Sequence Characterized Amplified Region Research Articles

The development and utilization of two SCAR markers linked to the resistance of banana (Musa spp. AAA) to Fusarium oxysporum f. sp. cubense race 4

Banana (Musa spp.) production worldwide is seriously threatened by Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc). The best way to control this disease is to grow resistant cultivars. However, it requires large-scale field evaluations and labor- and time-consuming to obtain disease-resistant germplasm. Development of early, reliable, and reproducible selection strategies are considered as the efficient approach which could speed up the selection procedure. In this study, two pairs of sequence-related amplified polymorphism (SRAP) primers related to banana Foc resistance/susceptibility were screened from 100 pairs of random primers. Correspondingly, two pairs of sequence characterized amplified region (SCAR) markers (namely SC4-F/SC4-R and SC14-F/SC14-R, respectively) were successfully generated from these two SRAP markers using 30 cultivars either resistant or susceptible to Foc. Both SCAR markers were located in mitochondrion genome and showed discriminatory power of 96.67% and 100%, respectively. Mitochondrial proteins possibly play a very important role in banana resistance to Foc. In additional, these two SCAR markers were employed simultaneously to screen potential resistant germplasm from 53 accessions with unknown resistance to Foc, and the results revealed a consistency of 83.0% with each other, further indicating their high reliability and reproducibility. These results suggest that both SCAR markers could be used in molecular marker-assisted selection for banana germplasm resistant to Fusarium.

Unveiling mechanisms for induced systemic resistance, resistance breeding and molecular marker‐assisted breeding against Phomopsis blight of Solanum melongena

AbstractPhomopsis vexans is one of the most destructive fungal pathogens associated with eggplant and currently poses a significant threat to eggplant production worldwide. The detrimental impact of P. vexans on eggplant yield has been extensively explored by various mycologists who have conducted thorough studies on the diversity, pathology and biological aspects of the pathogen. However, achieving enduring resistance or effective management has proven to be a challenge thus far. PCR‐based detection and molecular association of Phomopsis resistance use molecular markers to examine the potential for heterosis in various crosses, aiming for premium hybrids with genetic resistance and high‐yielding capabilities. The latest genome sequencing methods and availability of a wider range of genetic diversity has enabled the breeding of resistant varieties of eggplant. This review provides a detailed description on P. vexans including its epidemiology, dispersal methods, symptomology, colony characteristics, taxonomy and evolution of its strains. Different resistance breeding techniques including heterosis breeding, host plant resistance, identification of resistant sources, inheritance pattern for Phomopsis resistance, importance of grafting to impart resistance, significance of induced resistance, PCR‐based detection and molecular association of Phomopsis resistance are explained. Future approaches include molecular marker techniques such as genome‐wide association studies, sequence‐characterized amplified regions (SCAR), role of biotic inducers, pathogenesis‐related proteins and plant growth‐promoting rhizobacteria against Phomopsis blight of eggplant.

Discrimination of lethal Russula subnigricans from wild edible and morphologically similar mushrooms in the genus Russula using SCAR markers

Russula is a diverse genus of mushrooms that is consumed worldwide. Russula subnigricans is a lethal species that causes myotoxicity upon ingestion. It is morphologically similar to wild foraged species, including R. nigricans and R. densifolia. Misidentification of these mushrooms can lead to severe food poisoning. Several PCR-based approaches have been used to overcome this problem. In this study, 22 samples of wild edible Russula species were collected, and five clinical samples of R. subnigricans leftovers were obtained. Based on the sequence data of the internal transcribed spacer, the phylogenetic trees revealed that these 27 samples could be classified into well-established clades of six subgenera. Fifty arbitrary primers were used in high annealing temperature rapid amplified polymorphic DNA (HAT-RAPD) technique to screen polymorphic bands among R. subnigricans, R. nigricans, R. densifolia, and other edible species. Distinctive RAPD fragments were obtained from 11 primers and used in sequence characterized amplified region (SCAR) technique. Three pairs of species-specific SCAR primers were selected to distinguish lethal R. subnigricans, R. nigricans, and R. densifolia with SCAR markers of 213, 420, and 609 bp, respectively. Ten-fold sensitivity test revealed that the SCAR marker of R. subnigricans could be detected at DNA template concentrations as low as 30 pg/μL. This marker could detect the presence of lethal R. subnigricans even at 1% in a cooked sample of mixed mushroom remnants. The developed SCAR markers ensured rapid and accurate diagnosis of suspected myotoxic mushrooms, thereby reducing the risk of severe foodborne illness and death.

