Seed Protein Content Research Articles

AAC Planet field pea

AAC Planet is a semi-leafless and powdery mildew (caused by Erysiphe pisi Syd.) resistant field pea ( Pisum sativum L.) variety developed at Agriculture and Agri-Food Canada, Lacombe Research and Development Centre, Lacombe, Alberta, Canada. It has high yielding potential, late maturity, tall plant height with good lodging resistance, medium seed size, round seed shape, and low seed coat breakage. It has maturity of 100 days, and thousand-seed weight of 221 g with seed protein content of 24.6%. AAC Planet has a lodging score of 3.2 on the scale of 1–9. It is moderately susceptible to mycosphaerella blight (caused by Mycosphaerella pinodes) and fusarium root rot (caused by Fusarium avenaceum and F. solani).

Integrative Analysis of Metabolome and Transcriptome Reveals Molecular Mechanisms Regulating Oil and Protein Content in Peanut (Arachis hypogaea L).

Peanut (Arachis hypogaea L.) is an important source of edible vegetable oils and plant proteins globally. However, the complex mechanisms regulating the oil and protein contents of peanut seeds remain unclear. Here, comparative broad-target metabolomics and quantitative lipidomics, together with transcriptome analysis, of peanut seeds at four developmental stages from the high-oil content variety "YH15" and high-protein content variety "KB008" were performed to search for oil and protein content control genes. A total of 984 differential metabolites, including 128 amino acids and derivatives and 310 differentially accumulated lipids, were identified between "YH15" and "KB008" in four seed developmental stages. The weighted gene coexpression network analysis and module-trait relationship analysis revealed that MEbrown, MEyellow, and MEturquoise modules were key contributors to the quality discrepancies observed between "YH15" and "KB008." Crucial genes potentially regulating the differences in oil and protein contents between "YH15" and "KB008" were identified within the aforementioned three modules, including genes involved in amino acid synthesis and degradation, nitrogen allocation, triglyceride synthesis and degradation, and fatty acid synthesis and degradation, as well as transcription factors. Overall, this study provides valuable insights into the molecular regulation of oil and protein contents in peanut seeds and may help cultivate specialized peanut varieties with enhanced nutritional and economic values.

Glycine soja, PI424025, is a valuable genetic resource to improve soybean seed-protein content and composition.

Soybean seed-protein content and composition is important because it contributes over half the value of this $61 billion crop. Historic negative correlation between seed-protein content and oil have been reported. Similarly, negative correlation between seed-protein content and yield have been reported but may be at least in part mitigated by increasing the genetic diversity of the elite soybean germplasm. Improvements in amino acid composition of seed-protein would increase the value of soybean meal and protein for animal and human consumption. We have identified a genetic resource in wild soybean germplasm, PI424025B, with elevated seed-protein, elevated cysteine in the seed and increased sulfur content in the seed. We have developed a population of Recombinant Inbred Lines derived from a cross between NC-Raleigh and PI424025B. We evaluated the carbon, nitrogen and sulfur (C, N and S) content of seeds from the progeny, the parents and other high-seed protein soybean lines. N content and C/N (ratio of C to N) were well correlated with protein content measured by NIR. PI424025B had a N content comparable to high-protein soybean lines and a superior N/S. These traits were inherited by some of the progeny. Quantitative Trait Loci (QTL) associated with high-seed protein were identified on chr2, chr20 and chr15 and colocalizes with well characterized loci on chr 15 and chr 20 known to affect seed-protein content and quality. A potentially unique QTL was identified on Chr15. Unlike the chr20 QTL, the chr15 QTL improved S content relative to N content and was superior to other high seed-protein phenotypes tested. These data indicate that PI424025B is a valuable resource to diversify the genetics of soybean while improving soybean seed-protein content and composition.

