Second-stage Juveniles Research Articles

Relationship between the distribution of the pinewood nematode (Bursaphelenchus xylophilus) and the development of xylem embolism in the stems of Japanese black pine (Pinus thunbergii) seedlings monitored by magnetic resonance imaging.

The development of xylem embolism in 1-year-old stems of Japanese black pine (Pinus thunbergii) seedlings was monitored by compact magnetic resonance imaging (MRI) after inoculation with the pinewood nematode (Bursaphelenchus xylophilus). In parallel, the nematode distribution and population structure in the stems were examined by isolating the nematodes using the Baermann funnel technique. The vertical length and volume of massive embolisms in each seedling were strongly correlated with the maximum relative embolized area (REA) in stem cross-sections. Embolism development and nematode reproduction were not restricted to the inoculation site, as any portion of the stem could be the initial point of a population burst. The nematode population in the stem xylem was strongly correlated with the REA and with the circumferential proportion of cambial death in cross-sections monitored by MRI. The proportion of second-stage juveniles was also correlated with the REA in the xylem. In contrast, the nematode population in bark tissue was not correlated with either the REA or cambial death. These results suggested that nematode reproduction in the cambial zone is the key step in pine wilt disease, and second-stage juveniles were suggested to induce massive embolisms in the advanced stage of the disease.

Involvement of G-protein alpha subunit in soybean cyst nematode chemotaxis

The soybean cyst nematode (SCN; Heterodera glycines Ichinohe) is a significant agricultural pest that causes extensive damage to soybean production worldwide. Second-stage juveniles (J2s) of the SCN migrate through the soil and infest the roots of host plants in response to certain chemical substances secreted from the host roots. Therefore, controlling SCN chemotaxis could be an effective strategy for its management.In the present study, we identified the Hg-gpa-3d gene, which encodes the G protein alpha subunit, as a key regulator of SCN chemotaxis. Gene silencing of Hg-gpa-3d reduced the attraction of SCN J2s to host roots, as well as to nitrate ions, a chemoattractant recognized through a mechanism different from that of host recognition. However, silencing of Hg-gpa-3d did not affect avoidance behavior towards unpleasant temperatures or stylet protrusion. These results suggest that Hg-gpa-3d is a crucial gene in the regulation of SCN chemotaxis and provide new insights into the chemotactic mechanisms of the SCN.

Biocontrol potential of nicotinamide from Arachis hypogaea roots against Meloidogyne incognita

Root knot nematode disease is a global problem that causes significant economic losses to cash crops annually, and Meloidogyne incognita is the most destructive threat. The urgent need for reliable biocontrol agents is evident. This study evaluated the nematicidal effects of various tissue extracts from Arachis hypogaea, a non-host plant of M. incognita. Subsequently, the metabolic changes in peanut roots induced by M. incognita were analyzed, and the in vitro biological activity of differential metabolites were tested. The results indicated that peanut root extracts showed the highest inhibiting effect on M. incognita, the LC50 values were 18.54 mg/mL, 11.58 mg/mL, and 8.05 mg/mL after treated 24, 36, and 48 hours, respectively. Additionally, it was found that M. incognita infestation induced distinct metabolic changes in peanut roots. Among the differential metabolites, nicotinamide exhibited strong nematicidal effects on M. incognita, and the corrected mortality of second-stage juveniles and hatching inhibition of eggs could reach 99.65% and 95.90%, respectively at a concentration of 25 mg/mL. In conclusion, nicotinamide manifested distinctive advantages as a novel nematicide for the potential applications in sustainable agriculture.

