Severe Congenital Neutropenia Patients Research Articles

Truncated CSF3 receptors induce pro-inflammatory responses in severe congenital neutropenia.

Severe congenital neutropenia (SCN) patients are prone to develop myelodysplastic syndrome (MDS) or acute myeloid leukaemia (AML). Leukaemic progression of SCN is associated with the early acquisition of CSF3R mutations in haematopoietic progenitor cells (HPCs), which truncate the colony-stimulating factor 3 receptor (CSF3R). These mutant clones may arise years before MDS/AML becomes overt. Introduction and activation of CSF3R truncation mutants in normal HPCs causes a clonally dominant myeloproliferative state in mice treated with CSF3. Paradoxically, in SCN patients receiving CSF3 therapy, clonal dominance of CSF3R mutant clones usually occurs only after the acquisition of additional mutations shortly before frank MDS or AML is diagnosed. To seek an explanation for this discrepancy, we introduced a patient-derived CSF3R-truncating mutation in ELANE-SCN and HAX1-SCN derived and control induced pluripotent stem cells and compared the CSF3 responses of HPCs generated from these lines. In contrast to CSF3R-mutant control HPCs, CSF3R-mutant HPCs from SCN patients do not show increased proliferation but display elevated levels of inflammatory signalling. Thus, activation of the truncated CSF3R in SCN-HPCs does not evoke clonal outgrowth but causes a sustained pro-inflammatory state, which has ramifications for how these CSF3R mutants contribute to the leukaemic transformation of SCN.

P1434: CORRECTION OF CONGENITAL NEUTROPENIA-RELATED GENES IN NAÏVE IPS CELLS DERIVED FROM PATIENTS USING VIRAL-FREE CRISPR/CAS9 GENE-EDITING SYSTEM

Background: Severe congenital neutropenia (SCN) is a rare haematological condition with a heterogeneous genetic background that often leads to severe impairment of the immune system. For patients who do not respond to standard treatment, the only possible therapy is allogeneic haematopoietic stem cell transplantation. SCN patients have an increased risk of the development of myelodysplastic syndrome or acute myelogenous leukaemia. Rare genetic disorders, such as SCN, require prioritising bone marrow failure diagnosis and therapy tailored to individual patients. Human induced pluripotent stem (iPS) cells are a promising prospect for future cell therapy in a wide range of diseases like congenital neutropenia for which there are currently no cures or effective therapies. Aims: The aim of this study was to develop potential treatment procedure based on the use of iPS cells generated from epithelial cells of patients with congenital neutropenia. Using mutation-specific gRNA and CRISPR-Cas9 system, we made an attempt to repair patients-derived iPS cells which may have potential for renewal of the corrected granulocyte population in the bone marrow. Methods: Patient-derived epithelial cells were reprogrammed with the EBV-derived oriP/EBNA-1 system carrying transcription factors. The transition of these cells into the naïve state was accomplished with the use of cell culture media supplemented with Leukaemia inhibitory factor, an inhibitor of Protein kinase C, small molecule activators of WNT, and inhibitors of ERK1/2 and JNK signaling pathways. CRISPR-Cas9 was used to repair mutations in patients-derived naïve iPS cells. Into the target cells, a specific sgRNA combined with eSpCas9 protein and HDR template was introduced via nucleofection with Lonza 4D Nucleofector, as a CRISPR enhancer, brefedrin A was used. To verify the efficiency of transfection and gene edition, the targeted region were analysed with Sanger sequencing (Fig. 1). Results: We have generated primed and naïve iPS cells from 7 patients with different severity of neutropenic phenotype and genetic background, 4 another samples are pending. The morphology of the iPSCs line (primed cells) displayed a typical ESC-like colony appearance comprised of tightly packed cells. Alkaline phosphatase and immunocytochemical staining confirmed that the reprogrammed cells express pluripotent stem cell markers and can differentiate into the three germ layers. We successfully repaired a mutation in ELANE gene in 4 out of 30 screened colonies as well as TCIRG1 gene in 3 out of 14 screened colonies. Additionally, for further functional studies, we generated a homozygotic ELANE p.Cys55Arg mutant, that might serve as a unique model of the genotype-phenotype gradient of elastase activity. Image:Summary/Conclusion: We have successfully generated and repaired iPS cells derived from patients with congenital neutropenia which might serve as a procedure with a great potential in the field of cell therapy tailored to individual patients.

Mutant allele knockout with novel CRISPR nuclease promotes myelopoiesis in ELANE neutropenia

Severe congenital neutropenia (SCN) is a life-threatening marrow failure disorder, usually caused by heterozygous mutations in ELANE. Potential genetic treatment strategies include biallelic knockout or gene correction via homology-directed repair (HDR). Such strategies, however, involve the potential loss of the essential function of the normal allele product or limited coverage of diverse monogenic mutations within the patient population, respectively. As an alternative, we have developed a novel CRISPR-based monoallelic knockout strategy that precisely targets the heterozygous sites of single-nucleotide polymorphisms (SNPs) associated with most ELANE mutated alleles. In vitro studies demonstrate that patients’ unedited hematopoietic CD34+ cells have significant abnormalities in differentiation and maturation, consistent with the hematopoietic defect in SCN patients. Selective knockout of the mutant ELANE allele alleviated these cellular abnormalities and resulted in about 50%–70% increase in normally functioning neutrophils (p < 0.0001). Genomic analysis confirmed that ELANE knockout was specific to the mutant allele and involved no off-targets. These results demonstrate the therapeutic potential of selective allele editing that may be applicable to SCN and other autosomal dominant disorders.