Physical and biochemical characteristics of cereal grains affect population growth parameters of Sitophilus oryzae (L.) (Coleoptera: Curculionidae)

The rice weevil, Sitophilus oryzae L. (Coleoptera: Curculionidae), is a significant pest of rice and other cereal grains. In this research, the effects of various grain species, including barley, maize, millet, rice, sorghum, and wheat, were assessed on biological properties and life history variables of S. oryzae under laboratory conditions. Data were analyzed based on the age-stage, two-sex life table method. Furthermore, various physicochemical properties of cereal grains, including protein content, starch content, humidity content, and seed hardness, were investigated to explore their correlation with the studied parameters of S. oryzae. The longest development time was observed on millet and sorghum hosts, while the shortest was on maize seed. The beetles reared on rice and millet species showed the maximum fecundity, whereas those reared on sorghum and millet grains showed the lowest. Maize grain had the highest intrinsic rate of increase (r), whereas millet and sorghum grains had the lowest. According to the correlation analysis, overall, seed protein content was negatively correlated with insect fecundity, R0 and r, but positively correlated with development time. Furthermore, starch content was positively correlated with insect fecundity, R0 and r, and negatively correlated with development time. The cluster results demonstrated that whereas sorghum and millet were comparatively resistant hosts for the growth of S. oryzae, maize and rice were relatively susceptible seeds. This information can be helpful in the development or improvement of integrated pest management (IPM) strategies against rice weevil. The findings of this research will also be helpful in introducing unsuitable hosts for the development of transgenic grains resistant to S. oryzae. The pest-resistant cereal grains identified in this study can potentially be utilized in combination with other pest control strategies for sustainable management of S. oryzae, which may help reduce the excessive use of chemical insecticides.

Genome- and transcriptome-wide association studies reveal the genetic basis of seed palmitic acid content in Brassica napus

Rapeseed (Brassica napus L.) is one of the most important oilseed crops worldwide. Development of rapeseed varieties with high-quality oil is a long-term breeding goal. Reducing the contents of palmitic acid, the main saturated fatty acid in rapeseed oil, could greatly improve oil quality. Here, we performed genome-wide association study (GWAS) and transcriptome-wide association study (TWAS) of seed palmitic acid content (SPAC) using 393 diverse B. napus accessions. Four genes (BnaA08.DAP, BnaA08.PAA1, BnaA08. DUF106, and BnaC03.DAP) were identified by both GWAS and TWAS. The transcripts per million (TPM) values of these candidate genes at 20 and 40 days after flowering (DAF) were significantly correlated with SPAC in this association panel. Based on genetic variation in the candidate genes, we identified four low-SPAC haplotypes by combining candidate gene association analysis and haplotype analysis. Brassica napus accessions carrying low-SPAC haplotypes had lower SPAC than those carrying high-SPAC haplotypes without affecting seed oil content, seed protein content, or seed yield. Based on the functional single-nucleotide polymorphism (SNP) chrA08_9529850 (C/A) in the promoter of BnaA08.DUF106, we developed a molecular marker (Bn_A8_SPAC_Marker) that could be used to facilitate breeding for low SPAC in B. napus. Our findings provide valuable information for studying the genetic control of SPAC in B. napus. Moreover, the candidate genes, favorable haplotypes, and molecular marker identified in this study will be useful for breeding low-SPAC B. napus varieties.

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Heritability, signal perception and autoregulation of root nodulation in chickpea

Chickpea (Cicer arietinum L.) establishes symbiotic interactions with Mesorhizobium to develop root nodules where nitrogen fixation occurs. This symbiotic relationship can fix atmospheric nitrogen (N2) up to 140 kg N/ha that contribute nearly 80% nitrogen requirement of the crop. Global researchers had revealed the existence of natural variations in chickpea germplasm for nodulation traits with high heritability. Surprisingly, the contribution of environmental variation is too low for Biological Nitrogen Fixation (BNF) traits and high broad-sense heritability (>60) was observed for early nodulation, late nodule senescence and high nodule number traits. Correlation studies indicated a strong positive correlation between nodule number at flowering stage with total nodule weight and plant biomass and seed protein content. Nod Factor receptors in chickpea (CaNFR1 and CaNFR5) are characterized recently that forms phylogenetically distinct group along with M. truncatula, P. sativum, and L. japonicus. Critical role of cytokinin signalling through members of two component system (TCS) in nodulation was investigated in chickpea. The chickpea ortholog CaHK19 was the master spigot of cytokinin perception in chickpea. The co-expression pattern of CaHKs and CaNIN clearly indicated a link between cytokinin perception and downstream expression of CaNIN in chickpea as earlier established in Medicago. Genes involved in AON pathway are partially revealed in chickpea. CaRND1, CaRDN2, and CaRDN3 (C. arietinum Root-Determined Nodulation) function as receptors for signals produced from the roots. Revealing the molecular basis of root nodule organogenesis and their regulatory mechanisms along with identification of potential genetic stock will help on breeding or engineering chickpea genotypes with high symbiotic efficiency, extended nitrogen fixation and high symbiotic efficiency make grain legumes as nitrogen fixing factories to fertilize the soil in a sustainable way.

