rRNA Fragments Research Articles

Occurrence of Phytoplasmas Belonging to 16SrII Group Associated with Cyanthillium cinereum Witches'-Broom Diseases in China.

Cyanthillium cinereum, which belongs to the family of Asteraceae, is an annual or perennial herbaceous plant with significant medicinal uses for treating colds and fever. During September to November of 2020, C. cinereum showing symptoms of witches'-broom were found in economic forests distributed in Ding'an, Hainan Province of China, with 20% incidence. The symptoms of the plant were consistent with infections by 'Candidatus Phytoplasma' species. To identify the pathogen, five symptomatic and three asymptomatic C. cinereum samples were collected. Total DNAs were extracted using 0.10 g fresh leaf tissues of symptomatic and asymptomatic C. cinereum through a CTAB DNA extraction method according to Doyle and Doyle (1990). PCR amplification were performed employing the primer pairs of R16mF2/R16mR1 (Gundersen and Lee, 1996) and secAfor1/secArev3 (Hodgetts et al., 2008) specific for the conserved gene fragments of 16S rRNA and secA from phytoplasma. The PCR products were purified and sequenced through Biotechnology (Shanghai) Co., Ltd. (Guangzhou, China), and the obtained sequences were deposited in GenBank. The phytoplasmal 16S rRNA and secA gene fragments obtained in the study were all identical with the length of 1325 bp (GenBank accession: PP098738) and 741 bp (PP072217), respectively. The phytoplasma strain was described as CcWB-hnda. A BLAST search based on 16S rRNA genes indicated that CcWB-hnda strain was identical to phytoplasmas belonging to 16SrII group like peanut witches'-broom phytoplasma strain T48 (OR239773) and 'Ca. Phytoplasma aurantifolia' strain TB2022 (CP120449). Virtual RFLP profiles based on 16S rRNA gene fragments obtained by iPhyClassifier (Zhao et al., 2009) showed that CcWB-hnda strain was a member of 16SrII-A subgroup with 1.00 similarity coefficient to the reference phytoplasma strain (L33765). A BLAST search based on secA genes indicated that CcWB-hnda had 100% sequence identity with phytoplasmas belonging to 16SrII group such as 'Ca. Phytoplasma aurantifolia' isolate TB2022 (CP120449), Vigna unguiculata witches'-broom phytoplasma (OR661282) and Emilia sonchifolia witches'-broom phytoplasma (MW353710). Phylogenetic analysis based on 16S rRNA and secA genes by MEGA 7.0 employing Neighbor-Joining method with 1000 bootstrap value (Kumar et al., 2016; Felsenstein, 1985) demonstrated that CcWB-hnda was clustered into one clade with the phytoplasmas belonging to 16SrII group, with 98% and 100% bootstrap value respectively. To our knowledge, this is the first report of C. cinereum infected by phytoplasmas belonging to 16SrII-A subgroup in China. Identification of the vector insects of the pathogens is necessary in future, revealing the epidemiology of the related diseases. Phytoplasmas belonging to same 16Sr group or subgroup can infect different plants and spread through them in nature. The finding in this study will be beneficial to epidemic monitoring and early warning of C. cinereum witches'-broom disease and the related plant diseases caused by the phytoplasmas belonging to 16SrII group.

Babesia bigemina and Theileria annulata infections in cattle: molecular detection, phylogenetic analysis, and assessment of risk factors.

Babesia bigemina and Theileria annulata are tick-borne protozoans that cause piroplasmosis in cattle, resulting in huge damages to the livestock industry. The prevalence of these infections depends on various intrinsic and extrinsic risk factors. In Pakistan, there is no information regarding the molecular characterization of Babesia bigemina and the risk factors associated with piroplasmosis. This study aimed to molecularly characterize Babesia spp. and Theileria spp. infecting various cattle breeds in Khyber Pakhtunkhwa, Pakistan, and to shed light on risk factors associated with these infections. Altogether, 219 blood samples were collected from various symptomatic cattle breeds, including Holstein Friesian (65.3%; 143/219), Jersey (21.5%; 47/219) and Sahiwal (13.2%; 29/219). Isolated genomic DNA from these blood samples was used in PCR for the amplification of the 18S rRNA fragment of apicomplexan parasites. Obtained 18S rDNA sequences from cattle hosts showed 99.5% identity with B. bigemina, or 100% with T. annulata. Having an overall infection rate of 61.6% (135/219), the highest infection rate was recorded for T. annulata (43.8%; 95/219), followed by B. bigemina (18.3%; 40/219). Phylogenetic analysis of 18S rDNA sequences revealed that B. bigemina clustered with corresponding species reported from Bolivia, and South Africa, while T. annulata grouped with same species from Italy, India, and Turkey. Among the different risk factors, the breed, season, and tick infestation were found to have a significant (P < 0.05) association with the piroplasmid infections. The information obtained in this study can be employed for effective surveillance and control of babesiosis and theileriosis in Pakistan. In addition to confirming our previous molecular detection of T. annulata in cattle, this study provides the first molecular surveillance and phylogenetic position of B. bigemina and associated risk factors in the study region.

DNA Metabarcoding Approach as a Potential Tool for Supporting Official Food Control Programs: A Case Study.