Characterization of Trichoderma strains for novel species-specific markers by multiplex PCR and antagonistic property against Alternaria ricini in castor (Ricinus communis L.)

The study aimed at characterizing six Trichoderma strains isolated from the rhizospheric soil of castor growing region of Telangana, India. Microscopic examination and sequencing of ribosomal DNA (rDNA) using internal transcribed spacer (ITS) and D1-D2 region-specific primers revealed them as members of Trichoderma sp. Whereas the phylogenetic analysis revealed four of those strains as Trichoderma asperellum, two strains were confirmed as Trichoderma harzianum with a high sequence similarity of >99%. Further, multiplex PCR results with Trichoderma-specific primers; TEF1 (translation elongation factor 1) and rpb2 (the second largest subunit of RNA polymerase II) gene-specific primers confirmed the findings resulting from the phylogenetic analysis. To develop a set of sequence characterized amplified region (SCAR) markers, these strains were screened with 185 random amplified polymorphic DNA (RAPD) primers. A pairwise comparison of correlation of coefficient values determined from the RAPD-based genetic similarity analysis revealed that TV3 and TS4 strains were closely related to each other (0.98) confirming them as T. harzianum while N13, 7316, TV5, and TV2B16 strains formed a different cluster with T. asperellum strains. A set of novel SCAR markers were developed to distinguish these two species, T. asperellum and T. harzianum including the reported Trichoderma strains as Ex-type strains. T. harzianum strains had extremely low sporulation ability to be tested for biocontrol properties. Of the four T. asperellum strains, 7316 followed by N13 demonstrated high antagonistic ability against the fungal pathogen, Alternaria ricini indicating these strains as potential biocontrol agents to limit Alternaria infection in castor.

Development of a sequence-characterized amplified region (SCAR) marker for female off-season flowering detection in date palm (Phoenix dactylifera L.)

Development of a sequence-characterized amplified region (SCAR) marker for female off-season flowering detection in date palm (<i>Phoenix dactylifera</i> L.)

DNA barcodes, ISSR, RAPD and SCAR markers as potential quality control tools for molecular authentication of black and white mulberry

Morus species, especially black mulberry (Morus nigra L.), are well known for their nutritive and economic values. Black mulberry is often a subject for deliberate and undeliberate substitution with the morphologically similar white mulberry (Morus alba L.). In the current study, the genetic diversity of Morus nigra L. and Morus alba L. was assessed using different genetic profiling and fingerprinting techniques namely namely DNA barcoding, Random Amplified Polymorphic DNA (RAPD) and Inter Simple Sequence Repeat (ISSR). DNA barcoding was implemented using 2 plastid loci (matK, and rbcL-1) and 2 nuclear spacers (ITS and ITS2) aiming at accurate authentication of the studied species. DNA barcoding, targeting the selected loci succeeded to identify and authenticate the studies Morus species but failed to differentiate them, owing to their close genetic resemblance. Out of 52 screened RAPD primers, 27 were able to produce reproducible and clear profiles with 115 amplified fragments of which 37 were polymorphic accounting for 32.17% polymorphism. The number of amplified bands varied from 2 to 7 ranging in size from 100 to 700 bp. Moreover, 55 ISSR primers were evaluated, 108 fragments were produced, using 20 primers, of which 28 were polymorphic accounting for 25.92% polymorphism with size range of 200–800 bp. Sequence Characterized Amplified Region (SCAR) marker was developed based on reproducible banding pattern obtained by RAPD primer (OPG-03), for the purpose of accelerating the initial screening of Morus batches and enabling the preventative rejection of adulterated samples. The polymorphic band obtained was sequenced and specific primers were designed to develop a SCAR marker of approximately 558 bp exclusively for M. nigra, allowing detection of down to 1 ng, of M. nigra. The SCAR marker showed 100% success in differentiating authentic M. nigra and M. alba samples. In addition, the application of the developed SCAR marker was extended to distinguish M. nigra from its four common adulterants namely Ficus carica L., Fragaria vesca L., Ficus racemosa L. and Vitis vinifera L.. The proposed protocol was successfully implemented for the evaluation of 47 commercial M. nigra samples collected from different Egyptian locations.