The Germination Performance After Dormancy Breaking of Leucaena diversifolia (Schltdl.) Benth. Seeds in a Thermal Gradient and Its Distribution Under Climate Change Scenarios.

Climate change models predict temperature increases, which may affect germination, an important stage in the recruitment of individuals in agroecosystems. Therefore, it is crucial to conduct research on how temperature will impact the germination of multipurpose native species. Leucaena diversifolia (Schltdl.) Benth. is native to America and is commonly cultivated around the world due to having a high protein content in seeds, and their trees are used in agrosilvopastoral systems because they fix nitrogen and provide shade and cattle feed. However, climate change affects the critical phases of its life cycle and influences its growth, reproduction, phenology, and distribution. To assess the germination performance of Leucaena diversifolia under different temperatures throughout thermal times, we estimated germination variables and determined cardinal temperatures and thermal time; we also analysed germination and potential distribution under two climate change scenarios. We found significant variations in seed germination (78-98%) and differences in cardinal temperatures (Tb = 5.17 and 7.6 °C, To = 29.42 and 29.54 °C, and Tc = 39.45 and 39.76 °C). On the other hand, the sub-optimal and supra-optimal temperature values showed little differences: 51.34 and 55.57 °Cd. The models used showed variations in germination time for the analysed scenarios and the potential distribution. We confirm that the populations and distribution of L. diversifolia will be altered due to climate changes, but the species retains the ability to germinate under warmer conditions.

High-protein soybean lines with stable seed protein content under heat and drought stresses

A significant factor determining the value of soybean is protein content, in addition to its importance as an oilseed. Increasing the seed protein content in soybean will make it a more valuable food and feedstock and enhance its importance in the international market. Due to this reason, developing high-protein soybean varieties is gaining increased industrial interest. To ensure profitable production, the stability of the high-protein trait needs to be verified under environmental stresses. The objectives of this study were to test whether the high-protein soybean genotypes can maintain their high seed protein content under heat and drought stresses imposed during seed filling and to assess the changes in their oil composition under stress conditions. The changes in seed protein and oil contents and oil composition of the high-protein lines NLM09–77, N14-7017, and N16-9924 under heat and drought stresses were assessed and compared against those of a recently released high-yielding, high-protein variety Benning HP; elite cultivars NC-Dunphy, NC-Raleigh, and NC-Dilday; low-protein breeding lines N11–9228 and N09-2505; heat-tolerant line DS25-1; and heat-susceptible line DT97-4290. We found that the high-protein genotypes NLM09–77, N16–9924, N14-7017, and Benning HP maintained their high seed protein contents under heat and drought stresses (46–55 %). Among them, NLM09–77 and N14-7017 were unique with no apparent negative relationship between the seed protein and oil contents. In terms of oil composition, N14-7017, NLM09-77, and Benning HP were similar to the elite cultivars NC-Dunphy and NC-Dilday. Additionally, the high-protein genotypes N14-7017, NLM09-77, and Benning HP did not exhibit any yield drag (2993–3150 kg ha−1vs 3289–3368 kg ha−1 for the elite cultivars). Taken together, our study demonstrates the usefulness of the advanced breeding lines NLM09–77 and N14-7017 and cultivar Benning HP for developing new varieties with enhanced nutritional value under climate change-associated stresses.

