RNA-dependent RNA Polymerase Sequences Research Articles

Using artificial intelligence to document the hidden RNA virosphere.

Current metagenomic tools can fail to identify highly divergent RNA viruses. We developed a deep learning algorithm, termed LucaProt, to discover highly divergent RNA-dependent RNA polymerase (RdRP) sequences in 10,487 metatranscriptomes generated from diverse global ecosystems. LucaProt integrates both sequence and predicted structural information, enabling the accurate detection of RdRP sequences. Using this approach, we identified 161,979 potential RNA virus species and 180 RNA virus supergroups, including many previously poorly studied groups, as well as RNA virus genomes of exceptional length (up to 47,250 nucleotides) and genomic complexity. A subset of these novel RNA viruses was confirmed by RT-PCR and RNA/DNA sequencing. Newly discovered RNA viruses were present in diverse environments, including air, hot springs, and hydrothermal vents, with virus diversity and abundance varying substantially among ecosystems. This study advances virus discovery, highlights the scale of the virosphere, and provides computational tools to better document the global RNA virome.

First Report on Detection and Molecular Characterization of Astroviruses in Mongooses.

Applying a pan-astrovirus (AstV) RT-hemi-nested PCR assay, we report here high detection rates (28.3%, 15/53) of AstVs in the small Indian mongoose (Urva auropunctata) on the Caribbean Island of St. Kitts. Based on deduced amino acid (aa) identities and phylogenetic analysis of long RNA-dependent RNA polymerase (RdRp) sequences (~315 aa, partial RdRp), the AstVs detected in the mongooses (designated as Mon-AstVs) were classified into two distinct groups (deduced aa identities of 66.45-67.30% between the groups). The putative RdRps of the Mon-AstVs shared low deduced aa identities with those of AstVs from other host species (<69%, <54%, and <50% identities with reptilian/amphibian AstVs, avastroviruses, and mamastroviruses, respectively). Phylogenetically, the group-I and group-II Mon-AstVs formed two distinct clusters, near the cluster of reptilian/amphibian AstVs, and were distantly related to avastroviruses and mamastroviruses. Since the mongooses were apparently healthy during sampling, we could not establish if the Mon-AstVs infected the animal or were of dietary origin. Although we could not ascertain the true host of the Mon-AstVs, phylogenetic analysis indicated that these viruses might have originated from lower vertebrates. To our knowledge, this is the first report on the detection and molecular characterization of AstVs in mongooses, highlighting the wide host range and significant genetic diversity within the family Astroviridae.

Metatranscriptomic Sequencing of Sheath Blight-Associated Isolates of Rhizoctonia solani Revealed Multi-Infection by Diverse Groups of RNA Viruses.

Rice sheath blight, caused by the soil-borne fungus Rhizoctonia solani (teleomorph: Thanatephorus cucumeris, Basidiomycota), is one of the most devastating phytopathogenic fungal diseases and causes yield loss. Here, we report on a very high prevalence (100%) of potential virus-associated double-stranded RNA (dsRNA) elements for a collection of 39 fungal strains of R. solani from the rice sheath blight samples from at least four major rice-growing areas in the Philippines and a reference isolate from the International Rice Research Institute, showing different colony phenotypes. Their dsRNA profiles suggested the presence of multiple viral infections among these Philippine R. solani populations. Using next-generation sequencing, the viral sequences of the three representative R. solani strains (Ilo-Rs-6, Tar-Rs-3, and Tar-Rs-5) from different rice-growing areas revealed the presence of at least 36 viruses or virus-like agents, with the Tar-Rs-3 strain harboring the largest number of viruses (at least 20 in total). These mycoviruses or their candidates are believed to have single-stranded RNA or dsRNA genomes and they belong to or are associated with the orders Martellivirales, Hepelivirales, Durnavirales, Cryppavirales, Ourlivirales, and Ghabrivirales based on their coding-complete RNA-dependent RNA polymerase sequences. The complete genome sequences of two novel RNA viruses belonging to the proposed family Phlegiviridae and family Mitoviridae were determined.