Development of Local Breeding Lines for Rust Resistance in the Common Bean (&lt;em&gt;Phaseolus vulgaris&lt;/em&gt;) through the Incorporation of Rust-Resistant Genes

Bean rust is one of the major diseases of the common bean (Phaseolus vulgaris) reported in Sri Lanka and at the global level. This study aimed to develop rust-resistant snap bean breeding lines via gene pyramiding assisted by molecular markers. Resistant sources; PI 181996, BelMiNeb-RMR-8, and BelDakMi-RMR-19, enriched with the rust-resistant genes Ur-3 and Ur-11, were selected as donor parents to obtain a wide range of resistance to the rust pathogen. Resistant genotypes were crossed with popular local varieties Kappetipola nil and Galpalama Kalu (Capri) to introgress Ur-3 and Ur-11 resistant genes. Successive F1, F2, and BC (backcross) generations were obtained with the self-pollination and backcrossing processes. Standard phenotypic disease screening methods were applied to identify resistant lines. Phenotypically resistant plants obtained from these crosses were tested with sequence-characterized amplified region (SCAR) markers linked to two rust-resistant genes: SK 14 (linked to Ur-3) and SI 19 (linked to Ur-11). Molecular marker SI-19 showed higher reproducibility (50% to 80%) with the availability of relevant banding patterns for phenotypically resistant F1, F2, and BC1 progenies. However, SK 14 showed lower reproducibility (30–60%) for the same progenies. Approximately 450 genotypes introgressed with rust-resistant genes (Ur-3 and Ur-11)were produced. Among them, four advanced resistant lines obtained from the different cross combinations (Kappetipola nil x BelDakMi-RMR-19, Galpalama Kalu x BelMiNeb RMR-8, Kappetipola nil x PI 181996, and Kappetipola nil x BelMiNeb RMR-8) with preferred agronomic characters were selected for further variety development. All new genotypes will be important for future bean-resistant breeding programs in Sri Lanka.

Diagnosis and Characterization of Ditylenchus destructor Isolated from Mazus japonicus in China.

The potato rot nematode (Ditylenchus destructor) is one of the most destructive pests in the production of tuber crops, resulting in severely decreased yields and inferior product quality. In 2021, a great number of nematodes were detected in the roots of Mazus japonicus, a weed that is harmful to crop growth, in Qingdao, Shandong Province, China. The present study was undertaken to characterize and identify the nematodes isolated from M. japonicus through morphological identification and molecular approaches. Their morphological characteristics were highly consistent with the descriptions of D. destructor Thorne, 1945. The nematodes collected from M. japonicus were identified as D. destructor haplotype B using D1/D2 and sequence characterized amplified region (SCAR) primers. PCR-ITS-RFLP analysis was conducted to monitor intraspecific variations. In addition, the phylogenetic analysis of the internal transcribed spacer (ITS) demonstrated that this D. destructor population was clustered in haplotype B, supported by a 100% bootstrap value. Another assay, in which M. japonicus was inoculated with a mixture of the life stages of D. destructor, was performed. This assay showed that M. japonicus exhibited a high susceptibility to D. destructor in pots. This is the first record of D. destructor parasitizing M. japonicus in China, and it is of great importance because M. japonicus could be a potential reservoir for D. destructor in the field.

First Report of Root-Knot Nematode (Meloidogyne incognita) on Dioscorea opposita in Henan Province, China.