Coffee and its waste repel second-stage juveniles of Meloidogyne species and inhibit their infection of lettuce roots

Summary Second-stage juveniles (J2) of Meloidogyne species are known to be repelled by several compounds. Although such repellents could serve for nematode control, effective, practical and sustainable repellents are unknown. The present study tested instant coffee crystals (ICC) and a methanolic extract of spent coffee grounds (SCG) for their repellency against, and infection inhibition of, J2 of Meloidogyne species on agar plate assays. J2 of Meloidogyne javanica, M. hapla and M. marylandi were repelled by the SCG extract and ICC. When ICC were mixed with chemical J2 attractants, their attractiveness to M. javanica J2 was reduced or abolished. ICC and the SCG extract deposited near lettuce seedling roots on the agar plate reduced the number of M. javanica, M. incognita, and M. hapla J2 attracted to the root tips by 84.3-96.4%, decreased infection rates by 37.5-75.0%, and increased root length 1.3- to 2.8-fold compared to seedlings grown on the non-treated side of the same plate. Thoroughly mixing the SCG extract into the plated agar reduced the number of J2 of the three species attracted to lettuce root tips by 46.7-98.6% and the infection rate by 87.5-95.8%, and increased the root length of the seedlings up to 2.8-fold, although no nematicidal effect was found. The same SCG-treated agar plate reduced the attraction of M. javanica J2 to a chemical attractant. The results suggest that ICC and the SCG extract have repellent and infection-inhibitory activity against Meloidogyne J2 and are potential control means for Meloidogyne species.

Metabolic engineering of a 1,8-cineole synthase from Nicotiana suaveolens, confers enhanced resistance to Meloidogyne incognita by synergistic blend of root volatiles

Root-knot nematodes (RKNs) pose a significant threat to global crop production. Given the detrimental effects of fumigants and conventional chemical nematicides, there is a growing interest in exploring biological nematicides as a promising alternative for pest control. In this study, we present data demonstrating the role of root volatiles in enhancing resistance against Meloidogyne incognita (M. incognita) in tobacco plants overexpressing NsCINS (NsCINS-OE). The NsCINS gene, derived from Nicotiana suaveolens, encodes a 1,8-cineole synthase induced by M. incognita infection and predominantly localized to the chloroplast. The roots of NsCINS-OE plants exhibited deterrent properties to infective second-stage juveniles (J2s) of M. incognita. Moreover, NsCINS-OE plants showed enhanced resistance against M. incognita, as evidenced by reduced gall numbers and egg mass counts compared to wild type (WT) plants. Notably, the emission of root volatiles from NsCINS-OE plants, including 1,8-cineole, α-terpineol, terpinene-4-ol, and furfural, was significantly higher than that of WT. In vitro assays confirmed that a mixture of commercially available volatile organic compounds (VOCs) had a deterrent effect on infective J2s. Furthermore, the natural root volatiles emitted by NsCINS-OE plants effectively enhanced tobacco's resistance against M. incognita. Our findings provide valuable insights into the role of NsCINS in volatile-based defense and highlight the potential of metabolic engineering of monoterpene synthase genes to control M. incognita by enhancing root volatile emissions.

A New Cyst Nematode, Heterodera luodingensis n. sp. (Nematoda: Heteroderinae) From Rice In China.

A unique cyst nematode population (Heterodera spp.) was collected from rice roots in Luoding County, Guangdong Province, China. Morphological and molecular analyses revealed it is significantly different from all previously described cyst nematode species. It is described as Heterodera luodingensis n. sp. and classified in the Cyperi group. H. luodingensis n. sp. is characterized by its lemon-shaped cyst with a prominent terminal vulval cone that is ambifenestrate with abundant bullae and a relatively short vulval slit, 31.3 (24.4 -38.7) μm long. The second-stage juveniles (J2) are characterized by dumbbell shaped labials, three lip annules and a lateral field with three incisures. The J2 stylet is 18.7 (16.9 -19.8) μm long with anterior concave or spherical knobs. The tail is elongate conoid, tapering to a rounded terminus or zig tapering to a rounded terminus that is 54.9 (43.9 - 64.3) μm long with a hyaline region comprising 40.3%-52.5% of the tail. Phylogenetic tree analysis based on rDNA 28S D2D3 and ITS fragments showed that the H. luodingensis n. sp. is unique and clearly separated it from other cyst nematodes. It is most closely related to H. oryzicola, H. fengi, H. elachista, H. oryzae, and H. guangdongensis. H. luodingensis n. sp. can be distinguished from H. oryzicola by its shorter vulval slit and underbridge, from H. elachista by abundant bullae, shorter vulval slit and fenestrate width, from H. oryzae by a shorter vulval slit and underbridge, from H. fengi by a shorter vulval slit, from H. guangdongensis by a longer cyst length and abundant bulla. Based on PCR-RFLP of rDNA-ITS, H. luodingensis n. sp. can be clearly distinguished from H. oryzicola, H. mothi, H. elachista, H. guangdongensis and H. cyperi. A parasitism test from a pure culture derived from a single cyst in greenhouse showed that H. luodingensis n. sp. can successfully complete its life cycle on rice and rice is its type host.