SERF1 Is Required for G-CSF Resistance of Start-Codon Mutant ELANE Granulocytic Precursors

▪Severe congenital neutropenia (SCN) is frequently associated with mutations in the ELANE gene encoding neutrophil elastase (NE), an azurophilic granule protein which represents a major fraction of all protein synthesized by neutrophilic promyelocytes and myelocytes. The reduction of mutant ELANE translation inversely correlates with neutrophil differentiation. Chronic administration of granulocyte colony-stimulating-factor (G-CSF) has been successfully used to treat some of these patients, especially those ones with mutations in C-terminus translating exons-4 and -5. Patients with proximal mutations of ELANE tend to be resistant to G-CSF therapy. The SCN pathobiology is poorly understood due to the lack of efficient disease animal models, and difficulty in obtaining relevant primary cell populations from patients. We have demonstrated that ELANE exon-3 mutations, sensitive to higher doses of G-CSF administration, cause maturation arrest and apoptosis of promyelocyte and myelocyte stages due to mutant NE inducing unfolded protein response (UPR) and endoplasmic reticulum (ER) stress. We have also shown that SCN patients with mutations in ELANE at its translation initiation codon (ELANE-ATG mut) result in synthesis of alternate truncated neutrophil elastase peptides from downstream in-frame ATG due to the presence of internal ribosomal entry sites. However, the mechanisms of SCN pathogenesis associated with mutations at the translation initiation codon of ELANE gene associated with G-CSF resistance remain unclear. We employed a disease-in-a-dish approach by directed hematopoietic and granulopoietic differentiation of gene edited (CRISPR/Cas9) isogenic patient-derived iPSC lines. We used four iPSC lines (healthy donor 28L and its start codon knock-in isogenic 28L-GTG; and patient-derived ATG mut SCN110 and its isogenic corrected line SCN110C) to evaluate if ELANE start codon mutations are both necessary and sufficient to cause disease pathogenesis, and to unravel the underlying molecular mechanisms. We found that myeloid precursors derived from 28-GTG and SCN110 iPSC lines generate low molecular weight truncated NE that is detected by a C-terminal region (C225-H238) specific anti-NE antibody (Ab). The survival, expansion and differentiation of ELANE start codon mutant hematopoietic progenitors were significantly reduced in cytokine supplemented in vitro myelopoiesis cultures, and the correction of the mutation (SCN110C) restored the granulocytic precursor expansion and differentiation. The reduced expansion in 28L-GTG and SCN110 lines was associated with both increased apoptosis and expression of proapoptotic BH3-only proteins in comparison to their isogenic 28L and SCN110C lines. However, this apoptosis was not associated with UPR/ER-stress in ELANE-ATG mut myeloid precursors. Granulopoietic differentiation of the 28L-GTG and SCN110 iPSC derived hematopoietic progenitors was significantly reduced, while it was rescued in corrected isogenic lines. Correlating with their clinical behavior, high-dose G-CSF in vitro did not restore the granulopoietic differentiation of ELANE ATG mutant hematopoietic progenitors. Mechanistically, 28L-GTG and SCN110 myeloid precursors contained high-molecular weight, sodium dodecyl sulfate (SDS) resistant NE bands that were detected by anti-NE Ab specific for the C-terminal (C225-238), but not the N-terminal region (C19-38), suggesting that truncated mutant NE generates insoluble NE aggregates. The association of truncated NE with classical autophagy marker LC3B strongly suggested the activation of an aggrephagy process in these cells. We found that SERF1 (small EDRK-rich factor), an RNA-chaperoning protein, known to localize in misfolded protein aggregates of neurodegenerative diseases, was highly upregulated in GTG knock-in and SCN patient myeloid precursors. SERF1 was distributed in both nucleus and cytoplasm, co-localized and physically interacted with mutant truncated NE in the cytoplasm of ELANE-ATG mut cells as shown by proximity ligation assays. Silencing of SERF1 made the survival and differentiation of 28L-GTG and SCN110 derived myeloid precursors sensitive to G-CSF. ELANE translation initiation mutant was associated with truncated NE aggregates and induced apoptosis mediated by SERF1. This data opens a path for therapeutic intervention of G-CSF resistant ELANEmut SCN. DisclosuresKalfa: Agios Pharmaceuticals, Inc.: Other: Steering Committee, Research Funding; FORMA Therapeutics, Inc: Research Funding. Lutzko: Aruvant Sciences: Patents & Royalties: preclinical vector development. Cancelas: Hemerus LLC: Research Funding; Vascular Solutions Inc.: Research Funding; Westat Inc: Research Funding; Fresenius-Kabi LLC: Research Funding; Cytosorbents Inc: Research Funding; Hemanext: Membership on an entity's Board of Directors or advisory committees, Research Funding; TerumoBCT: Research Funding; Cerus Co: Research Funding; University of South Florida/MEQU Inc: Research Funding.

Safe and Efficient Engraftment of CRISPR-Based ELANE Mono-Allelic Knocked out HSCs in Mice: Evidence for a Novel Treatment for ELANE Neutropenia