Dioscorea opposita is an annual twining plant in China that is used for consumption and medicinal purposes. The planting area of D. opposita is near 500,000 hectares in China, mainly in Shangdong, Hebei, Henan, Jiangxi and Yunnan provinces. In August 2021, we observed that some D. opposita plants grew poorly with smaller and chlorotic leaves in Changyuan (35°8'12"N; 114°43'52"E), Henan Province, China. Galls with hook-shaped roots and tuber damage were also observed, typical of root-knot nematode. Thirty tubers were randomly collected and 60% were infested with root-knot nematodes. During a disease survey in Changyuan, the incidences of root-knot nematode damage were 31.5%, 21%, and 18% in three fields (0.33, 0.67, and 4 ha, respectively) at harvest. The average tuber length of infected plants was decreased by 65.8%, and the average weight was decreased by 70.1% compared to the healthy plants. Males, females, second-stage juveniles (J2s), and eggs were extracted from individual diseased tubers from the three fields for morphological identification. Females were white, pear-shaped with a projecting neck. Males showed a trapezoidal labial region with prominent stylet knobs, including a high head cap which had a stepped outline and was centrally concave in lateral view. Morphological measurements are described in the supplementary material. All data and descriptions conformed to the morphological characteristics of Meloidogyne incognita. Genomic DNA was extracted from J2s (n=9) using PCR lysis buffer, and used for PCR amplification of the sequence characterized amplified region (SCAR) markers specific for M. incognita. Two pairs of the SCAR primers, Mi-F/Mi-R, and Inc-K14-F/Inc-K14-R, were used to diagnose whether these nematodes from D. opposita were M. incognita (Meng et al. 2004; Randig et al. 2002). The PCR produced expected amplification products of 955 and 399 bp, confirming the nematode to be M. incognita. Primers specific for M. arenaria (Far/Rar) and M. javanica (Fjav/Rjav) were used but failed to amplify fragments (Randig et al. 2002; Zijlstra et al. 2000). The obtained PCR fragments were sequenced and deposited in GenBank (accession no. OQ420602.1, OQ427638.1). They showed 99.9 and 100% identity to the available GenBank M. incognita sequence (accession no. MK410954.1, ON861825.1), respectively. A pathogenicity test was conducted in greenhouse conditions. Bulbils of D. opposita were sown in the pots filled with 2,000 ml of autoclaved soil mixture (loamy soil/sand, 1:1). One month later, 15 seedlings (five to six leaf stage) were inoculated with 1,000 M. incognita J2s individually. Five plants without nematode inoculation were used as the control. Two months after inoculation, all of the inoculated roots had galling symptoms similar to those observed in the field, and 100% of root system tissues had galls. The root gall index was ~6 according to a 0 to 10 RKN damage rating scale (Poudyal et al. 2005). No symptoms were found on the control plants. The nematodes were reisolated from root tissue and identified. M. incognita has a broad host range in many species of economic importance including Salvia miltiorrhiza (Wen et al. 2023), Ipomoea batatas (Maleita et al. 2022), and Zea mays (López-Robles et al. 2013). So far, M. incognita has been reported in D. alata and D. rotundata in Africa (Onkendi et al. 2014). To our best knowledge, this is the first record of M. incognita on D. opposita in Henan Province, China. With the increased planting area of D. opposita in China, root-knot nematodes are becoming more serious and reducing tuber production, with yield losses more than 60%. This identification is a preliminary step in developing effective disease management schemes. Declaration of interest The authors declare no conflict of interest. Funding This work was financially supported by the Key Scientific Research Projects of Higher Education Institutions of Henan Province (21A180013), China Agriculture Research System (CARS-21), The Zhongyuan high level talents special support plan-Science and Technology Innovation Leading Talents (224200510011) and Science and Technology Research Project of Henan Province (222102310211). References López-Robles, J., et al. 2013. Plant Dis. 97:694. https://doi.org/10.1094/PDIS-07-12-0674-PDN. Maleita, C., et al. 2022. Plant Dis. 106:2536. https://doi.org/10.1094/PDIS-12-21-2680-PDN. Meng, Q. P., et al. 2004. Acta Phytopathol. Sinica 34:204. https://doi.org/10.13926/j.cnki.apps.2004.03.003. Onkendi, E. M., et al. 2014. Plant Pathol. 63:727. https://doi.org/10.1111/ppa.12202. Poudyal, D. S., et al. 2005. Australas. Plant Pathol. 34:181. https://doi.org/10.1071/AP05011. Randig, O., et al. 2002. Genome 45:862. https://doi.org/10.1139/g02-054. Wen, Y., et al. 2023. Plant Dis. Accepted. https://doi.org/10.1094/PDIS-05-22-0997-PDN. Zijlstra, C., et al. 2000. Nematology 2:847. https://doi.org/10.1163/156854100750112798.

