein, malonyl daidzein, malonyl genistein, and daidzin) in the seeds of six soybean cultivars from two different regions of Europe, namely Poland and France. The total phenolic contents, isoflavone levels, and in vitro antioxidant capacities of soybean seeds from most of the investigated cultivars of northeast Europe were found to be greater than those from southwest Europe. The phenolic compounds of seed extracts are primarily responsible for the free-radical scavenging of soybeans. Factors regulating the production of phenolic compounds in the seeds have not been thoroughly elucidated. Hence, the results presented in this paper can be useful in the selection of soybean cultivars with higher levels of seed phenolics, because of their beneficial impact on human health and on the soybean’s defense mechanism against plant stresses.

Characterization of the Brazilian vegetable brassicas production chain

ABSTRACT Brassica crops worldwide provide the greatest diversity of products used by man derived from a single genus. Collectively, leafy, flower and root vegetables can be eaten fresh, cooked and processed. The production of these vegetables in Brazil has been growing exponentially in the last decades, due to its economic importance, with major production volumes in several states and a quick monetary return for growers in areas considered of small acreage. With expansion, a number of aspects, including demands for quality and safety of these foods introduce themselves, strictly attached to the forms of production, logistics and their appearance. To meet the challenges and list the trends within the activities of different agents, a multiple case study was held in the states of Amazon, Minas Gerais, Paraná and Rio de Janeiro. Altogether, 55 stakeholders were interviewed, along with the compilation of different sources of data to characterize this productive chain. Changes in the scenario are imperative in order to maintain the activity of overcoming years, being related to cultivars adaptation, plant health, productions costs and difficulties during the establishment of crops. To overcome these adversities, a collective effort in terms of organization, technology transfer and R&amp;D from official and private agents, technical assistance, and regional sanitary inspection is imperative, aiming, especially, in actions regarding themes like protected cultivation, mechanization/automation and adding value to products by processing and packaging, listed by stakeholders as priority.

Descriptive Analysis and Consumer Acceptability of Locally and Commercially Grown Spinach.

The consumer demand for locally grown fresh produce is continuously increasing in the United States. The high tunnel systems have been successfully utilized by small acreage growers for local production. Consumers are typically assessing appearance, freshness, flavor and aroma when purchasing produce. A common perception is that locally grown produce tastes better than nonlocal. However, there is not much evidence for supporting this claim. The objective of this study was to identify consumer acceptability and the sensory characteristics/differences of locally grown spinach in open field or in high tunnel and nonlocal commercially grown spinach. Spinach, Spinacia oleracea cv. "Corvair" was grown in open field and in high tunnel at Kansas State Univ. Olathe Horticulture Research and Extension Center (OHREC) in spring 2017 and the commercially grown spinach was purchased at a local retail store. A consumer study (n = 205) was conducted at Kansas State Univ., Olathe campus, and a descriptive sensory analysis was conducted by a highly trained descriptive analysis panel in the Center for Sensory Analysis and Consumer Behavior at Kansas State Univ., Manhattan campus, in spring 2017. The consumer test showed that high tunnel spinach scored significantly higher in overall liking (P < 0.0001), flavor liking (P < 0.0001), and texture liking (P < 0.05) when compared to open field and store purchased spinach. Descriptive analysis showed that locally grown spinach had higher intensity of attributes that indicate premium quality, such as green color and green/spinach flavors. Our results indicate that locally grown spinach was preferred from the consumers for its high organoleptic quality. PRACTICAL APPLICATION: Locally grown spinach demonstrated high intensity in a set of sensory attributes that suggest a product with premium organoleptic quality. Correspondingly to these results, consumers liked spinach produced locally in high tunnels the most. The results of this study can be used for developing marketing strategies that are aiming specifically to the consumer niche that is seeking fresh produce of high organoleptic quality.

Clubroot disease in Latin America: distribution and management strategies

Clubroot caused by Plasmodiophora brassicae is an important disease of cruciferous crops worldwide. In Latin America (from Mexico to Chile, including the Caribbean), most of the area in cruciferous crops is devoted to oilseed rape (Brassica napus; c. 230 600 ha) in Brazil, Chile, Paraguay, Uruguay and Argentina, while cruciferous vegetables such as cabbage, cauliflower, broccoli and Brussels sprouts (40 900 ha) are cropped intensively on small acreages across the region. Although clubroot is present in most Latin American countries, there have been very few studies of P. brassicae. Clubroot research in Latin America has focused mainly on adapting disease management strategies developed in temperate climates to tropical climates, including liming, biological control and genetic resistance. This review summarizes the management strategies used in Latin America to reduce the impact of clubroot, including novel strategies when compared with temperate regions, such as a crop rotation with aromatic plant species and the use of biological control with Trichoderma spp. Latin America has unique characteristics relative to temperate countries such as high humidity, warm temperatures and acidic soil that impact the interaction between P. brassicae and its plant hosts, so more research is required.

Advancing Primocane-fruiting Raspberry Production in the Intermountain West Using Spring Protection

Winter injury to raspberry floricanes commonly limits productivity in cold climates. Primocane-fruiting raspberries avoid winter injury by fruiting on first year canes, but fruit production in the high-elevation valleys of the Intermountain West is later than needed for local markets, and may be limited by early fall freezes. High tunnels were used for early spring heat to advance primocane growth and the fruiting season of two primocane-fruiting red raspberry cultivars. Tunnels were covered with plastic in March and April. Then, they were covered with shade cloth during fruit ripening. Tunnel-covered plots were compared with field plantings for primocane growth rate, fruiting season, yield, and fruit quality over two seasons. High tunnels increased cane growth rate, with the harvest season advanced by 18 to 26 days depending on season and cultivar, but they did not consistently affect the total season yield or fruit size. Low-cost two-season tunnels used in conjunction with early-season primocane-fruiting raspberries may provide a viable method for small acreage producers in harsh climates to reliably supply high-value seasonal raspberry markets.

Tactics for efficient agriculture outreach targeting small and midsize farmers; a case study in the Coachella Valley

A successful agriculture outreach program was implemented in the Coachella Valley among small acreage Hispanic farmers. The main objective of this program was to help farmers conserve water through active soil moisture monitoring through the use of tensiometers. To overcome the challenges of agriculture outreach, this project incorporated a one-on-one, hands-on approach with an individualized curriculum. By regularly visiting the farmers in their fields we were able to truly understand their needs and to demonstrate to them we were honestly concerned about the issues they face. This approach slowly made the farmers feel comfortable working with us and more receptive towards advice given. An important component of the project is to involve the farmer in the actual soil moisture monitoring as much as possible. By allowing farmers to actively monitor the moisture content of their soils, we were able to give the farmers a sense of empowerment and ownership of the project. This approach helped farmers trust the technology and feel comfortable using it to make irrigation decisions. Up to date, all of the participating farmers have reported using tensiometers as the main decision-making tool at the time of irrigation