Novel Aquareovirus isolated from channel catfish (Ictalurus punctatus) used in mussel restoration efforts in Wisconsin.

Channel catfish (Ictalurus punctatus) are a food fish extensively reared in aquaculture facilities throughout the world and are also among the most abundant wild catfish species in North America, making them a popular target of anglers. Furthermore, channel catfish are important members of aquatic ecosystems; for example, they serve as a glochidial host for the endangered winged mapleleaf mussel (Quadrula fragosa), making them critical for conserving this species through hatchery-based restoration efforts. During a routine health inspection, a novel aquareovirus was isolated from channel catfish used in mussel propagation efforts at a fish hatchery in Wisconsin. This virus was isolated on brown bullhead cells (ATCC CCL-59) and identified through metagenomic sequencing as a novel member of the family Spinareoviridae, genus Aquareovirus. The virus genome consists of 11 segments, as is typical of the aquareoviruses, with phylogenetic relationships based on RNA-dependent RNA polymerase and major outer capsid protein amino acid sequences showing it to be most closely related to golden shiner virus (aquareovirus C) and aquareovirus C/American grass carp reovirus (aquareovirus G) respectively. The potential of the new virus, which we name genictpun virus 1 (GNIPV-1), to cause disease in channel catfish or other species remains unknown.

Metatranscriptomic data mining together with microfluidic card uncovered the potential pathogens and seasonal RNA viral ecology in a drinking water source.

Despite metatranscriptomics becoming an emerging tool for pathogen surveillance, very little is known about the feasibility of this approach for understanding the fate of human-derived pathogens in drinking water sources. We conducted multiplexed microfluidic cards and metatranscriptomic sequencing of the drinking water source in a border city of North Korea in four seasons. Microfluidic card detected norovirus, hepatitis B virus (HBV), enterovirus, and Vibrio cholerae in the water. Phylogenetic analyses showed that environmental-derived sequences from norovirus GII.17, genotype C of HBV, and coxsackievirus A6 (CA6) were genetically related to the local clinical isolates. Meanwhile, metatranscriptomic assembly suggested that several bacterial pathogens, including Acinetobacter johnsonii and V. cholerae might be prevalent in the studied region. Metatranscriptomic analysis recovered 349 species-level groups with substantial viral diversity without detection of norovirus, HBV, and CA6. Seasonally distinct virus communities were also found. Specifically, 126, 73, 126, and 457 types of viruses were identified in spring, summer, autumn, and winter, respectively. The viromes were dominated by the Pisuviricota phylum, including members from Marnaviridae, Dicistroviridae, Luteoviridae, Potyviridae, Picornaviridae, Astroviridae, and Picobirnaviridae families. Further phylogenetic analyses of RNA (Ribonucleic Acid)-dependent RNA polymerase (RdRp) sequences showed a diverse set of picorna-like viruses associated with shellfish, of which several novel picorna-like viruses were also identified. Additionally, potential animal pathogens, including infectious bronchitis virus, Bat dicibavirus, Bat nodavirus, Bat picornavirus 2, infectious bursal disease virus, and Macrobrachium rosenbergii nodavirus were also identified. Our data illustrate the divergence between microfluidic cards and metatranscriptomics, highlighting that the combination of both methods facilitates the source tracking of human viruses in challenging settings without sufficient clinical surveillance.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Complete genome sequence of triticum yellow stripe virus, a new polerovirus infecting wheat (triticum aestivum) in China