ELANE-related severe congenital neutropenia (SCN) is a disorder wherein numerous heterozygous mutations in the ELANE gene lead to misfolding and mislocalization of mutant neutrophil elastase, resulting in the death of myeloid cells and block in neutrophil differentiation.Currently, SCN is treated with daily injections of granulocyte colony-stimulating factor (G-CSF), but patients on this therapy are at risk of developing myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). The only other effective therapy is allogeneic hematopoietic stem cell transplantation that may involve graft versus host disease and risk of serious infections. Thus, there is great interest in safe and efficient therapeutic alternatives.Emendo Biotherapeutics has developed a novel CRISPR-based (OMNI A1) ex-vivo gene editing strategy that involves specific excision of disease-causing ELANE mutant allele. This treatment was tested on CD34 + HSCs from SCN patients and resulted in a significant improvement in the maturation of myeloid cells and their differentiation to normal functional neutrophils.To assess the feasibility and safety of this editing strategy, we conducted an in vivo study using human HSCs derived from two healthy donors that were engrafted into a NOD scid gamma (NSG) immunocompromised mice model. The study involved a single iv injection of HSCs that were either not-treated (NT), electroporated without delivery of CRISPR nuclease (mock) or edited with Emendo's novel nuclease, OMNI A1,(excision). Each group consisted of 6 NSG female mice and an additional group of 4 mice served as vehicle control (no HSCs). All animals were subjected to total body irradiation, 1 day prior to the treatment, at a dose of 250 cGy. Animals were subjected to retro-orbital blood collection, at 4 designated time points during the study (Figure A), for CD45 + cell counts using FACS. All animals were evaluated for systemic reactions, clinical signs and body weight changes during the study period. At the end of the study period, animals were subjected to peripheral blood (PB), bone marrow (BM) and spleen sampling. FACS analysis of CD45 + cells was performed on those samples to determine the engraftment efficiency. Furthermore, excision levels for ELANE were measured in the engrafted cells by droplet digital PCR (ddPCR). Finally, multilineage differentiation capacity of the engrafted cells was evaluated by FACS.Analysis of human CD45 + cells, at 20 weeks, showed comparable levels of engraftment of the not-treated, mock treated and excised HSCs in the mouse PB, BM and spleen (No statistically significant difference, Kruskal Wallis test) (Figure B). Excised cells were detected in the mouse BM and excision levels in some of the mice were comparable to those measured in the HSCs prior to engraftment (about 30-36%). Human-derived cells from the BM and spleen of mice engrafted with excised HSCs showed similar multilineage differentiation capacity as obtained in mice engrafted with either NT or mock-treated HSCs. Engrafted human CD45 + cells differentiated into neutrophils (CD66b +), myeloid cells (CD33 +), Lymphocytes: B-cells (CD19 +) and T-cells (CD3 +). In addition, a population of engrafted hematopoietic CD34 + cells was detected in the BM. Excised HSCs of both donors gave rise to all lineages tested, as efficient as the NT and the mock groups. Finally, engrafted mice showed no systemic reactions, abnormal clinical signs or loss of body weight.These data show that edited cells can be engrafted successfully, maintain their excision profile and populate the bone marrow. This study also supports the safety of the OMNI A1 therapeutic composition. [Display omitted] DisclosuresPovodovski: Emendo Biotherapeutic: Current Employment. Makaryan: Emendo Biotherapeutic: Research Funding. Sabo: Emendo Biotherapeutic: Research Funding. Dicken: Emendo Biotherapeutic: Ended employment in the past 24 months. Herman: Emendo Biotherapeutic: Current Employment. Emmanuel: Emendo Biotherapeutic: Current Employment. Dale: X4 Pharmaceuticals: Consultancy, Honoraria, Research Funding.

Reduced ELANE and SLPI expression compromises dental pulp cell activity.

BackgroundPatients with ELANE variants and severe congenital neutropenia (SCN) commonly develop oral complications. Whether they are caused only by low neutrophil count or the combination of neutropenia and aberrant dental cells is unknown.MethodsGenetic variant was identified with exome sequencing. Dental pulp cells isolated from the SCN patient with an ELANE mutation were investigated for gene expression, enzyme activity, proliferation, colony formation, wound healing, apoptosis, ROS, attachment, spreading and response to lipopolysaccharide.ResultsELANE cells had diminished expression of ELANE and SLPI and reduced neutrophil elastase activity. Moreover, ELANE cells exhibited impaired proliferation, colony forming, migration, attachment and spreading; and significantly increased ROS formation and apoptosis, corresponding with increased Cyclin D1 and MMP2 levels. The intrinsic levels of TGF‐β1 and TNF‐α were significantly increased; however, IL‐6, IL‐8 and NF‐kB1 were significantly decreased in ELANE cells compared with those in controls. After exposure to lipopolysaccharide, ELANE cells grew larger, progressed to more advanced cell spreading stages and showed significantly increased SLPI, TNF‐α and NF‐kB1 and tremendously increased IL‐6 and IL‐8 expression, compared with controls.ConclusionThis study, for the first time, suggests that in addition to neutropenia, the aberrant levels and functions of ELANE, SLPI and their downstream molecules in pulp cells play an important role in oral complications in SCN patients. In addition, pulp cells with diminished neutrophil elastase and SLPI are highly responsive to inflammation.

Combinatorial CSF3R and RUNX1 Mutations Involved in the Leukemic Progression of Severe Congenital Neutropenia Confer a G-CSF-Dependent Premalignant State in Mice

Background: Severe congenital neutropenia (SCN) is a genetically heterogeneous disorder characterized by a lack of peripheral neutrophils, leading to life-threatening bacterial infections. The disease is alleviated by sustained G-CSF treatment, which restores neutrophil production in the majority of patients. While on G-CSF therapy, SCN patients frequently develop hematopoietic clones with acquired CSF3R mutations. The appearance of CSF3R mutant clones is seen in multiple genetic subtypes of SCN and is strongly associated with progression towards MDS or AML. At this stage, CSF3R mutant clones acquire secondary mutations, most often (in ~75% of cases) in RUNX1 . The majority of these mutations affect the Runt homology domain (RHD) of RUNX1. This combination of CSF3R and RUNX1 mutations is exclusively seen in SCN/MDS/AML, suggesting a unique pattern of leukemic progression of SCN. However, the molecular and cellular consequences of combined CSF3R and RUNX1 mutations and the effects of sustained G-CSF therapy on leukemia development are unknown.Aim: To determine the cooperative role of CSF3R and RUNX1 mutations in sequential steps of malignant transformation in vivo and to investigate how sustained G-CSF therapy affects this process.Methods: We used our previously generated Csf3r -d715 mouse strain, which copies the most frequent G-CSFR truncation mutant in SCN patients. Lethally irradiated wild type mice were transplanted with Csf3r-d715 HSPCs transduced with an IRES-GFP backbone lentiviral vector expressing RHD mutant RUNX1-D171N or empty vector control. Mice were treated 3x per week with G-CSF or PBS (solvent control). Biweekly, peripheral blood (PB) samples were analyzed for GFP-marked engraftment, immunophenotypes and cytology. At regular intervals, in vitro progenitor cell colony assays were performed. Bone marrow (BM) and spleen samples were used for phenotypic analyses and secondary transplantations. RNA-seq experiments were carried out on FACS purified LK populations to identify molecular pathways associated with the observed phenotypes.Results: Mice transplanted with Csf3r -d715/ RUNX1 -D171N (RHD mutant) BM cells started to accumulate GFP-marked Lin negative, c-Kit positive (LK) progenitor cells in the PB, 6 weeks after initiation of G-CSF treatment. The percentages of GFP+ LK cells in the PB ranged from 0.7% to 27.8% (Mean=5.9%; n=11) and fluctuated over time in individual mice, indicating that they were maintained but not vastly expansive at this stage. This phenotype was fully dependent on the combined presence of the Csf3r and RUNX1 mutations and was only seen in the G-CSF treated mice. The PB-LK cells had a blast-like morphology and formed myeloid colonies in semi-solid cultures. Transcriptome analysis of in vitro expanded LK cells by RNA-seq and gene set enrichment analysis (GSEA) showed that the combination of Csf3r -d715 and RUNX1 -D171N mutations and G-CSF stimulation selectively enhanced c-Myc , NF-κB and E2F1-driven transcriptional programs. Of note, fully differentiated GFP-positive neutrophils were also formed, both in vitro and in vivo and mice did not succumb to this pre-leukemic condition. Csf3r -d715/ RUNX1 -D171N BM cells isolated after 30 weeks could successfully engraft secondary recipients (n=6), again resulting in sustained G-CSF dependent accumulation of immature blast (LK) cells in the PB. In these mice, the blast cells in the BM exceeded 85% at week 7 after initiation of G-CSF treatment. At this stage, the blasts had become entirely defective in neutrophil differentiation, indicating that they had now undergone full transformation to AML. RNA-seq and genomic analyses of these AML blasts are currently underway to assess the molecular steps involved in the transition from the premalignant to the fully transformed state.Conclusion: The combination of Csf3r -d715 and RUNX1 -D171N (RHD) mutations frequently seen in SCN/MDS/AML perturbs myeloid development in an in vivo transplant model in a G-CSF dependent manner. A sustained pre-leukemic state characterized by the selective accumulation of LK cells is seen in primary recipients, followed by a fully transformed AML phenotype in secondary recipients. This model is attractive for unraveling the molecular steps of malignant transformation driven by CSF3R and RUNX1 mutations and for preclinical testing of new therapeutic options for SCN/AML. DisclosuresNo relevant conflicts of interest to declare.