Streptomyces avermitilis MICNEMA2022: a new biorational strain for producing abamectin as an integrated nematode management agent

BackgroundAbamectin (ABA) is considered a powerful insecticidal and anthelmintic agent. It is an intracellular product of Streptomyces avermitilis; is synthesized through complicated pathways and can then be extracted from mycelial by methanol extraction. ABA serves as a biological control substance against the root-knot nematode Meloidogyne incognita. This investigation is intended to reach a new strain of S. avermitilis capable of producing ABA effectively.ResultsAmong the sixty actinobacterial isolates, Streptomyces St.53 isolate was chosen for its superior nematicidal effectiveness. The mycelial-methanol extract of isolate St.53 exhibited a maximum in vitro mortality of 100% in one day. In the greenhouse experiment, the mycelial-methanol extract demonstrated, for the second-stage juveniles (J2s), 75.69% nematode reduction and 0.84 reproduction rate (Rr) while for the second-stage juveniles (J2s), the culture suspension demonstrated 75.38% nematode reduction and 0.80 reproduction rate (Rr). Molecular identification for St.53 was performed using 16 S rRNA gene analysis and recorded in NCBI Genbank as S. avermitilis MICNEMA2022 with accession number (OP108264.1). LC-MS was utilized to detect and identify abamectin in extracts while HPLC analysis was carried out for quantitative determination. Both abamectin B1a and abamectin B1b were produced and detected at retention times of 4.572 and 3.890 min respectively.ConclusionStreptomyces avermitilis MICNEMA2022 proved to be an effective source for producing abamectin as a biorational agent for integrated nematode management.

Piriformospora indica modifies cucumber’s tolerance to Meloidogyne incognita by regulating various agro-physiological traits, antioxidant enzymes, and abscisic acid pathway genes

Root knot nematode (RKN), Meloidogyne incognita, is considered a major soil-borne pathogen that can cause severe yield losses for vegetables and diverse crops. Usually, reducing of M. incognita damage is mainly relies on the application of nematicides and good agricultural practices. However, the use of synthetic nematicides is restricted due to concerns about their impact on the environment and human health. As a result, the use of alternative strategies is becoming necessary to combat RKN resistance. This study evaluates the antagonistic impact of the root mutualistic fungus Pirforomospora indica on M. incognita. It also assesses its influence on the nutritional status, photo-synthesis, antioxidant enzyme activity, endogenous abscisic acid (ABA) levels, and selected ABA related-responsive genes in cucumber plants. Roots of cucumber seedlings were inoculated with P. indica and the second-stage juveniles (1000 J2 per plant). The results demonstrated that P. indica significantly reduced M. incognita invasion in roots, resulting in a 24% reduction in root galling and 42.6% decline in final population. Inoculating plants with both P. indica and RKN increased performance of root fresh and dry weight, as well as improved photochemical efficiency of PSII (Fv/Fm), photosystem II efficiency (PSII), catalase (CAT), peroxidase (POD), and superoxide dis-mutase (SOD). Furthermore, P. indica colonization, either alone or in combination with M. incognita, significantly improved number of fruits per plant, average fruit weight, the plant's marketable yield, and leaf nutrient content (N, P, K and Mg), Moreover, there was an increase in IAA content combined with a decrease in ABA content in roots of dual inoculation plants, if compared to M. incognita infested plants. The highest ABA content was recorded in the root of RKN-cucumber plants. The decline in ABA content due to P. indica treatment was consistent with the modulation of ABA pathway genes, specifically PP2C, PYL1, RK2,1, and RK2,2. The mixed of P. indica and M. incognita led to a decrease in the expression of PP2C, PLY1, RK2,1, and RK2,2 in comparison to the control group. These results indicate that P. indica application could help reduce the negative effects of RKN on important crops.