Wheat plants with yellow stripes on their leaves were collected in the city of Tai'an (Shandong province, China). High-throughput sequencing analysis of the collected plants showed that they were coinfected with wheat leaf yellowing-associated virus (WLYaV) and an unidentified polerovirus. The genome of the unidentified virus, tentatively named "triticum yellow stripe virus" (TriYSV), comprises 5,595 nucleotides and contains seven open reading frames (ORFs), with a typical polerovirus genome structure. Analysis by sequence alignment showed that TriYSV had the highest sequence similarity to wheat yellow dwarf virus (WYDV, a tentative member of the genus Polerovirus), with 87.3% nucleotide sequence identity over the whole genome. Except for P3a and the coat protein (CP), all of the proteins encoded by TriYSV showed < 90% amino acid identity to those of other poleroviruses. Phylogenetic analysis based on RNA-dependent RNA polymerase and CP amino acid sequences and complete genome nucleotide sequences showed that the poleroviruses WYDV, cereal yellow dwarf virus RPS (CYDV-RPS), CYDV-RPV, and barley yellow dwarf virus GPV are the most closely related to TriYSV. Thus, TriYSV is proposed to be a new member of the genus Polerovirus.

RNA silencing proteins and small RNAs in oomycete plant pathogens and biocontrol agents.

Oomycetes cause several damaging diseases of plants and animals, and some species also act as biocontrol agents on insects, fungi, and other oomycetes. RNA silencing is increasingly being shown to play a role in the pathogenicity of Phytophthora species, either through trans-boundary movement of small RNAs (sRNAs) or through expression regulation of infection promoting effectors. To gain a wider understanding of RNA silencing in oomycete species with more diverse hosts, we mined genome assemblies for Dicer-like (DCL), Argonaute (AGO), and RNA dependent RNA polymerase (RDRP) proteins from Phytophthora plurivora, Ph. cactorum, Ph. colocasiae, Pythium oligandrum, Py. periplocum, and Lagenidium giganteum. Moreover, we sequenced small RNAs from the mycelium stage in each of these species. Each of the species possessed a single DCL protein, but they differed in the number and sequence of AGOs and RDRPs. SRNAs of 21nt, 25nt, and 26nt were prevalent in all oomycetes analyzed, but the relative abundance and 5' base preference of these classes differed markedly between genera. Most sRNAs mapped to transposons and other repeats, signifying that the major role for RNA silencing in oomycetes is to limit the expansion of these elements. We also found that sRNAs may act to regulate the expression of duplicated genes. Other sRNAs mapped to several gene families, and this number was higher in Pythium spp., suggesting a role of RNA silencing in regulating gene expression. Genes for most effector classes were the source of sRNAs of variable size, but some gene families showed a preference for specific classes of sRNAs, such as 25/26 nt sRNAs targeting RxLR effector genes in Phytophthora species. Novel miRNA-like RNAs (milRNAs) were discovered in all species, and two were predicted to target transcripts for RxLR effectors in Ph. plurivora and Ph. cactorum, indicating a putative role in regulating infection. Moreover, milRNAs from the biocontrol Pythium species had matches in the predicted transcriptome of Phytophthora infestans and Botrytis cinerea, and L. giganteum milRNAs matched candidate genes in the mosquito Aedes aegypti. This suggests that trans-boundary RNA silencing may have a role in the biocontrol action of these oomycetes.

A novel statovirus identified in fecal samples from wild geladas in the Ethiopian highlands.

We present a novel statovirus in geladas (Theropithecus gelada), graminivorous primates endemic to the Ethiopian highlands. Using a high-throughput sequencing approach, we identified contiguous sequences in feces from two adult female geladas in the Simien Mountains National Park, Ethiopia, that share similarities to statoviruses. Our phylogenetic analysis of the whole genome, as well as the RNA-dependent RNA polymerase (RdRp) and capsid protein (CP) amino acid sequences, revealed that the gelada statoviruses cluster with those from other primates (laboratory populations of Macaca nemestrina and Macaca mulatta). As the first report of statovirus in wild primates, this finding contributes to our understanding of the phylogenetic and geographic distribution of statoviruses and their hosts.

RdRp-scan: A bioinformatic resource to identify and annotate divergent RNA viruses in metagenomic sequence data.