Establishment of the Safe and Efficient CRISPR/Cas9-RNP Based Gene-Correction Platform of ELANE Mutations in iPSCs of Severe Congenital Neutropenia (CN) Patients with No Response to G-CSF and High Risk to Develop Leukemia

Severe congenital neutropenia (CN) is a monogenic pre-leukemia bone marrow failure syndrome characterized by an absolute neutrophil count (ANC) below 500 cells per microliter and recurrent, life-threatening bacterial infections. Treatment with recombinant human granulocyte colony-stimulating factor (rhG-CSF) increases ANC in the majority of CN patients and dramatically improves the quality of life. However, some CN patients do not respond or respond only poorly to G-CSF and should be treated by bone marrow transplantation (BMT). In some cases, “G-CSF no-responder” CN patients fail to engraft bone marrow transplant and no therapeutic options for these patients remain. Therefore, establishment of the alternative therapeutic approaches for these patients is indispensable.Many underlying genetic defects have been identified in CN. Autosomal dominant ELANE mutations have been identified in a majority of CN patient. Some ELANE mutations (e.g. p.A57V, p.C151Y, p.G214ter) are associated with no response or poor response to G-CSF therapy or high frequency of leukemia development.In the present study, we established a DNA- and virus-free clinical-grade gene correction approach of these phenotypically severe ELANE mutations in induced pluripotent stem cells (iPSCs) of CN patients using CRISPR/Cas9-based technology. We used ribonucleoprotein (RNP) form of CRISPR Cas9 as a safe tool to correct ELANE mutations. For this, we generated and characterized iPSCs from ELANE -CN patients harboring p.C151Y and p.G214ter ELANE mutations. We used embryoid body (EB)-based hematopoietic differentiation method to evaluate granulocytic differentiation of CN-patients specific iPSCs. Granulocytic differentiation was studied by absolute live cell counts, FACS analysis of myeloid-specific surface markers expression levels, CFU assay, cell morphology of cytospin preparations and nitroblue tetrazolium (NBT) assay. We found markedly diminished granulocytic differentiation of ELANE -CN iPSCs (ELANE mutations p.C151Y and p.G214ter), as compared to healthy individuals. We designed and generated repair templates and specific Crispr-RNA (crRNA) for the fourth (GGGACGCCGCCTGGGCAACG) and fifth (GGACGAAGGAGGCAATTTCG) exons of ELANE for correction of mutations p.C151Y and p.G214R, respectively and made efficient Crispr-Cas9 Ribonucleoprotein (RNP) complexes to edit the mutations along with ssODN repair templates.We further established gentle and efficient transfection of iPSCs from CN patients with ELANE -mutations specific-CRISPR/Cas9 ribonucleoprotein (RNP) complexes. We also developed simple and fast screening method for the selection of the ELANE gene corrected single iPSCs clones using restriction fragment length polymorphism (RFLP) analysis and Cas9 in vitro digestion technique. Selected clones were further analyzed for granulocytic differentiation. Up to now, we compared myeloid differentiation of iPSCs generated from healthy individuals with iPSCs from one CN- ELANE patient (p.C151Y) before- and after correction of ELANE mutation. We found that correction of ELANE mutation resulted in fully normalized granulocytic differentiation, that was in line with normalized levels of ELANE mRNA, correction of previously increased unfolded protein response (UPR)-activated gene expression, such as CHOP, ATF4, BIP, and reduction of elevated STAT5A levels in the ELANE corrected cells.Taken together, we established a safe and efficient CRISPR/Cas9-RNP based ELANE gene-correction platform of iPSCs of ELANE -CN patients that may provide novel stem cell-based therapy for CN patients with high risk of leukemia development as well as for G-CSF-non-responsive patients. This platform may be also applied for treatment of patients with other monogenic bone marrow failure syndromes. DisclosuresNo relevant conflicts of interest to declare.