Characterising the Nutritional and Alkaloid Profiles of Tarwi (Lupinus mutabilis Sweet) Pods and Seeds at Different Stages of Ripening

Tarwi (Lupinus mutabilis Sweet) is a key crop for Andean indigenous communities, offering proteins and fats. Both the pods and seeds of tarwi are consumed, either in their tender (immature) state or as dried, fully ripe seeds. Tarwi, like other Lupinus species, contains high alkaloid levels in its fruits and seeds that must be removed before consumption. This study evaluated the fat, protein, fibre, and alkaloid contents of four cultivars at five maturity stages ranging from 180 to 212 days after sowing. Samples of the pods and the seeds were analysed to determine their colour and protein, crude fibre, fat, and alkaloid contents. The results showed that while the protein concentration in the pods decreased as the fruits matured, the protein content in the seeds increased, reaching approximately 41%. Moreover, the pods exhibited a significant decrease in alcohol content, with the values dropping below 1% at the senescent (dry) stage for all the cultivars. In contrast, the alkaloid levels in the seeds remained stable from 196 days after sowing in the Guaranguito, Andean, and Ecuadorian cultivars, with concentrations around 4%. The present study showed that as the pods matured, their overall protein content decreased, while their seed protein content increased to around 41%. The alkaloid levels in the pods dropped below 1% in the dry stage, while the seed alkaloid levels remained stable at around 4% in the Guaranguito, Andean, and Ecuadorian cultivars after 196 days. However, in the Peruvian cultivar, the alkaloid content remained constant starting from 188 days after sowing, with concentrations just over 3%. This result suggests that as the pods mature, their alkaloid content decreases, while the alkaloid levels in the seeds stabilise from around 188 to 196 days after seeding. Consequently, the alkaloid contents found in the seeds likely originate from other aerial parts of the plant and are not significantly increased by the pods.

Application of Pyroligneous Acid as a Plant Growth Stimulant Can Improve the Nutritional Value of Soybean Seed

Farmers today are using biochemical treatments to improve their crop yields. Commercialized organic biostimulants exist in the form of pyroligneous acid generated by burning agricultural waste products. During the 2023 growing season, we demonstrated that soil treatment with a commercial pyroligneous acid product, Coriphol™, manufactured by Corigin Solutions, Inc., stimulated plant growth and significantly improved yield with an optimal treatment dose of 2 gal. acre−1. In the present work, we examined the effect of this treatment on soybean nutritional content using seed harvested from the 2023 season. Total mean seed protein content for untreated control plants was 32.26 ± 0.49% of dry mass and increased 10.8% to 35.64 ± 0.64% with treatment. This increase resulted in a net reduction in total free amino acid content, although levels of the essential dietary amino acid, lysine, were boosted 6-fold. Total lipid content was unaffected by treatment with mean levels of 21.61 ± 0.70% of dry mass noted. Treatment, however, reduced saturated fatty acid content by roughly 40%, and reduced the polyunsaturated content of linoleic acid in favor of the monounsaturated fatty acid, oleic acid. Finally, Coriphol™ treatment did not impact seed content of eight essential micronutrients including Na, Mg, K, Ca, Fe, Ni, Cu, and Mo, but did significantly boost Zn and Mn levels. Altogether, these results demonstrate that soil treatment with the growth stimulant Coriphol™ has the potential to improve the dietary nutritional value of soybean.

Biopriming using microbial consortia and biostimulants as a technique to increase seed quality of Solanum melongena L. by modifications in morphological and metabolic constituents

Brinjal (Solanum melongena L.) is a widely cultivated vegetable in tropical and subtropical regions. High-quality seeds are crucial for successful crop production, necessitating rapid and uniform field emergence. In the new wave of the Green Revolution, organic wastes were replaced by agrochemicals. This study was conducted from January to March 2024 to standardize biopriming techniques for brinjal using various organic inputs and microbial cultures to improve seed quality. Brinjal seeds cv. PLR 2 were treated with organic inputs (Panchagavya, Egg fermented extract, Fish fermented extract and effective microorganism solution) and liquid microbial cultures (Azospirillum and Pink Pigmented Facultative Methylotroph). The bioprimed seeds were assessed for their physiological attributes and anatomical and biochemical changes. Compared with the control, biopriming with 2% Fish fermented extract significantly improved the germination rate (19.4%), germination energy (40.9%), root length (44.4%), shoot length (24.4%) and seedling vigour index (68.1%). This increase was attributed to the nutritional and bioactive compounds in the fish by-products, which promoted root development and nutrient absorption. The biochemical parameters revealed increased ?-amylase activity, protein, and amino acid content in the bioprimed seeds. Gas Chromatography-Mass Spectrometry (GC-MS) analysis revealed beneficial root volatile compounds in the roots of treated seeds. An evaluation of the plant growth-promoting activities of the biopriming agents revealed the superiority of fish-fermented extract over other bioagents. Therefore, this method promotes sustainable agriculture and improved crop productivity, providing a scientific basis for biopriming as a viable alternative to conventional seed treatments.