Despite a rapid expansion in the number of documented viruses following the advent of metagenomic sequencing, the identification and annotation of highly divergent RNA viruses remain challenging, particularly from poorly characterized hosts and environmental samples. Protein structures are more conserved than primary sequence data, such that structure-based comparisons provide an opportunity to reveal the viral 'dusk matter': viral sequences with low, but detectable, levels of sequence identity to known viruses with available protein structures. Here, we present a new open computational resource-RdRp-scan-that contains a standardized bioinformatic toolkit to identify and annotate divergent RNA viruses in metagenomic sequence data based on the detection of RNA-dependent RNA polymerase (RdRp) sequences. By combining RdRp-specific hidden Markov models (HMMs) and structural comparisons, we show that RdRp-scan can efficiently detect RdRp sequences with identity levels as low as 10 per cent to those from known viruses and not identifiable using standard sequence-to-sequence comparisons. In addition, to facilitate the annotation and placement of newly detected and divergent virus-like sequences into the diversity of RNA viruses, RdRp-scan provides new custom and curated databases of viral RdRp sequences and core motifs, as well as pre-built RdRp multiple sequence alignments. In parallel, our analysis of the sequence diversity detected by the RdRp-scan revealed that while most of the taxonomically unassigned RdRps fell into pre-established clusters, some fell into potentially new orders of RNA viruses related to the Wolframvirales and Tolivirales. Finally, a survey of the conserved A, B, and C RdRp motifs within the RdRp-scan sequence database revealed additional variations of both sequence and position that might provide new insights into the structure, function, and evolution of viral polymerases.

Complete sequence and genome characterization of a new potexvirus isolated from Chaenostoma cordatum.

Leaves from the ornamental plant Chaenostoma cordatum (Thunb.) Benth. expressing virus-like symptoms were collected for pathogen testing. A virus with features consistent with those of members of the genus Potexvirus was identified by high-throughput sequencing. The genome sequence was confirmed and completed using RT-PCR, cloning, rapid amplification of cDNA ends kits, and Sanger sequencing, revealing a complete viral genome of 6,071 nucleotides, excluding the poly-A tail. Phylogenetic analysis of the RNA-dependent RNA polymerase sequence from the viral genome indicated that its closest relative is Plantago asiatica mosaic virus. Further analysis of the nucleotide and amino acid sequences revealed that it had diverged enough from other potexviruses to be considered a member of a new species.

First Report of Capsicum chlorosis virus Infecting Chromolaena odorata in Yunnan, China.

Capsicum chlorosis virus (CaCV) is a negative sense ssRNA virus belonging to the genus Orthotospovirus in the family Tospoviridae. It was first discovered in Australia, and then reported in other places including Thailand, China, India, Greece, and United States (Zheng et al.2011; Melzer et al.2014; Chrysoula et al. 2018; Abudurexiti et al. 2019). CaCV infects plants of the families Amaranthaceae, Apocynaceae, Chenopodiaceae, Cucurbitaceae, Amaryllidaceae, Fabaceae and Solanaceae (Basavaraj et al. 2017; Basavaraj et al. 2020). Chromolaena odorata L. (commonly known as Feiji cao in China) is an invasive weedy herb that belongs to the genus Eupatorium (family Asteraceae), and is native to Central America. In May 2020, serrated chlorotic ring and chlorotic ringspots resembling symptoms of orthotospovirus infection (Supplementary Figure 1) was observed on the leaves of C. odorata plants in Honghe County, Yunnan. Three symptomatic leaf samples were collected and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using antisera targeting Tomato spotted wilt virus (TSWV), Calla lily chlorotic spot virus (CCSV), Capsicum chlorosis virus (CaCV), and Tomato zonate spot virus (TZSV) (Proteintech Group, Inc., China). Buffer solution and healthy leaves were used as a blank and negative controls, respectively. All three symptomatic samples showed positive reactions with only CaCV antiserum (OD450 of 0.315-0.345 relative to 0.078 and 0.076 for healthy plants and the blank control, respectively. The total RNA extracted from the positive samples were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using generic primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435c (CATDGCRCAAGARTGRTARACAGA) which were designed to amplify partial L segment encoding the RNA-dependent RNA polymerase (RdRP) of orthotospoviruses (Chu, et al. 2001). The expected ~800 bp DNA fragment was amplified from all three positive samples by RT-PCR. The amplified DNA was cloned and sequenced. BLAST search of the partial L RNA sequence (GenBank acc. nos. MW964378 to MW964380) revealed that they shared 86.2-97.4% nucleotide (nt) and 97.2-100% amino acid (aa) sequence identities with different isolates of CaCV available in GenBank with CaCV chili isolates (KU941834 to KU941836) from India sharing the highest aa identity of 100%. This confirmed the presence of CaCV in the symptomatic C. odorata plants. The 825 bp complete nucleocapsid protein (NP) of CaCV was also amplified from the samples using primers CaCV-F: ATGTCTAMCGTYAGGCAAC and CaCV-R: TYACACYTCWATAGAWGTACTAG) (Basavaraj et al. 2020), cloned, and sequenced to obtain complete S fragment-nucleocapsid protein (NP) with a size of 825 bp (MW964381 to MW964383). The pairwise comparisons of three fragments showed 85.1-98.3% nt and 87.6-99.6% aa sequence identities with different isolates of CaCV. Maximum-Likelihood phylogenetic trees inferred from the partial RdRP and complete NP aa sequences showed that the C. odorata isolates (CaCV-YN) clustered closely with CaCV tomato isolate from Taiwan and tomato (Yuxi-2013) isolate from China, respectively (Supplementary Figure 1). To our knowledge, this is the first time CaCV has been detected in C. odorata. This study will serve as an important reference for the study of host range of CaCV. Further studies will be required to determine whether thrips could transmit CaCV between C. odorata and other hosts of the virus.