Molecular cloning and development of RAPD-SCAR markers for the selection of thermo-tolerant line of tropical tasar silkworm

Aim: To develop random amplified polymorphic DNA (RAPD) -sequence-characterized amplified region (SCAR) markers for selecting thermo-tolerant line of tropical tasar silkworm. Methodology: In the environmental chamber, Daba BV cocoons of A. mylitta were exposed to high temperature at 46°C/4 hr for 3 days. After the emergence, genomic DNA was extracted from thermo-tolerant moths and thermo-susceptible pupae. The genomic DNA was amplified using 30 RAPD random decamer primers. The improved RAPD fragments that can differentiate thermo-tolerant and susceptible line of A. mylitta were eluted, cloned in pJET1.2 vector and sequenced. SCAR markers were developed based on the sequence and validated in the subsequent generations. Results: Among 30 RAPD primers, OPK04, OPAJ15 and OPA17 generated polymorphic bands to differentiate thermo-tolerant and susceptible line of A. mylitta. These polymorphic bands were eluted, cloned and sequenced. Sequencing of three cloned fragments revealed that clone PB1 comprised of 1412 bp, clone PB2 comprised of 704 bp and clone PB3 comprised of 931 bp. Sequence specific stable multiplex SCAR markers TT-PB1, TT-PB2 and TT-PB3 were designed and synthesized. PCR amplification was performed using DNA templates of 10 thermo-tolerant and 10 thermo-susceptible samples. SCAR marker TT-PB1 was observed to be more specific to thermo-tolerant line of tropical tasar silkworm and validation with 25 samples each in next generation also supported the specificity of TT-PB1. Interpretation: Among three SCAR markers, TT-PB1 showed more specificity for selecting the thermo-tolerant line of A. mylitta. Therefore, the study provides an effective and precise PCR-based molecular marker system for selecting thermo-tolerant lines in tropical tasar silkworm to overcome seed crop loss due to high temperature stress in tasar rearing hotter zones. Key words: Antheraea mylitta, cloning, RAPD, SCAR m­­­arker, Thermo-tolerance

Nematicidal effects of silver nanoparticles (AG-NPs) on the root-knot nematode, Meloidogyne javanica associated with Swiss chard (Beta vulgaris L.).

Root-knot nematodes (RKNs) are important nematode pests, causing huge economic losses on vegetable crops worldwide. A decline in the yield of Swiss chard (Beta vulgaris L.) which was associated with RKNs was observed on an organic vegetable farm in the Western Cape Province of South Africa. Nematodes were extracted from galled plant roots and identified using molecular tools. PCR-based Sequence Characterised Amplified Region (SCAR) primers was used to confirm the specie of the RKN associated with the infected plants. Thereafter, a pot assay was conducted to determine the response of artificially infected Swiss chard plants to varying concentrations of bio-synthesized silver nanoparticle Ag-NP (1 μg/mL, 2 μg/mL, and 3 μg/mL) under controlled conditions. The results of the study showed that Swiss chard is highly susceptible to M. javanica with an egg-laying-female index of >5 in all infected plants. Significantly lower values (at P=0.05) in egg masses (EM), juveniles (J2s), and reproduction factor (RF) of nematodes were recorded on plants treated with 3 μg/mL, indicating a potential for nematode control. A negative correlation was also observed in the number of egg masses, J2s, and RF of the nematodes with increasing concentrations of the Ag-NP. This study confirms that Swiss chard is highly susceptible to M. javanica and demonstrates the potential nematicidal property of Ag-NP in controlling the nematode pest of Swiss chard.