Effectiveness of the use of chickpea collection samples in breeding

Aim. To determine the breeding value the large number of collection chickpea (Cicer arietinum L.) varieties obtained from the International Crops Research Institute for the Semi-Arid Tropics (India, Patancheru, ICRISAT) and the National Center for Plant Genetic Resources of Ukraine (Kharkiv) was evaluated in 1995-2022 under the conditions of the steppe zone of Ukraine. Methods. Standard field and laboratory methods (phenological observations, hybridization, structural analysis, biochemical analysis of protein content in seeds according to the Kjeldahl method), statistical analysis. Results. Donors and sources of such economically valuable features as early maturity, increased productivity, protein content in seeds, large-seeded, resistance against pathogens on an artificially created infectious background were identified. The set of 12 varieties of chickpea were developed by artificial hybridization, which are recommended for cultivation in all zones of Ukraine. Conclusions.The characteristics of the created varieties are given, the most valuable collection genotypes for use in crossing programs are recommended.

The genome of Lupinus mutabilis: Evolution and genetics of an emerging bio-based crop.

Lupinus mutabilis is an under-domesticated legume species from the Andean region of South America. It belongs to the New World lupins clade, which groups several lupin species displaying large genetic variation and adaptability to highly different environments. L. mutabilis is attracting interest as a potential multipurpose crop to diversify the European supply of plant proteins, increase agricultural biodiversity, and fulfill bio-based applications. This study reports the first high-quality L. mutabilis genome assembly, which is also the first sequenced assembly of a New World lupin species. Through comparative genomics and phylogenetics, the evolution of L. mutabilis within legumes and lupins is described, highlighting both genomic similarities and patterns specific to L. mutabilis, potentially linked to environmental adaptations. Furthermore, the assembly was used to study the genetics underlying important traits for the establishment of L.mutabilis as a novel crop, including protein and quinolizidine alkaloids contents in seeds, genomic patterns of classic resistance genes, and genomic properties of L. mutabilis mycorrhiza-related genes. These analyses pointed out copy number variation, differential genomic gene contexts, and gene family expansion through tandem duplications as likely important drivers of the genomic diversity observed for these traits between L. mutabilis and other lupins and legumes. Overall, the L. mutabilis genome assembly will be a valuable resource to conduct genetic research and enable genomic-based breeding approaches to turn L.mutabilis into a multipurpose legume crop.

Optimized irrigation and fertilization can mitigate negative CO2 impacts on seed yield and vigor of hybrid maize

Seed yield and vigor of hybrid maize determine the planting, yield, and quality of maize, and consequently affect food, nutrition, and livelihood security; however, the response of seed yield and vigor to climate change is still unclear. We established an optimization-simulation framework consisting of a water‑nitrogen crop production function, a seed vigor and a gridded process-based model to optimize irrigation and nitrogen fertilization management, and used it to evaluate seed yield and vigor in major seed production locations of China, the USA, and Mexico. This framework could reflect the influence of water and nitrogen inputs at different stages on seed yield and vigor considering the spatio-temporal variability of climate and soil properties. Projected seed yield and vigor decreased by 5.8–9.0 % without adaptation by the 2050s, due to the 1.3–5.8 % decrease in seed number and seed protein concentration. Seed yield was positively correlated with CO2 and negatively correlated with temperature, while seed vigor depended on the response of components of seed vigor to climatic factors. Under optimized management, the direct positive effects of temperature on seed protein concentration and CO2 on seed number were strengthened, and the direct negative effects of temperature on seed number and CO2 on seed protein concentration were weakened, which mitigated the reductions in both seed yield and vigor. Elevated CO2 was projected to exacerbate the 2.6 % seed vigor reduction and mitigate the 2.9 % seed yield loss without adaptation, while optimized management could increase seed yield by 4.1 % and mitigate the 2.2 % seed vigor reduction in the Hexi Corridor of China, and decrease the seed yield and vigor reduction by 2.4–5.8 % in the USA and Mexico. Optimized management can strengthen the positive and mitigate the negative effects of climate change on irrigated hybrid maize and inform high-yield and high-quality seed production globally.