BAALC Is a Key Mediator of Leukemia Development in Congenital Neutropenia

We recently reported high frequency of cooperating acquired CSF3R and RUNX1 mutations in severe congenital neutropenia (CN) patients that developed AML or MDS. CN is a pre-leukemic bone marrow failure syndrome (BMFS) and longitudinal retrospective analysis of CN bone marrow samples allows identification of the pathological intracellular events that lead to leukemogenic transformation.In the present study, we report the identification of a key mechanism of leukemogenesis in CN. We made use of the induced pluripotent stem cell (iPSC) model and embryoid body (EB)-based in vitro hematopoietic differentiation of iPSCs generated from a CN patient harboring ELANE mutation before (CN-iPSCs) and after (CN/AML-iPSCs) overt AML. CN/AML-iPSCs clones revealed CSF3R and RUNX1 mutations and trisomy 21. EB-based hematopoietic differentiation revealed that CN-iPSCs produced similar amounts of CD34+ cells, but approximately 2-fold reduction of mature granulocytes and CFU-G colonies in CFU-assay, as compared to healthy donor-derived iPSCs. CN/AML-iPSCs produced CD34+ cells but did not differentiate into mature granulocytes at all.Analysis of the gene expression profiles of five CN/AML patients including our index patient, revealed that genes upregulated in early hematopoietic stem/progenitor cells (HSPCs), such as Brain And Acute Leukemia, Cytoplasmic (BAALC), Hematopoietic Prostaglandin D Synthase (HPGDS), Natriuretic Peptide Receptor 3 (NPR3) and CD109 were markedly increased in CN/AML blasts harboring both RUNX1 and CSF3R mutations, as compared to hematopoietic cells prior to leukemia. This genetic signature suggests transformation of hematopoietic cells into more primitive hematopoietic progenitors after acquisition of CSF3R and RUNX1 mutations. We were able to confirm strong increase of BAALC, HPGDS, NPR3 and CD109 mRNA levels in CD34+ cells derived from CN/AML-iPSCs, as compared to CN-iPSCs, suggesting that our iPSC-model is reliable to study leukemogenesis.In order to evaluate which of these candidate genes (BAALC, HPGDS, NPR3 and CD109)is responsible for the leukemogenic transformation in CN, we generated CN/AML-iPSCs clones deficient for one selected genes. We established CRISPR-Cas9-mediated gene knockout using transfection of CN/AML-iPSCs with pSpCas9(BB)-2A-GFP vector expressing Cas9 and sgRNA, that were designed to specifically target first exon of each candidate gene. CN/AML-iPSCs transfected with specific sgRNAs were sorted and single cell clones were analyzed further.Knockout of the selected genes did not affect survival and pluripotency of CN/AML-iPSCs and we were able to study EB-based hematopoietic differentiation of gene-edited CN/AML-iPSCs clones. Interestingly, knockout of HPGDS, NPR3 or CD109 did not correct defective granulocytic differentiation of CN/AML-iPSCs, whereas knockout of BAALC in CN/AML-iPSCs resulted in the tremendous increase of the granulocytic differentiation, as assessed by FACS, CFU assay, morphological analysis of cytospin preparations and nitroblue tetrazolium (NBT) assay. Granulocytic differentiation of BAALC -deficient CN/AML-iPSCs was comparable to CN-iPSCs, but was still reduced in comparison to healthy donor-derived iPSCs.These data clearly showed that knockout of BAALC in CN/AML-iPSCs overcomes differentiation block at the early hematopoietic progenitor cell stage, demonstrating a fundamental role of BAALC in leukemia development in CN. BAALC, HPGDS and CD109 are known to be markedly up-regulated in RUNX1 -mutated de novo AML and qRT-PCR of CD34+ cells generated from BAALC -knockout CN/AML-iPSCs revealed a decrease of mRNA expression levels of BAALC, HPGDS and CD109 . At the same time, knockout of RUNX1 in CN/AML-iPSCs using CRISPR/Cas9-editing revealed even higher decrease of mRNA levels of BAALC, NPR3 and CD109 . These data suggest that HPGDS and CD109 up-regulation is downstream of RUNX1 -mediated BAALC induction in AML.Taken together, we established a reliable in vitro model to study leukemogenesis in the pre-leukemic BMFS, using CN as an example. With the help of this model, we identified BAALC up-regulation as a key “leukemogenic” factor downstream of RUNX1 and CSF3R mutations. Based on these observations, we conclude that inhibition of BAALC in hematopoietic cells of CN patients may prevent leukemogenic transformation of hematopoiesis or eliminate AML blasts in CN-AML. DisclosuresNo relevant conflicts of interest to declare.

Dissecting ELANE neutropenia pathogenicity by human HSC gene editing.

Severe congenital neutropenia (SCN) is a life-threatening disorder most often caused by dominant mutations of ELANE that interfere with neutrophil maturation. We conducted a pooled CRISPR screen in human hematopoietic stem and progenitor cells (HSPCs) that correlated ELANE mutations with neutrophil maturation potential. Highly efficient gene editing of early exons elicited nonsense-mediated decay (NMD), overcame neutrophil maturation arrest in HSPCs from ELANE-mutant SCN patients, and produced normal hematopoietic engraftment function. Conversely, terminal exon frameshift alleles that mimic SCN-associated mutations escaped NMD, recapitulated neutrophil maturation arrest, and established an animal model of ELANE-mutant SCN. Surprisingly, only -1 frame insertions or deletions (indels) impeded neutrophil maturation, whereas -2 frame late exon indels repressed translation and supported neutrophil maturation. Gene editing of primary HSPCs allowed faithful identification of variant pathogenicity to clarify molecular mechanisms of disease and encourage a universal therapeutic approach to ELANE-mutant neutropenia, returning normal neutrophil production and preserving HSPC function.

Nicotinamide (vitamin B3) treatment improves response to G‐CSF in severe congenital neutropenia patients

Nicotinamide (vitamin B3) treatment improves response to G‐CSF in severe congenital neutropenia patients

Hematopoietic stem cell transplantation for inherited bone marrow failure syndromes: alternative donor and disease-specific conditioning regimen with unmanipulated grafts

ABSTRACT Objective: The outcomes of alternative donor hematopoietic stem cell transplantation (HSCT) with unmanipulated grafts for Inherited bone marrow failure syndromes (IBMFS) are discouraging. Our study is to demonstrate that IBMFS with disease-specific characteristics requires a tailored conditioning regimens to enhance engraftment and reduce regimen related toxicities. Methods: We retrospectively analyzed 42 patients diagnosed with IBMFS and transplanted with an alternative donor graft at our center from November 2012 to August 2018. Twenty-seven patients had Fanconi anemia (FA), 7 had dyskeratosis congenita (DC), and 8 had severe congenital neutropenia (SCN). Patients received ex-vivo unmanipulated alternative donor grafts from a matched unrelated donor (MUD) (n = 22), haploidentical donor (HID) (n = 17) and unrelated cord blood donor (UCBD) (n = 3). FA and DC patient subgroups received reduce intensified conditioning (RIC), while SCN patients received a myeloablative conditioning (MAC) regimen. Results: The median follow-up time for the surviving patients was 38 months (range: 9–63 months). The failure-free survival (FFS) for entire cohort was 76.1%, and was 72.4%, 100% and 56.2% for patients with FA, DC and SCN, respectively. There were no primary graft failures. The cumulative incidence of aGVHD at day 100 was 48.1%. The cumulative incidence of cGVHD at 1 and 3 years was 35.0% and 69.3%, respectively. Conclusion: HSCT using alternative donors with unmanipulated grafts and disease-specific conditioning regimens for IBMFS patients shows promising survival.