Virus-derived sequences from the transcriptomes of two snail vectors of schistosomiasis, Biomphalaria pfeifferi and Bulinus globosus from Kenya.

Schistosomiasis, which infects more than 230 million people, is vectored by freshwater snails. We identified viral sequences in the transcriptomes of Biomphalaria pfeifferi (BP) and Bulinus globosus (BuG), two of the world’s most important schistosomiasis vectors in Africa. Sequences from 26 snails generated using Illumina Hi-Seq or 454 sequencing were assembled using Trinity and CAP3 and putative virus sequences were identified using a bioinformatics pipeline. Phylogenetic analyses were performed using viral RNA-dependent RNA polymerase and coat protein sequences to establish relatedness between virus sequences identified and those of known viruses. Viral sequences were identified from the entire snail holobiont, including symbionts, ingested material and organisms passively associated with the snails. Sequences derived from more than 17 different viruses were found including five near full-length genomes, most of which were small RNA viruses with positive sense RNA genomes (i.e., picorna-like viruses) and some of which are likely derived from adherent or ingested diatoms. Based on phylogenetic analysis, five of these viruses (including BPV2 and BuGV2) along with four Biomphalaria glabrata viruses reported previously, cluster with known invertebrate viruses and are putative viruses of snails. The presence of RNA sequences derived from four of these novel viruses in samples was confirmed. Identification of the genome sequences of candidate snail viruses provides a first step toward characterization of additional gastropod viruses, including from species of biomedical significance.

MERS-related CoVs in hedgehogs from Hubei Province, China

The emerging coronavirus diseases such as COVID-19, MERS, and SARS indicated that animal coronaviruses (CoVs) spillover to humans are a huge threat to public health. Therefore, we needed to understand the CoVs carried by various animals. Wild hedgehogs were collected from rural areas in Wuhan and Xianning cities in Hubei Province for analysis of CoVs. PCR results showed that 5 out of 51 (9.8%) hedgehogs (Erinaceus amurensis) were positive to CoVs in Hubei Province with 3 samples from Wuhan City and 2 samples from Xianning City. Phylogenetic analysis based on the partial sequence of RNA-dependent RNA polymerase showed that the CoVs from hedgehogs are classified into Merbecovirus of the genus Betacoronavirus; the hedgehog CoVs formed a phylogenetic sister cluster with human MERS-CoVs and bat MERS-related CoVs. Among the 12 most critical residues of receptor binding domain in MERS-CoV for binding human Dipeptidyl peptidase 4, 3 residuals were conserved between the hedgehog MERS-related CoV obtained in this study and the human MERS-CoV. We concluded that hedgehogs from Hubei Province carried MERS-related CoVs, indicating that hedgehogs might be important in the evolution and transmission of MERS-CoVs, and continuous surveillance of CoVs in hedgehogs was important.