Characterization of the Serine Protease TlSP1 from Trichoderma longibrachiatum T6 and Its Function in the Control of Heterodera avenae in Wheat.

Serine protease is an extracellular protease secreted by biocontrol fungi that can effectively control nematode diseases by degrading nematode eggshells and enhancing plant resistance. Trichoderma longibrachiatum T6, an important biocontrol fungus, has been demonstrated to effectively parasitize and degrade Heterodera avenae cysts, eggs, and second-stage juveniles (J2s). However, the genes that encoding serine protease and their functions in T. longibrachiatum T6 have not been thoroughly investigated. In this study, we successfully cloned and sequenced the serine protease gene TlSP1 in T. longibrachiatum T6. Our results revealed that the expression level of the TlSP1 gene was induced and significantly increased in T. longibrachiatum T6 after inoculation with H. avenae cysts. The full-length sequence of the coding region (CDS) of TlSP1 gene was 1230 bp and encoded a protein consisting of 409 amino acids. Upon the transformation of the TlSP1 gene into Pichia pastoris X33, the purified recombinant TlSP1 protein exhibited optimal activity at a temperature of 50 °C and pH 8.0. Following 4-10-day of treatment with the purified recombinant TlSP1 protein, the eggshells and content were dissolved and exuded. The number of nematodes invading wheat roots was reduced by 38.43% in the group treated with both TlSP1 and eggs on one side (P1+N) compared to the control group, while the number of nematodes invading wheat roots was reduced by 30.4% in the TlSP1 and eggs two-sided treatment group (P1/N). Furthermore, both the P1+N and P1/N treatments significantly upregulated genes associated with defense enzymes (TaPAL, TaCAT, TaSOD, and TaPOD), genes involved in the lignin synthesis pathway (TaC4H, Ta4CL2, TaCAD1, and TaCAD12), and salicylic acid (SA)-responsive genes (TaNPR1, TaPR1, and TaPR2) and led to the high expression of jasmonic acid (JA)-responsive genes (TaPR4, TaOPR3, and TaAOS2). This study has highlighted the significant role of the TlSP1 gene in facilitating H. avenae eggshells' dissolution, preventing nematode invasion in the host plant, and boosting plant resistance in wheat.

Morphological and Biochemical Changes in the Mediterranean Cereal Cyst Nematode (Heterodera latipons) during Diapause.

The cereal cyst nematode (Heterodera latipons) is becoming an economically important species in global cereal production as it is being identified in many new cereal cultivated areas and causes significant losses. Consequently, understanding its biology becomes crucial for researchers in identifying its vulnerabilities and implementing effective control measures. In the current study, different morphological and biochemical changes of H. latipons cysts containing eggs with infective juveniles from a barley field in Jordan were studied during the summer of 2021, at two sample dates. The first, at the harvest of the cereal crop (June 2021), when the infective second-stage juveniles (J2s) were initiating diapause, and the second, before planting the sequent cereal crop (late October 2021), when the J2s were ending diapause. The studied population was characterized morphologically and molecularly, showing 98.4% molecular similarity to both JOD from Jordan and Syrian "300" isolates of H. latipons. The obtained results and observations revealed that there were dramatic changes in all the investigated features of the cysts and eggs they contained. Morphological changes such as cyst color, sub-crystalline layer, and thickness of the rigid eggshell wall were observed. A slight change in the emergence time of J2s from cysts was observed without any difference in the number of emerged J2s. The results of biochemical changes showed that the total contents of carbohydrates, glycogen, trehalose, glycerol, and protein were higher in cysts collected in October when compared to those cysts collected in June. The SDS-PAGE pattern indicated the presence of a protein with the size of ca. 100 kDa in both sampling dates, whereas another protein (ca. 20 kDa) was present only in the cysts of October. Furthermore, the expression of trehalase (tre) gene was detected only in H. latipons collected in October. The outcomes of this study provide new helpful information that elucidates diapause in H. latipons and may be used for the implementation of new management strategies of cyst nematodes.