Physiological traits, crop growth, and grain quality of quinoa in response to deficit irrigation and planting methods

Climate change has become a concern, emphasizing the need for the development of crops tolerant to drought. Therefore, this study is designed to explore the physiological characteristics of quinoa that enable it to thrive under drought and other extreme stress conditions by investigating the combined effects of irrigation water levels (100%, 75%, and 50% of quinoa's water requirements, WR as I1, I2 and I3) and different planting methods (basin, on-ridge, and in-furrow as P1, P2 and P3) on quinoa's physiological traits and gas exchange. Results showed that quinoa’s yield is lowest with on-ridge planting and highest in the in-furrow planting method. Notably, the seed protein concentrations in I2 and I3 did not significantly differ but they were 25% higher than those obtained in I1, which highlighted the possibility of using a more effective irrigation method without compromising the seed quality. On the other hand, protein yield (PY) was lowest in P2 (mean of I1 and I2 as 257 kg ha−1) and highest in P3 (mean of I1 and I2 as 394 kg ha−1, 53% higher). Interestingly, PY values were not significantly different in I1 and I2, but they were lower significantly in I3 by 28%, 27% and 20% in P1, P2, and P3, respectively. Essential plant characteristics including plant height, stem diameter, and panicle number were 6.1–16.7%, 6.4–24.5%, and 18.4–36.5% lower, respectively, in I2 and I3 than those in I1. The highest Leaf Area Index (LAI) value (5.34) was recorded in the in-furrow planting and I1, while the lowest value was observed in the on-ridge planting method and I3 (3.47). In I3, leaf temperature increased by an average of 2.5–3 oC, particularly during the anthesis stage. The results also showed that at a similar leaf water potential (LWP) higher yield and dry matter were obtained in the in-furrow planting compared to those obtained in the basin and on-ridge planting methods. The highest stomatal conductance (gs) value was observed within the in-furrow planting method and full irrigation (I1P3), while the lowest values were obtained in the on-ridge and 50%WR (I3P2). Finally, photosynthesis rate (An) reduction with diminishing LWP was mild, providing insights into quinoa’s adaptability to drought. In conclusion, considering the thorough evaluation of all the measured parameters, the study suggests using the in-furrow planting method with a 75%WR as the best approach for growing quinoa in arid and semi-arid regions to enhance production and resource efficiency.

Identification of a Major QTL for Seed Protein Content in Cultivated Peanut (Arachis hypogaea L.) Using QTL-Seq.

Peanut (Arachis hypogaea L.) is a great plant protein source for human diet since it has high protein content in the kernel. Therefore, seed protein content (SPC) is considered a major agronomic and quality trait in peanut breeding. However, few genetic loci underlying SPC have been identified in peanuts, and the underlying regulatory mechanisms remain unknown, limiting the effectiveness of breeding for high-SPC peanut varieties. In this study, a major QTL (qSPCB10.1) controlling peanut SPC was identified within a 2.3 Mb interval in chromosome B10 by QTL-seq using a recombinant inbred line population derived from parental lines with high and low SPCs, respectively. Sequence comparison, transcriptomic analysis, and annotation analysis of the qSPCB10.1 locus were performed. Six differentially expressed genes with sequence variations between two parents were identified as candidate genes underlying qSPCB10.1. Further locus interaction analysis revealed that qSPCB10.1 could not affect the seed oil accumulation unless qOCA08.1XH13 was present, a high seed oil content (SOC) allele for a major QTL underlying SOC. In summary, our study provides a basis for future investigation of the genetic basis of seed protein accumulation and facilitates marker-assisted selection for developing high-SPC peanut genotypes.