JAGN1 mutations in severe congenital neutropenia.

Severe congenital neutropenia (SCN) was first clinically described in 1956 by Swedish pediatrician Rolf Kostmann, who recognized that infants who suffered from severe bacterial infections with absolute neutrophil counts (ANC) persistently below 0.5 × 109/l represented an inherited genetic disorder.1 SCN is now known to be caused by mutations in at least 25 genes and has autosomal recessive (AR), autosomal dominant (AD) and X-linked forms.2 The most common cause is due to AD mutations in the neutrophil elastase gene, ELANE, while the original disease Kostmann described was found to be due to AR mutations in HAX1.3, 4 Many of the genes causing SCN appear to be involved in endoplasmic reticulum (ER) or mitochondrial function and their disruption is involved in increasing ER stress and enhancing neutrophil apoptosis. In this issue the paper by Khandagale et al.5 whole exome sequencing techniques were applied to 27 AR SCN patients and three were found to have homozygous mutations in jagunal homolog 1 (JAGN1) which was first described as a cause of SCN in 2014 by Boztug et al.6 Jagunal was originally described as being critical for oocyte development in Drosophila via its role in ER reorganization.7 This new study further enhances our knowledge of how JAGN1 mutations can lead to ER stress and intracellular calcium activation of calpain that leads to apoptosis of myeloid cells. The experiments reported here utilized patient neutrophils, human bone marrow and the HL-60 cell line (derived from a human acute promyelocytic leukemia) to demonstrate aberrant neutrophil granules and a predilection to higher cytosolic calcium upon stimulation and enhanced calpain-dependent apoptosis in the presence of the mutant JAGN1 which could be blocked by addition of a specific inhibitor (PD150606) or by silencing JAGN1. It is of note that knocking down JAGN1 with small interfering (si)-RNA did not affect susceptibility of HL-60 cells to cell death, suggesting a dominant pathophysiologic effect of patient mutant JAGN1 on a calpain-mediated process despite an autosomal recessive pattern of inheritance. Khandagale et al. have achieved a very important breakthrough in understanding how JAGN1 mutations promote a non-apoptotic, calpain-dependent form of cell death. The authors acknowledge that further work will be needed to fully understand this pathway. The mainstay of treatment for SCN has been filgrastim since its approval by the FDA in 1991.8 It is a recombinant human granulocyte-stimulating factor that must be injected. While improving quality of life and survival by enhancing numbers and function of neutrophils in most types of SCN, long-term use has been associated with patients being at increasing risk of clonal myeloid disorders and malignancies.9 Whether this is a direct toxicity or due to prolonged survival of the patients allowing evolution of malignant clones from the prolonged pathophysiologic stress from effects of the underlying mutation remains controversial. Other experimental treatments may be appropriate in carefully selected SCN patients such as small-molecule CXCR4 inhibitors such as plerixafor or mavorixafor for WHIM syndrome,10 empagliflozin for G6PT deficiency,11 and perhaps neutrophil elastase inhibitors such as alvelestat for ELANE mutations or JAGN1 inhibitors for mutant JAGN1. Bone marrow transplantation can cure SCN, but is limited by the availability of suitable donors, and is associated with the risk of graft-versus-host disease, infectious mortality and other complications which will be improved by utilizing more specific conditioning regimens.12 Donor availability has been made less of a concern since haploidentical transplant has become more common. Genetic correction of neutrophil gene defects has already been successfully undertaken13 and may be even more practical in the future. In AD SCN, recent evidence suggests deletion of the disease allele may be a simple and effective technique without need to specifically correct the gene defect. In the case of WHIM syndrome, evidence suggests that removal of one copy of CXCR4 enhances haematopoietic stem cell engraftment and survival without the need for conditioning.14 Similarly, editing and removal of ELANE may be curative in the future.15

Evaluation of periodontal status and cytokine/chemokine profile of GCF in patients with severe congenital neutropenia.

Severe congenital neutropenia (SCN) is a primary immunodeficiency characterized by defect in neutrophil count. Increased risk of infections in addition to periodontal problems, such as ulcerations of oral mucosa, gingival inflammation, and rapid loss of attachment are common in the course of the disease. The aim of the present study is to define the causal relationship between the severity of periodontal inflammation and severe congenital neutropenia through identification of cytokine profile in gingival crevicular fluid (GCF). A case-control study was performed in patients diagnosed with SCN and healthy controls. Demographic data, the molecular defect, laboratory work-up were gathered from the hospital registry. Periodontal indices were recorded and GCF samples were analyzed using multiplex analysis for the simultaneous measurements of the particular cytokines and chemokines. The present study included 14 patients and 22 control subjects. Both groups were comparable in terms of age and sex. Severity of gingival inflammation measured by the criteria of Löe was higher in the SCN cases (p < 0.05). Moreover, GCF levels of IFN-α, TNF-α, IL-10, IL-13, IL-15, IL-17, IL-2, IL-7, IL-33, IP-10, MIG, MIP-1β were significantly higher in the controls. Decreased cytokine secretion seems to correlate with the decrease in neutrophil counts. The severity of gingival inflammation in SCN patients may be due to the bacterial overgrowth and the change in the content of the oral flora due to the decreased neutrophil counts. Therefore, regular periodontal examinations, the motivation of oral hygiene as well as the compliance with therapy in SCN patients contribute to the periodontal health.