Identification of bioactive compounds in cavalcade leaves for nematicidal activity against Hirschmanniella mucronata and Meloidogyne graminicola using LC-QTOF-MS

Hirschmanniella mucronata and Meloidogyne graminicola are the main plant-parasitic nematodes found in paddy fields in Thailand causing significant rice production yield losses. Although these nematodes are found widely in fields, an effective management method has not been documented. Here, we examined the nematicidal effects of different cavalcade leaf ages (1-, 2- and 3-month-old), used as aqueous extracts and soil amendments, on H. mucronata and M. graminicola. In vitro tests evidenced maximum mortality of H. mucronata (55.6–60.0%) in 50 mg ml−1 extract from all leaf ages, while mortality (65.9%) and hatchability (67.0%) of M. graminicola second-stage juveniles were observed in 50 mg ml−1 extract from 1-month-old leaves only. Moreover, aqueous extracts of cavalcade showed a repellent effect on both nematodes. Similarly, greenhouse experiments showed a significant reduction of H. mucronata population densities and reproduction of M. graminicola in soil amended with 0.5 and 1.0% (w/w) from each leaf age. LC-QTOF-MS analysis determined that three bioactive compounds, including quercetin, rutin, and kaempferol, are associated with the nematicidal activity of cavalcade against H. mucronata and M. graminicola. The information derived from this study indicates that the leaves of cavalcade are a source of promising phytonematicidals. This is the first study to assess and document its potential for nematicidal activity against H. mucronata and M. graminicola in Thailand. However, further research is needed to evaluate their efficacy under paddy field conditions.

Nematicidal Activity of Volatiles against the Rice Root-Knot Nematode and Environmental Safety in Comparison to Traditional Nematicides.

The rice root-knot nematode (RRKN), Meloidogyne graminicola Golden and Birchfield 1965, is a dangerous crop pest that affects rice production on a global scale. The largest rice-producing countries struggle with the impacts of RRKN infestation, namely, underdeveloped plants and a reduction in rice grain that can reach up to 70% of crop yield. In addition, the shift to strategies of sustainable pest management is leading to a withdrawal of some of the most effective pesticides, given the dangers they pose to the environment and human health. Volatile metabolites produced by plants can offer safer alternatives. The present study characterized the nematicidal activity of volatile phytochemicals against the RRKN and compared the most active with commercial nematicides concerning their safety to the environment and human health. Rice plants were used to grow large numbers of RRKNs for direct-contact bioassays. Mortality induced by the volatiles was followed for four days on RRKN second-stage juveniles. Of the 18 volatiles tested, carvacrol, eugenol, geraniol, and methyl salicylate showed the highest mortalities (100%) and were compared to traditional nematicides using (eco)toxicological parameters reported on freely available databases. While methyl salicylate had a faster activity, carvacrol had more lasting effects. When compared to synthetic nematicides, these volatile phytochemicals were reported to have higher thresholds of toxicity and beneficial ecotoxicological parameters. Ultimately, finding safer alternatives to traditional pesticides can lower the use of damaging chemicals in farming and leverage the transition to agricultural practices with a lower impact on biodiversity.

Nematicidal Potential of Green Chiretta Extracts Against Meloidogyne enterolobii and M. Incognita: In vitro Assessment for Agricultural Application