Molecular characterization of anovel polymycovirus from the phytopathogenic fungus Setosphaeria turcica.

A putative polymycovirus tentatively named "Setosphaeria turcica polymycovirus 1" (StPmV1) was discovered in the phytopathogenic fungus Setosphaeria turcica. StPmV1 has a genome comprising five double-stranded RNAs (dsRNAs). dsRNA1, 2, and 3 each encode a protein sharing significant similarity but lower than 64% sequence identity to the corresponding proteins of other polymycoviruses. dsRNA4 and 5 each encode a protein with a sequence that is not conserved among polymycoviruses. However, the protein encoded by dsRNA4 is rich in proline (P), alanine (A), and serine (S) residues, which is a feature shared by the so-called PAS-rich proteins encoded by all polymycoviruses. Phylogeny reconstruction using the RNA-dependent RNA polymerase (RdRp) sequences of accepted or putative polymycoviruses revealed that StPmV1 is most closely related to Plasmopara viticola lesion associated polymycovirus 1 (PvaPolymyco1), a putative polymycovirus recovered from the phytopathogenic oomycetes Plasmopara viticola. These data suggest that StPmV1 may represent a novel species of the genus Polymycovirus, family Polymycoviridae. To our knowledge, this is the first polymycovirus reported from S. turcica.

Molecular characterization of a novel totivirus infecting the basal fungus Conidiobolus heterosporus.

Mycoviruses are widely distributed in fungi, but only a few mycoviruses have been reported in basal fungi to date. Here, we characterized a novel totivirus isolated from the basal fungus Conidiobolus heterosporus, and we designated this virus as "Conidiobolus heterosporus totivirus 1" (ChTV1). The complete genome of ChTV1 contains two discontinuous open reading frames (ORFs), ORF1 and ORF2, encoding a putative coat protein (CP) and a putative RNA-dependent RNA polymerase (RdRP), respectively. Phylogenetic analysis based on RdRP sequences showed that ChTV1 clustered with members of the genus Totivirus. The RdRP of ChTV1 has 51% sequence identity to that of Trichoderma koningiopsis totivirus 1 (TkTV1), which is the highest among mycoviruses. However, TkTV1 formed a distinct cluster with Wuhan insect virus 27, with 63% RdRP sequence identity, although Wuhan insect virus 27 has not been described, and its host represents a different kingdom. Therefore, we propose that ChTV1 is a new member of the genus Totivirus, family Totiviridae.

A nanoscale genosensor for early detection of COVID-19 by voltammetric determination of RNA-dependent RNA polymerase (RdRP) sequence of SARS-CoV-2 virus.

A voltammetric genosensor has been developed for the early diagnosis of COVID-19 by determination of RNA-dependent RNA polymerase (RdRP) sequence as a specific target of novel coronavirus. The severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) uses an RdRP for the replication of its genome and the transcription of its genes. Here, the silver ions (Ag+) in the hexathia-18-crown-6 (HT18C6) were used for the first time as a redox probe. Then, the HT18C6(Ag) incorporated carbon paste electrode (CPE) was further modified with chitosan and PAMAM dendrimer-coated silicon quantum dots (SiQDs@PAMAM) for immobilization of probe sequences (aminated oligonucleotides). The current intensity of differential pulse voltammetry using the redox probe was found to decrease with increasing the concentration of target sequence. Based on such signal-off trend, the proposed genosensor exhibited a good linear response to SARS-CoV-2 RdRP in the concentration range 1.0 pM–8.0 nM with a regression equation I (μA) = − 6.555 log [RdRP sequence] (pM) + 32.676 (R2 = 0.995) and a limit of detection (LOD) of 0.3 pM. The standard addition method with different spike concentrations of RdRP sequence in human sputum samples showed a good recovery for real sample analysis (> 95%). Therefore, the developed voltammetric genosensor can be used to determine SARS-CoV-2 RdRP sequence in sputum samples.Graphical abstract PAMAM-functionalized SiQDs were used as a versatile electrochemical platform for the SARS-CoV-2 RdRP detection based on a signal off sensing strategy. In this study, for the first time, the silver ions (Ag+) in the hexathia-18-crown-6 carrier were applied as an electrochemical probe.Supplementary InformationThe online version contains supplementary material available at 10.1007/s00604-021-04773-6.