Nicotinamide (NA) Treatment Improves Response to G-CSF in Severe Congenital Neutropenia (SCN) Patients

Background: SCN is an inherited bone marrow failure syndrome with markedly reduced granulocyte numbers and functions that often manifests with life-threatening bacterial infections. G-CSF treatment is the primary therapeutic approach, yet some SCN patients require high doses of G-CSF which increases the risk of acute myeloid leukemia development, or do not respond to GCSF at al. We have demonstrated that nicotinamide (NA) treatment increases granulocyte numbers in healthy volunteers. Aim: To asses the effect of NA treatment in SCN and cyclic neutropenia (CyN) patients. Methods: 15 SCN and three CyN patients ages 0.5 to 31 (M-5.47) years were orally treated with 20 mg/kg/day of NA in addition to G-CSF therapy. G-CSF dose varied between 0.6 and 50.8 µg/kg/day before start of NA treatment. Results: After three months of NA treatment, absolute neutrophil counts (ANC) increased from median 0.80 x 109/l (Q1 0.61, Q3 1.29 x 109/l) to 1.77 x 109/l (Q1 1.49, Q3 2.33 x 109/l) (p &amp;lt; 0.001). This allowed G-CSF dose reduction from 15 µg/kg/day (Q1 5, Q3 25 µg/kg/day) to 10 µg/kg/day (Q1 1.77, Q3 15.16 µg/kg/day) in 17 patients, and complete G-CSF tapering in one patient. After one year of observations, ANC were 1.50 x 109/l (Q1 0.99, Q3 2.86 x 109/l), median increase of ANC from start of therapy was 0.89 x 109/l fold (Q1 0.39, Q3 1.57; р = 0.004). NA was well tolerated, without severe adverse events. We also observed a marked reduction of the frequency and severity of bacterial infections upon combination of NA and G-CSF. Conclusions: In our group of SCN/CyN patients, NA treatment led to increased neutrophil counts and decreased required G-CSF doses with continuous clinical and laboratory responses. We also observed a reduction of the frequency and severity of bacterial infections. Therefore, the use of NA in combination with a reduced dose of G-CSF for the treatment of SCN and CyN patients is promising and should be further investigated in a larger cohort of patients. Disclosures No relevant conflicts of interest to declare.

CRISPR Mediated ELANE Single-Allele Knock-out Restores Proliferation and Myeloid Differentiation of Neutropenia Patient Derived BM HSCs

Background: Mutations in ELANE are a cause of cyclic and severe congenital neutropenia (SCN), predominantly autosomal dominant disorders. ELANE encodes neutrophil elastase (NE), a tissue specific serine protease. Neutropenia occurs because mutant NE impairs survival and maturation of myeloid cells. More than 130 disease causing mutations in ELANE have been identified and cell permeable inhibitors of NE can correct the defect in cell survival and maturation in cellular models. (Makaryan et al. J Leukoc Biol. 2017;102:1143). CRISPR/Cas9 knock-out (KO) of ELANE in patients' hematopoietic stem cells (HSCs) corrects myeloid cell differentiation, (Nasri et al Haematologica 2020:105:598), but this approach targets both alleles, eliminates normal NE and may impair innate immunity. Hypothesis: Selective, single allele editing is a preferred strategy for correcting ELANE associated neutropenia and other autosomal dominant disorders. Methods: Emendo Biotherapeutics developed CRISPR-associated allele specific KO based on single nucleotide polymorphisms (SNPs) located in the vicinity of ELANE. Three SNPs cover ~80% of the population. In the current study, editing of the mutated allele was achieved by targeting SNP rs1683564 located downstream to the 3'UTR of ELANE and mediating a biallelic break in intron 4, with excision of the 3'UTR, destabilized the mutated allele transcript. For editing we utilized RNPs assembled from Emendo's proprietary nuclease, OMNI-50, a guide targeting the SNP and a guide targeting a region in intron 4. OMNI-50 has low off-target activity and high allele specific editing when targeting either the reference or the alternative form of the SNPs. The efficacy of this composition was tested on normal and SCN patient-derived HSCs harboring the relevant SNP. (Figure 1) A patient's bone marrow CD34+ cells with the S126L mutation and rs1683564 were enriched using RosetteSep™ Progenitor Cell Enrichment Cocktail (Stemcell Technologies), purified by density gradient centrifugation using Lymphoprep (Stemcell Technologies). The purified CD34+ cells were expanded 4 days in StemSpan™ SFEM II media, supplemented with StemSpan™ CD34+ Expansion Supplement. Expanded CD34+ cells were further purified using StemSep™ Human CD34 Positive Cocktail and purity verified by FACS analysis using CD34 and CD45 antibodies. Purified CD34+ cells were cryopreserved using serum free CryoStor® CS10 media (Stemcell Technologies) and stored in Liquid Nitrogen Vapor Phase. Normal human blood CD34+ progenitor cells, harboring rs1683564 were similarly treated as the control. Allele specific excision was determined by ddPCR. To determine excision efficiency for the patient and control, we amplified two regions in ELANE, Exon 1 and Exon 5 (excised region), using two different probes labeled with FAM and HEX, respectively. We used OMNI-50 nuclease (Emendo Bio, Ness Ziona, Israel), electroporation (Lonza 4D nucleofector) and StemCell media (Stemcell Technologies, Vancouver, BC) to modify, grow and differentiate the CD34+ cells. We assessed myeloid cell proliferation and differentiation using daily cell counts, cytospins stained with Diff-Quik, and CD14, CD66b, CD15, CD16, CD11b labeling and flow cytometry. Results: Unedited patient cells demonstrated significant abnormalities in proliferation and differentiation. Cytospins from unedited patient CD34+ cells at 14 days showed block of myeloid differentiation and 4-fold greater monocytes compared to control, consistent with the hematopoietic defect in SCN patients. Single allele ELANE KO significantly improved these cellular abnormalities: total cell proliferation increased 41% and CD14/CD66b and CD15/CD11b positive cells increased by 107% and 65.5%, respectively. Studies are in progress for additional patients harboring different ELANE mutations. Conclusions: Single allele KO may resolve concerns about unwanted effects of total elimination of the normal gene products with gene editing for autosomal dominant diseases and be an effective strategy for treating ELANE associate neutropenia. Disclosures Sabo: Emendo BioTherapeutics: Research Funding. Makaryan:Emendo BioTherapeutics: Research Funding. Poulsen:Emendo BioTherapeutics: Research Funding. Povodovski:Emendo BioTherapeutics: Current Employment, Current equity holder in private company. Dicken:Emendo BioTherapeutics: Current Employment, Current equity holder in private company. Herman:Emendo BioTherapeutics: Current Employment, Current equity holder in private company. Emmanuel:Emendo BioTherapeutics: Current Employment, Current equity holder in private company. Dale:X4 Pharmaceuticals: Research Funding; Emendo BioTherapeutics: Consultancy; X4 Pharmaceuticals: Honoraria.