Root-knot nematodes pose a persistent threat to various economically important crops in Thailand, with limited available management strategies for farmers. This study aimed to assess the efficacy of aqueous (AE), methanolic (ME), ethanolic (EE), ethyl acetate (EAE), and chloroform (CE) crude extracts derived from green chiretta in controlling Meloidogyne enterolobii and M. incognita under laboratory conditions. The results demonstrated significant inhibitory effects of all crude extracts, except for CE, against both nematode species. Notably, AE (10 and 20 mg/mL), ME (20 mg/mL), and EE (20 mg/mL) treatments exhibited maximum inhibition of hatching, leading to a considerable reduction in nematode hatch rates by 87.5 - 96.8 % for M. enterolobii and 88.5 - 96.5 % for M. incognita, compared with distilled water (DW). In terms of second-stage juveniles (J2s) mortality, AE (10 and 20 mg/mL), ME (20 mg/mL), and EAE (20 mg/mL) demonstrated the highest nematicidal activity, resulting in mortality rates of 94.2 - 100 % for M. enterolobii and 92.2 - 99.2 % for M. incognita. Chemotaxis assays revealed a repellent effect of all extracts on both nematode species, except for the ethyl acetate extract (EAE), which attracted M. incognita J2s without affecting M. enterolobii J2s. The observed efficacy was attributed to the higher concentrations of bioactive compounds, including flavonoids, phenolics, and terpenoids, in the extracts compared to CE. Based on these in vitro findings, it is suggested that AE, ME, EE, and EAE of green chiretta exhibit significant nematicidal activity against M. enterolobii and M. incognita. Further evaluation under greenhouse and field conditions is warranted to ascertain the practical applicability and effectiveness of these extracts in a real-world agricultural setting.

Utilizing endophytic plant growth-promoting bacteria and the nematophagous fungus Purpureocillium lilacinum as biocontrol agents against the root-knot nematode (Meloidogyne incognita) on tomato plants

AbstractThe present investigation was designed to assess how administering biocontrol agents (BCAs) made from the nematophagous endophytic fungus MR20 (Purpureocillium lilacinum) or a mixture of endophytic plant growth-promoting bacteria MR12 (Pseudomonas fluorescens), and MR25 (Serratia marcescens), could enhance tomato growth and resistance to Meloidogyne incognita under in vivo conditions. The three strains’ cell-free culture filtrates showed a strong nematocidal impact (P < 0.05) on M. incognita infective second-stage juveniles (J2s). The highest mortality rates by the three BCAs were at concentrations of 80%, followed by 60%, 40%, and 20%. The in vitro hatching of free eggs was found to be considerably (P < 0.05) reduced as the concentrations of the endophytic bacteria MR12, and MR25 were increased in the order 1 × 105, 1 × 106, 1 × 107, 0.5 × 108, to 1 × 108 colony forming units (CFU)/mL, and the maximum nematicidal activity in killing M. incognita free eggs occurred at 1 × 108 CFU/mL. A statistically significant (P < 0.05) reduction in the percentage of M. incognita-free eggs retrieved was seen in vitro when various concentrations of the endophytic fungus MR20 were applied compared to the negative control (distilled water). The endophytic fungus MR20 had the highest nematicidal activity against M. incognita free eggs at a concentration of 3 × 106 CFU/mL. The application of P. lilacinum or a combination of P. fluorescens and S. marcescens to tomato plants in the presence of M. incognita under greenhouse conditions resulted in a significant increase (P < 0.05) in root and shoot fresh weight, number of leaves, weight of leaves, and stem diameter when compared to the positive control treatment that contained only M. incognita. Treatment with P. lilacinum was more effective (P < 0.05) than P. fluorescens and S. marcescens in reducing egg masses per root, J2s per 100 g of soil, egg masses per 100 g of soil, J2s + eggs of M. incognita per 100 g of soil, reproduction factor, and reduction percentage after 60 days under greenhouse conditions. Nevertheless, the reduction of M. incognita gall size categorization (> 4 mm, 2–4 mm, and < 2 mm) was more effectively achieved by treatment with P. fluorescens and S. marcescens than by treatment with P. lilacinum. Under in vivo conditions, the tested P. lilacinum or a mixture of P. fluorescens and S. marcescens effectively controlled nematode population densities below the economic threshold.

Pathogenicity of Root-knot Nematode, Meloidogyne incognita on Tuberose (Polianthes tuberosa L.)