Assessing garden pea germplasm for powdery mildew resistance through disease phenotyping and genotyping using molecular markers

Erysiphe pisi is one among the other causal agents of powdery mildew infection in garden pea. So far, the resistance genes comprising two recessive (er1 and er2) and one dominant (Er3) have been reported to confer resistance to powdery mildew in garden pea. A set of 46 pea genotypes were screened against the E. pisi isolate- Ep01 in greenhouse conditions to identify resistant genotypes. Disease reaction and genotyping were carried out to test for resistance/ susceptibility through gene-specific sequence characterized amplified region (SCAR) markers. The presence of the resistance alleles in the control pea genotypes- JI2302 for er1 gene, JI2480 for er2 gene and P660–4 for Er3 was confirmed through their respective gene-specific markers. The pea genotype- Arkel served as a negative control. Screening of the pea germplasm revealed 3 genotypes as highly resistant, 6 genotypes as resistant while 10 genotypes were moderately resistant, 13 genotypes were moderately susceptible, 9 genotypes were susceptible and 5 were highly susceptible. The molecular marker for er1 resistance gene Sc-OPE-161600 was found to be segregating in most of the pea genotypes except in the susceptible control- Arkel. The marker- ScX17_1400 for er2 gene was found to be in homozygous condition in the resistant pea genotypes while the marker associated with Er3 resistance, SCW4637, was found to be in heterozygous condition in majority of the pea genotypes except in the resistant control genotype- P660–4.

Разработка ДНК-маркеров признака устойчивости подсолнечника к расе G заразихи (Orobanche cumana Wallr.)

Broomrape (Orobanche cumana Wallr.) is an obligatory parasite which is able to decrease significantly sunflower yields. The race G is the most spread and virulence broomrape race in the Russian Federation. Cultivation of genetically resistance sunflower varieties and hybrids is the most ecologic and economically efficient method to control this parasite plant. Usage of DNA-markers when selecting the resistant plants increases significantly the effectiveness of a breeding process. To mark the sunflower resistance to broomrape race G, using bioinformative approaches, we developed new DNA-markers: four SCAR (sequence characterized amplified region) and ten SSR (simple sequence repeat). These markers were tested on 20 lines and hybrids of sunflower. Due to the results of this testing, all SSR- and two SCAR-markers were eliminated by steps. SCAR-marker RORS1 was characterized with the presence of an amplified DNA fragment with a length ≈ 168 bps and showed association with a trait of resistance, and SORS1 with a fragment length ≈ 322 bps had a relation with a sus-ceptible phenotype. These markers composed a marker system for a multiplex PCR, which allowed distinguishing resistant and susceptible lines and hybrids, except a line VK678 and F1 hybrids developed using this line as parental one. To eliminate faults of the marker system, seven SCAR-markers analogous to SORS1 were created. Due to estimation result, we selected a marker SORS9 characterized with the presence an amplified DNA fragment with a length ≈ 217 bps in susceptible phenotypes. The new system of markers RORS1/SORS9 for a multiplex PCR was validated on 70 sunflower lines and hybrids. The susceptible lines and hybrids were characterized with amplification of only marker SORS9, resistant lines – only marker RORS1, and resistant hybrids – both markers. The developed marker system allowed distinguishing all susceptible lines and hybrids from the resistant sunflower genotypes.