CRISPR-Cas9-Mediated ELANE Mutation Correction in Hematopoietic Stem and Progenitor Cells to Treat Severe Congenital Neutropenia

Severe congenital neutropenia (SCN) is a monogenic disorder. SCN patients are prone to recurrent life-threatening infections. The main causes of SCN are autosomal dominant mutations in the ELANE gene that lead to a block in neutrophil differentiation. In this study, we use CRISPR-Cas9 ribonucleoproteins and adeno-associated virus (AAV)6 as a donor template delivery system to repair the ELANEL172P mutation in SCN patient-derived hematopoietic stem and progenitor cells (HSPCs). We used a single guide RNA (sgRNA) specifically targeting the mutant allele, and an sgRNA targeting exon 4 of ELANE. Using the latter sgRNA, ∼34% of the known ELANE mutations can in principle be repaired. We achieved gene correction efficiencies of up to 40% (with sgELANE-ex4) and 56% (with sgELANE-L172P) in the SCN patient-derived HSPCs. Gene repair restored neutrophil differentiation in vitro and in vivo upon HSPC transplantation into humanized mice. Mature edited neutrophils expressed normal elastase levels and behaved normally in functional assays. Thus, we provide a proof of principle for using CRISPR-Cas9 to correct ELANE mutations in patient-derived HSPCs, which may translate into gene therapy for SCN.

Evaluation of the effects of mesenchymal stem cells on neutrophils isolated from severe congenital neutropenia patients

Neutrophils are the most abundant, yet with the shortest lifespan among the circulating leukocytes. These cells are produced in the bone marrow during granulopoiesis process. Severe congenital neutropenia (SCN) is a hematological disorder with disturbance in granulopoiesis process, in which the neutrophils apoptosis rate is escalated. Previous reports indicated that mesenchymal stem cells (MSCs), as an immunomodulator cell, could increase neutrophil lifespan in addition to the supportive effects on cardiomyocytes or the neuroprotective effects. In this study, MSCs were co-cultured with neutrophils isolated from SCN patients and healthy individuals. Then, we evaluated the MSC co-culture effects on neutrophils survival (annexin V/PI assay), reactive oxygen species (ROS) production (colorimetric NBT assay), and phagocytic activity (Giemsa staining after exposure to yeasts). It was demonstrated that MSC co-culture could increase neutrophil lifespan and phagocytic activity of the neutrophils isolated from SCN patients. Regarding healthy donors’ neutrophils, only phagocytic activity improvement was seen. It could be concluded that MSCs could be considered as novel candidates for treatment of SCN patients.

Dysbiosis of the Oral Ecosystem in Severe Congenital Neutropenia Patients.

PurposeTo decipher the underlying immunological mechanisms in predisposition to oral microbial dysbiosis in severe congenital neutropenia (SCN) patients.Experimental DesignTen SCN patients (5–23 years old) and 12 healthy controls (5–22 years old) are periodontally examined and provided saliva, subgingival plaque, and gingival crevicular fluid (GCF) samples. The SCN patients received oral hygiene therapy and are re‐evaluated after 6 months. Antimicrobial peptides HPN1‐3 and LL‐37 are assessed in saliva by ELISA. Concentration of 30 cytokines is measured in saliva and GCF by human 30‐plex panel, while bacterial profiles of saliva and subgingival plaque are assessed using 16S rDNA amplicon sequencing.ResultsThere is no significant difference in salivary HPN1‐3 and LL‐37 concentration between the SCN patients and controls. At baseline, clinical, immunological, and microbiological parameters of the patients are indicative of oral ecological dysbiosis. The SCN patients have significantly higher bleeding on probing (BOP)%, GCF volume, and cytokine levels, high bacterial load with low bacterial diversity in saliva. The associations between the microbiome and immunological parameters in the SCN patients differ from those in the healthy individuals.Conclusions and Clinical RelevanceSCN patients have a dysregulated immune response toward commensal oral microbiota, which could be responsible for the observed clinical and microbiological signs of dysbiosis.

Lentiviral gene therapy and vitamin B3 treatment enable granulocytic differentiation of G6PC3-deficient induced pluripotent stem cells.

Induced pluripotent stem cells (iPSCs) from patients with genetic disorders are a valuable source for in vitro disease models, which enable drug testing and validation of gene and cell therapies. We generated iPSCs from a severe congenital neutropenia (SCN) patient, who presented with a nonsense mutation in the glucose-6-phosphatase catalytic subunit 3 (G6PC3) gene causing profound defects in granulopoiesis, associated with increased susceptibility of neutrophils to apoptosis. Generated SCN iPSC clones exhibited the capacity to differentiate into hematopoietic cells of the myeloid lineage and we identified two cytokine conditions, i.e., using granulocyte-colony stimulating factor or granulocyte-macrophage colony stimulating factor in combination with interleukin-3, to model the SCN phenotype in vitro. Reduced numbers of granulocytes were produced by SCN iPSCs compared with control iPSCs in both settings, which reflected the phenotype in patients. Interestingly, our model showed increased monocyte/macrophage production from the SCN iPSCs. Most importantly, lentiviral genetic correction of SCN iPSCs with a codon-optimized G6PC3 transgene restored granulopoiesis and reduced apoptosis of in vitro differentiated myeloid cells. Moreover, addition of vitamin B3 clearly induced granulocytic differentiation of SCN iPSCs and increased the number of neutrophils to levels comparable with those obtained from healthy control iPSCs. In summary, we established an iPSC-derived in vitro disease model, which will serve as a tool to test the potency of alternative treatment options for SCN patients, such as small molecules and gene therapeutic vectors.