A pot experiment was carried out in the net house of Department of Nematology, Assam Agricultural University, Jorhat, to study the pathogenicity of root-knot nematode, Meloidogyne incognita, on tuberose. The study found that as the inoculum level of M. incognita increased from 10 to 10,000 second-stage juveniles (J2) per pot (containing 1 kg of sterilized soil), all plant growth parameters of tuberose decreased progressively. At the highest inoculum level, the plants became severely stunted, chlorotic, and produced very few bulblets. It was noted that at the highest inoculum level, the root systems were significantly reduced, with larger and mostly coalescent galls. The treatments with no nematode (check and associated check) were free from galls and eggmasses. An initial inoculum level of 100 J2 of M.incognita per kg of soil caused significant reduction in all growth parameters and proved to be pathogenic to the tuberose plants. The number of galls and eggmasses increased gradually in the plants with an initial inoculum level of 10 to 1000 J2 of M.incognita per kg of soil, but it declined at highest inoculum level of 10,000 J2 per kg of soil. The experiment also recorded the variation in nematode population in the soil as well as their reproductive rates. These findings can be used to develop effective, targeted methods for minimizing the damage caused by root-knot nematode in tuberose crops.

First report of the barley root-knot nematode, Meloidogyne naasi Franklin, 1965 from Pennsylvania, with new host report.

Meloidogyne naasi Franklin, 1965, the barley root-knot nematode, was originally found in field crops such as cereals, grasses, and sugar beet (Beta vulgaris L.) in England and Wales, (Franklin,1965). This nematode is one of the most significant root-knot nematodes impacting grains in European countries (Santos et al. 2020). Among root-knot nematode species, M. naasi, exhibits a distinct preference for grasses, with documented impacts on turfgrasses leading to reduced growth and vigor (Skantar et al., 2023; Cook and Yeates, 1993). In September 2022, root-knot nematode females and second-stage juveniles (J2) were recovered from roots of fowl manna grass, Glyceria striata (Lam.) Hitchc., during a nematode survey on natural vegetation at the Allegheny National Forest (41°30'13.8"N 79°09'46.2"W). Second-stage juvenile specimens were recovered from soil using sugar centrifugal flotation (Jenkins, 1964). Small galls with egg masses were dissected from fowl manna grass roots originally collected from the surveyed areas. In parallel, five plants of non-infected fowl manna grass were placed in a pot in the greenhouse using naturally nematode-infested soil collected from the same forested area. Small galls and female specimens recovered from these plants were dissected and processed for further analyses. Female and J2 were fixed in 3% formaldehyde solution and processed to glycerin (Golden, 1990; Hooper, 1970). The specimens were examined by light microscopy, morphometric measurements, and molecular markers, which included the D2-D3 region of the large ribosomal subunit 28S, and the rDNA internal transcribed spacer region (ITS). The perennial pattern of five females analyzed morphologically were consistent to the patterns observed for M. naasi. The perennial patterns had coarse ridges on the cuticle in dorsal region forming broken irregular lines around anal and phasmid area. We also noted a prominent fold that covered some of the anus and showed a curved line between vulval slit and phasmids, typical of M. naasi. The area around the vulval area had a few or no striae except for a few lines radiating from the vulval slit as in the original description. Measurements of ten J2 had a body length ranged between 380 and 410 µm, stylet 11-13 µm, tail 50-70 µm long with a hyaline tail terminus between 12-22 µm in length, 4 lines in the lateral field, a and c ratio between 29.23-35.91 and 5.79-7.9 fitting the original description by Franklin, 1965 and others populations found in the USA (Skantar et al., 2023). The matrix codes for the female specimes are A32, B324, C3, D3 and for J2's A2, B21, C123, D1, E3, F12 (Subbotin et al., 2021). The amplified DNA fragments were sequenced, resulting in an 726 bp fragment flanked by the D2-D3 primers (PP097762), while for the ITS primers an 634 bp fragment was obtained (PP092043). Both generated sequences for the specimens collected in Pennsylvania revealed >99% similarity to M. naasi sequences deposited at GenBank, and therefore, validating the morphological analyses. Based on both morphological and molecular analyses the specimens collected in the state of Pennsylvania were identified as M.naasi. To our knowledge, this is the first report of this species from this state and being associated with naturally infected fowl manna grass.