A KASP Marker for the Potato Late Blight Resistance Gene RB/Rpi-blb1

The disease late blight is a threat to potato production worldwide, making genetic resistance an important target for breeding. The resistance gene RB/Rpi-blb1 is effective against most strains of the causal pathogen, Phytophthora infestans. Until now, potato breeders have utilized a Sequence Characterized Amplified Region (SCAR) marker to screen for RB. Our objective was to design and validate a Kompetitive Allele Specific PCR (KASP) marker, which has advantages for high-throughput screening. First, the accuracy of the SCAR marker was confirmed in two segregating tetraploid populations. Then, using whole genome sequencing data for two RB-positive segregants and a diverse set of 23 RB-negative varieties, a SNP in the 5’ untranslated (UTR) region was identified as unique to RB. The KASP marker based on this SNP, which had 100% accuracy in the cultivated diversity panel, was used to generate diploid breeding lines containing RB. The KASP marker is publicly available for others to utilize.

Hatching and development of maize cyst nematode Heterodera zeae infecting different plant hosts

The occurrence, distribution, and rapid molecular detection technology of Heterodera zeaeKoshy et al. 1971, have been reported in China. We explored the biological characteristics of H. zeae sampled in Henan Province, China to understand its interaction with plants. Cysts and second-stage juveniles (J2s) were identified under an optical and scanning electron microscope, internal transcribed spacer (ITS) phylogenetic tree, and sequence characterized amplified region (SCAR)-PCR analyses. The optimum hatching temperatures of H. zeae were 30°C and 28°C, with cumulative hatching rates of 16.5 and 16.1%, respectively, at 30 days post-hatching (dph). The hatching rate of H. zeae eggs was improved by 20- and 50-time maize soil leachate and root juice, and 10-time root exudates. The hatching rate in 10-time root exudates was the highest (25.9%). The 10-time root exudates of maize and millet produced the highest hatching rate at 30 dph (25.9 and 22.9%, respectively), followed by wheat (19.9%), barley (18.3%), and rice (17.6%). Heterodera zeae developed faster in maize than in other crops. Fourth-stage juveniles (J4s) were detected in maize roots 8 days post-inoculation (dpi) at 28°C but not in other crops. Combined with hatching tests, the Huang–Huai–Hai summer maize region and the south and central-southwest mountainous maize areas are highly suitable for H. zeae in China. This is the first systematically study of the hatching and infection characteristics on different plant hosts of corn cyst nematode H. zeae in temperate regions. This study laid a theoretical foundation for the rapid spread and high environmental adaptability of corn cyst nematode.

Genotyping-driven diversity assessment of biocontrol potent Bacillus spp. strain collection as a potential method for the development of strain-specific biomarkers.

Bacillus species are among the most researched and frequently applied biocontrol agents. To estimate their potential as environmentally friendly microbial-based products, reliable and rapid plant colonization monitoring methods are essential. We evaluated repetitive element-based (rep) and Random Amplified Polymorphic DNA (RAPD) PCR (Polymerase Chain Reaction) genotyping in a diversity assessment of 251 strains from bulk soil, straw, and manure samples across Serbia, highlighting their discriminative force and the presence of unique bands. RAPD 272, OPG 5, and (GTG)5 primers were most potent in revealing the high diversity of a sizable environmental Bacillus spp. collection. RAPD 272 also amplified a unique band for a proven biocontrol strain, opening the possibility of Sequence Characterized Amplified Region (SCAR) marker design. That will enable colonization studies using the SCAR marker for its specific detection. This study provides a guide for primer selection for diversity and monitoring studies of environmental Bacillus spp. isolates.

Enzymatic and Molecular Identification of Meloidogyne Species in Tomato Orchards in Paraguay

Tomato is a major crop in Paraguay, where it provides a source of employment and income for households. Tomato production can be affected by root-knot nematodes, especially Meloidogyne spp. The unequivocal identification of Meloidogyne spp. in Paraguay has not been conducted yet. This study aims to identify Meloidogyne species in eight tomato production districts of this country by biochemical and molecular techniques. Females of Meloidogyne spp. were extracted from tomato roots and characterized using esterase isozyme phenotypes. In addition, DNA was extracted from nematode eggs, and species-specific SCARs (sequence-characterized amplified regions) were used to confirm the diagnosis. Nematodes were detected in 100% of studied samples (prevalence), of which M. incognita (Est: I2, Rm: 1.1;1.2) and M. javanica (Est: J3, Rm: 1.0, 1.20, 1.35) were present in 39.13% and 26.08% of samples, respectively. One population (8.69%) of Meloidogyne sp. presenting an atypical esterase profile (Rm: 1.0 and 1.3) was only detected in Julián Augusto Saldívar District. Mixed populations, mostly M. incognita and M. javanica, were observed in 26.08% of samples. The SCAR primers incK14F/incK14R amplified specific fragments for M. incognita (399 bp) and M. javanica (670 bp), confirming the enzymatic results. Here, we present the first study of root-knot nematode identification at the species level in Paraguay.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Genetic Characterization of Nile Tilapia (&amp;lt;i&amp;gt;Oreochromis niloticus&amp;lt;/i&amp;gt;) Strains from Senegal for Sustainable Local Aquaculture Production