Identification of QTLs and candidate genes for water-soluble protein content in soybean seeds

Soybean represents a vital source of premium plant-based proteins for human nutrition. Importantly, the level of water-soluble protein (WSP) is crucial for determining the overall quality and nutritional value of such crops. Enhancing WSP levels in soybean plants is a high-priority goal in crop improvement. This study aimed to elucidate the genetic basis of WSP content in soybean seeds by identifying quantitative trait loci (QTLs) and set the foundation for subsequent gene cloning and functional analysis. Using 180 F10 recombinant inbred lines generated by crossing the high-protein soybean cultivar JiDou 12 with the wild variety Ye 9, our researcher team mapped the QTLs influencing protein levels, integrating Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and gene expression profiling to identify candidate genes. During the 2020 and 2022 growing seasons, a standard bell-shaped distribution of protein content trait data was observed in these soybean lines. Eight QTLs affecting protein content were found across eight chromosomes, with LOD scores ranging from 2.59 to 7.30, explaining 4.15–11.74% of the phenotypic variance. Notably, two QTLs were newly discovered, one with a elite allele at qWSPC-15 from Ye 9. The major QTL, qWSPC-19, on chromosome 19 was stable across conditions and contained genes involved in nitrogen metabolism, amino acid biosynthesis, and signaling. Two genes from this QTL, Glyma.19G185700 and Glyma.19G186000, exhibited distinct expression patterns at maturity, highlighting the influence of these genes on protein content. This research revealed eight QTLs for WSP content in soybean seeds and proposed a gene for the key QTL qWSPC-19, laying groundwork for gene isolation and enhanced soybean breeding through the use of molecular markers. These insights are instrumental for developing protein-rich soybean cultivars.

The vacuolar sulfate transporter PsSULTR4 is a key determinant of seed yield and protein composition in pea.

Pea is a grain legume crop with a high potential to accelerate the food transition due to its high seed protein content and relatively well-balanced amino acid composition. The critical role of external sulfur (S) supply in determining seed yield and seed quality in pea makes it essential to understand the impact of whole plant S management on the trade-off between these two traits. Here, we investigated the physiological relevance of vacuolar sulfate remobilization by targeting PsSULTR4, the only pea sulfate transporter showing substantial similarity to the vacuolar sulfate exporter AtSULTR4;1. Five mutations in PsSULTR4 were identified by TILLING (Targeting Induced Local Lesions IN Genomes), two of which, a loss of function (W78*) and a missense (E568K), significantly decreased seed yield under S deprivation. We demonstrate that PsSULTR4 triggers S distribution from source tissues, especially lower leaves, to reproductive organs to maintain seed yield under S deficiency. Under sufficient S supply, sultr4 seeds display lower levels of the S-rich storage protein PA1 at maturity. They also overaccumulate sulfate in the endosperm at the onset of seed filling. These findings uncover a role of PsSULTR4 in the remobilization of vacuolar sulfate during embryo development, allowing the efficient synthesis of S-rich proteins. Our study uncovers that PsSULTR4 functions (i) in source tissues to remobilize stored vacuolar sulfate for seed production under low S availability and (ii) in developing seeds well supplied with S to fine-tune sulfate remobilization from the endosperm as a critical control point for storage activities in the embryo.

Association study of crude seed protein and fat concentration in a USDA pea diversity panel.

Pea (Pisum sativum L.) is a key rotational crop and is increasingly important in the food processing sector for its protein. This study focused on identifying diverse high seed protein concentration (SPC) lines in pea plant genetic resources. Objectives included identifying high-protein pea lines, exploring genetic architecture across environments, pinpointing genes and metabolic pathways associated with high protein, and documenting information for single nucleotide polymorphism (SNP)-based marker-assisted selection. From 2019 to 2021, a 487-accession pea diversity panel, More protein, More pea, More profit, was evaluated in a randomized complete block design. DNA was extracted for genomic analysis via genotype-by-sequencing. Phenotypic analysis included protein and fat measurements in seeds and flower color. Genome-wide association study (GWAS) used multiple models, and the Pathways Association Study Tool was used for metabolic pathway analysis. Significant associations were found between SNPs and pea seed protein and fat concentration. Gene Psat7g216440 on chromosome 7, which targets proteins to cellular destinations, including seed storage proteins, was identified as associated with SPC. Genes Psat4g009200, Psat1g199800, Psat1g199960, and Psat1g033960, all involved in lipid metabolism, were associated with fat concentration. GWAS also identified genes annotated for storage proteins associated with fat concentration, indicating a complex relationship between fat and protein. Metabolic pathway analysis identified 20 pathways related to fat and seven to protein concentration, involving fatty acids, amino acid and protein metabolism, and the tricarboxylic acid cycle. These findings will assist in breeding of high-protein, diverse pea cultivars, and SNPs that can be converted to breeder-friendly molecular marker assays are identified for genes associated with high protein.