Evaluation of the lethal effect of hydrogen peroxide on the root-knot nematode, Meloidogyne javanica, and the disruption in the activity of enzymes related to its biosynthesis

Summary In this study, the accumulation of hydrogen peroxide (H2O2) in different parts (healthy root, gall, root attached to gall, aerial parts) of healthy tomato plants and plants infected by the root-knot nematode, Meloidogyne javanica, was investigated after treating the roots with β-aminobutyric acid (BABA). In addition, the effects of different concentrations of H2O2 (0-2 mM) on mortality, body structures and the digestive system of second-stage juveniles (J2) were also investigated in in vitro experiments. Results showed that exposure to concentrations of more than 1 mM H2O2 is lethal for J2, while the digestive system is not able to tolerate concentrations of more than 0.2 mM. Evaluating the activity level of enzymes related to biosynthesis and removing H2O2 in treated plants also showed that the nematode has significant suppressive effects on the biosynthesis enzymes of this compound, and this effect is greater in the site of nematode activity than in other parts of the plant. By contrast, the activity of catalase enzyme, as one of the H2O2-removing enzymes, shows a significant increase in all parts of nematode infected plants (especially in galls).

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Volatile organic compounds released from entomopathogenic nematode-infected insect cadavers for the biocontrol of Meloidogyne incognita.

Root-knot nematodes (RKNs), Meloidogyne spp., are one of the most destructive polyphagous plant-parasitic nematodes. They pose a serious threat to global food security and are difficult to control. Entomopathogenic nematodes (EPNs) show promise in controlling RKNs. However, it remains unclear whether the volatile organic compounds (VOCs) emitted from EPN-infected cadavers can control RKNs. We investigated the fumigation activity of VOCs released from cadavers infected by five different species of EPNs on RKNs in Petri dishes, and found that VOCs released from Steinernema feltiae (SN strain) and S. carpocapsae (All strain) infected cadavers had a significant lethal effect on second-stage juveniles (J2s) of Meloidogyne incognita. The VOCs released from the cadavers infected with S. feltiae were analyzed using SPME-GC/MS. Dimethyl disulfide (DMDS), tetradecane, pentadecane, and butylated hydroxytoluene (BHT), were selected for a validation experiment with pure compounds. The DMDS compound had significant nematicidal activity and repelled J2s. DMDS also inhibited egg hatching and the invasion of tomato roots by J2s. In a pot experiment, the addition of S. feltiae-infected cadavers and cadavers wrapped with a 400-mesh nylon net also significantly reduced the population of RKNs in tomato roots after 7 days. The number of root knots and eggs was reduced by 58% and 74.34%, respectively, compared to the control. These results suggested that the VOCs emitted by the EPN-infected cadavers affected various developmental stages of M. incognita and thus have the potential to be used in controlling RKNs through multiple methods. © 2024 Society of Chemical Industry.

Isolation, characterization, and predatory activity of nematode-trapping fungus, Arthrobotrys oligospora PSGSS01

A research study was undertaken to find a fungus that could effectively trap and kill Meloidogyne spp., which are root-knot nematodes that cause significant crop loss worldwide. Soil samples were collected and processed appropriately for the isolation of nematode-trapping fungi. After a primary screening, a potential nematode-trapping fungus, Arthrobotrys oligospora (Orbilia oligospora) PSGSS01 was selected for further investigation. Its growth was tested under various conditions, including different media types, temperatures, and pH levels. Its predatory activity on Meloidogyne incognita was also assessed in vitro. The fungus exhibited septate double-celled conidiospores, trapping hyphae, and radiating and sparse mycelium. Optimal conditions for growth were found to be at 25 °C and a pH of 4.0 and 5.0 on corn meal agar. The best temperature and pH for conidiospore germination were 25°C − 37°C and 5.0, respectively. The isolate could trap 94% of second-stage juveniles of M. incognita, and 92% juvenile mortality was recorded in 120 h at 28°C. Therefore, the study concluded that the isolate A. oligospora (Orbilia oligospora) PSGSS01 could be used as a biological control agent against root-knot nematodes.