The optimization of aquaculture production requires the selection of efficient strains. Thus, genetic improvement has become one of the important levers to boost the development of aquaculture. The objective of this study was to carry out genetic characterization of Nile tilapia Oreochromis niloticus, one of the most cultivated fish species in Senegal, in order to select an efficient strain to optimize local fish production. Thus, fish from five different populations (Richard-Toll, ANA, ITACA, Mbodiene and Sauvage) were analyzed, with 15 individuals per population. Genetic diversity and population structure were assessed using molecular genetic analyses by sequence characterized amplified region (SCAR) and microsatellite (SSR) markers. The analyses of the SCARII marker were conducted on four populations (ANA, ITACA, Sauvage and Mbodiene) while microsatellite analyses were conducted on all five populations. The results show high levels of polymorphism of SSR markers, and a high level of observed heterozygosity (Ho), indicating a high within-population genetic variability. These results are in agreement with the AMOVA results, which indicated a high within-population genetic variability (94%). The genetic structure analysis by DAPC indicates that the five populations analyzed are structured into four groups, which are highly heterogeneous because they share common allele individuals. The analysis of the genetic structure by AMOVA showed a low degree of differentiation between the populations (6%), in agreement with the genetic differentiation index (Fst = 0.059). The heterogeneity of studied populations implies a genetic flow over time, which may have existed between the original populations. The overall negative Tajima D values and low genetic differentiation indicate an excess of rare mutations in the populations studied, resulting from a recent population expansion from a limited number of initial breeders isolated in locale hatcheries. Thus, further studies with a much larger panel of markers are required to better differentiate the strains and identify the most efficient ones for sustainable local aquaculture production.

Genetic variability and phylogenetic characterization of different populations of Meloidogyne izalcoensis and reaction of coffee genotypes to this new species detected in Brazil

AbstractA new root‐knot nematode (RKN), Meloidogyne izalcoensis, was detected on coffee in Brazil. This species was first described on coffee from El Salvador and later detected in Asia and Africa. There are no reports on the genetic diversity of this species and resistance to M. izalcoensis has not yet been studied in coffee cultivars. All populations were identified by esterase phenotype and sequence‐characterized amplified region (SCAR) species‐specific markers. Based on random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) markers, low intraspecific variability was detected among M. izalcoensis populations from Africa, Vietnam and Brazil, but the population from El Salvador showed fewer genetic differences from the other populations. Phylogenetically, all populations of M. izalcoensis from different locations (El Salvador, Kenya, Tanzania, Vietnam and Brazil) grouped with 90% and 69% bootstrap support for COII and HSP90 regions, respectively, indicating that these markers are highly conserved for the species. In addition, both markers enabled separation of M. izalcoensis populations from other important coffee Meloidogyne species, including M. exigua, M. paranaensis, M. incognita, M. arabicida and M. lopezi. In resistance studies, most genotypes tested that had resistance to other Meloidogyne spp. (Amphillo × Catuaí, Hybrid of Timor, IAPAR 59, IPR 99, IPR 100, IPR 102, IPR 103, IPR 105, IPR 106, IPR 107 and IPR 108) were found to be susceptible to M. izalcoensis, except for the rootstock cv. Apoatã IAC 2258, which proved to be moderately resistant, with a genetic segregation for this character of 43.8%.