High Prevalence of Genogroup I and Genogroup II Picobirnaviruses in Dromedary Camels.

Picobirnaviruses (PBVs) are small non-enveloped bisegmented double-stranded RNA viruses found in humans, mammals, and birds. Increasing molecular epidemiology studies suggest a high sequence diversity of PBVs in numerous hosts and the environment. In this study, using 229 fecal samples from dromedary camels in Dubai, 52.8% were positive for PBVs, of which 77.7% and 41.3% were positive for genogroup I and II, respectively, and 19.0% were positive for both genotypes. Phylogenetic analysis showed high diversity among the sequences of genogroup I and II dromedary PBVs. Marked nucleotide polymorphisms were observed in 75.5% and 46.0% of genogroup I and II RNA-dependent RNA polymerase (RdRp) sequences, respectively, suggesting the co-existence of multiple strains in the same specimen. Both high genetic diversity and prevalence of genogroup I and II PBV in dromedaries were observed. In fact, the prevalence of genogroup II PBV in dromedaries is the highest among all animals to date. The complete/near-complete core genomes of five genogroup I and one genogroup II dromedary PBVs and partial segment 1 and 2 of both genotypes were also sequenced. The dromedary PBV genome organizations were similar to those of other animals. Genetic reassortment and mutation are both important in the ecology and evolution of PBVs.

The True Host/s of Picobirnaviruses

Picobirnaviruses (PBVs) are bisegmented double-stranded RNA viruses that have been detected in a wide variety of animal species including invertebrates and in environmental samples. Since PBVs are ubiquitous in feces/gut contents of humans and other animals with or without diarrhea, they were considered as opportunistic enteric pathogens of mammals and avian species. However, the virus remains to be propagated in animal cell cultures, or in gnotobiotic animals. Recently, the classically defined prokaryotic motif, the ribosomal binding site sequence, has been identified upstream of putative open reading frame/s in PBV and PBV-like sequences from humans, various animals, and environmental samples, suggesting that PBVs might be prokaryotic viruses. On the other hand, based on the detection of some novel PBV-like RNA-dependent RNA polymerase sequences that use the alternative mitochondrial genetic code (that of mold or invertebrates) for translation, and principal component analysis of codon usage bias for these sequences, it has been proposed that PBVs might be fungal viruses with a lifestyle reminiscent of mitoviruses. These contradicting observations warrant further studies to ascertain the true host/s of PBVs, which still remains controversial. In this minireview, we have focused on the various findings that have raised a debate on the true host/s of PBVs.

Characterization of tulip streak virus, a novel virus associated with the family Phenuiviridae.

In Japan, tulip-growing areas have been plagued by viral diseases for decades, but the viruses causing the damage remain undescribed. In this study, Nicotiana benthamiana and Chenopodium quinoa plants mechanically inoculated with crude sap from a symptomatic tulip flower exhibited necrosis symptoms. Additionally, flexuous and filamentous virus particles were detected by electron microscopy analysis. Moreover, we determined the complete sequences of two genomic segments of the tulip streak virus (TuSV), which is a new virus associated with streaking symptoms, on the basis of a next-generation sequencing analysis. Homology analyses of the amino acid sequence of RNA-dependent RNA polymerase and the terminal sequence of the genomic RNA indicated that TuSV is associated with viruses in the family Phenuiviridae, but differs substantially from other reported viruses.