Food authentication significantly impacts consumer health and the credibility of Food Business Operators (FBOs). As European regulations mandate the verification of food authenticity and supply chain integrity, competent authorities require access to innovative analytical methods to identify and prevent food fraud. This study utilizes the DNA metabarcoding approach on meat preparations, sampled during an official control activity. It assesses animal and plant composition by amplifying DNA fragments of the 12S rRNA and trnL (UAA) genes, respectively. The results not only confirmed the declared species but also revealed undeclared and unexpected taxa in products labelled as containing a single animal species and various unspecified plant species. Notable findings such as the presence of Murinae, Sus scrofa, Ovis aries, and Pisum sativum could raise public health concerns, compromise consumer choices made for ethical or religious reasons, and reflect the hygienic conditions of the processing plant. This study demonstrates that the DNA metabarcoding approach looks to be a promising support tool for official control authorities to ensure food authenticity and safety, and to develop risk profiles along the supply chain.

Crossroad between the sylvatic and domestic cycles of Mesocestoides litteratus: mesocestodiasis in dogs adopted from shelters in Türkiye.

This study aimed to report the presence of Mesocestoides litteratus in dogs adopted from shelters in Türkiye. Gravid segments were examined microscopically in the faeces of dogs from different shelters located in Ankara and Kirikkale provinces in the central region of Türkiye. Then, genomic DNA obtained from these segments, a 446-bp fragment of the mitochondrial cytochrome C oxidase subunit 1 gene, and a 350-bp fragment of mitochondrial 12S rRNA were amplified and sequenced. BLASTn search was performed. During light microscopic examination, an egg-filled paruterine organ was observed in the middle part of the segment. Thin-shelled, oval, 35-µm-diameter parasite eggs containing an oncosphere with three pairs of hooklets were observed. The gravid segments were determined as Mesocestoides spp. based on the appearance of the typical paruterine organ. PCR results supported our diagnosis; moreover, according to the BLAST results, it was detected that the species infecting two dogs was 98.01-100% similar to M. litteratus. Praziquantel-containing medication was administered to the infected dogs at a dosage of 5mg/kg. Foxes act as the final host of M. litteratus and the parasite is prevalent in wildlife; however, these animals may disperse the parasite in urban life. Veterinarians need to be made more aware of this parasite, especially if the dogs are owned from shelters.

Identification and management of infections caused by Giardia sp., Trichuris sp. and Demodex sp. in captive Brazilian porcupines (Coendou prehensilis)

The Brazilian porcupine (Coendou prehensilis, Rodentia, Erethizontidae) is an arboreal South American nocturnal rodent. Switzerland is home to one of the largest captive colonies in Europe. In June 2022, most of the animals in this colony showed severe diarrhoea, and Giardia sp. cysts were detected. All the animals were treated with metronidazole (75 mg/animal/day orally) for five days, repeating after two weeks. The diarrhoea continued, sometimes containing blood, and further analyses revealed Giardia sp. cysts and Trichuris sp. eggs with a particular undulating eggshell in pooled samples. The soil layer of some enclosures was removed to thoroughly clean and disinfect the underlying concrete floor. The animals were treated with fenbendazole (50 mg/kg/day orally) for 5 days repeating after three days. Giardia sp. cysts were not further detected. However, Trichuris sp. eggs were detected in branch bark samples and in six animals 2–3 months after treatment. The treatment with fenbendazole was repeated and no further Trichuris sp. eggs were detected. A 18S rRNA fragment consensus sequence showed 98.58% identity with Trichuris fossor. The Trichuris sp. in C. prehensilis may represent a new species, specific for arboreal porcupines. Demodex mites were observed in faecal flotations and thereafter in skin scrapings from five animals (four of them being family-related). A 16S consensus sequence showed 86.4% identity with other Demodex species. The animals were initially treated with moxidectin (0.4 and 0.8 mg/kg orally) and afterwards with sarolaner (10 mg/animal) but the treatments were not completely effective since in control scrapings, two animals evidenced few non-motile mites. An individual susceptibility and poor immunological control of the infection is suggested. Treatment with fenbendazole was effective against Giardia sp. and Trichuris sp. infections; however, reinfections may occur if the enclosures and tree branches are not deep cleaned and disinfected or replaced.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Prevalence and Diversity of Trypanosoma cruzi in Triatomine Vectors and Their Blood Meal Sources from South Central Texas, USA.

The prevalence of Trypanosoma cruzi was assessed in 117 triatomine insects from central Texas. The qPCR-based results revealed T. cruzi in 59% of the insects (62 adults and eight nymphs), with overall prevalences of T. cruzi of 0% (0/9), 64% (11/17), 58% (10/17), 73% (30/41), and 57% (19/33) for the Bastrop, Caldwell, Gonzales, Guadalupe, and Hays counties, respectively. Analyses of 18S rRNA fragments confirmed T. cuzi in 81% of these samples. Vectors were identified as Triatoma gerstaeckeri (35% of which 65% were positive for T. cruzi), T. sanguisuga (21%, 43% positive), and Paratriatoma leticularia (0.3%, 100% positive). Food sources were recovered from 29% of the insects. Raccoons were 53% of the blood meals (83% positive for T. cruzi), while the remainder came from a variety of sources, including humans (33% positive), house geckos, Eastern woodrats, plain-bellied water snakes (50% positive), hispid cotton rats (0% positive), chickens (100% positive); Asian forest turtles, bison, and pigs (0% positive). The serendipitous detection of blood meal sources at known minimum distances from the collection of the vector insect enabled us to provide several instances where the insect foraging distance was greater than 400 m. These vector foraging distances are novel information that can assist in our understanding of the landscape dynamics for the spread of the pathogen.

RNA tailing machinery drives amyloidogenic phase transition

The RNA tailing machinery adds nucleotides to the 3'-end of RNA molecules that are implicated in various biochemical functions, including protein synthesis and RNA stability. Here, we report a role for the RNA tailing machinery as enzymatic modifiers of intracellular amyloidogenesis. A targeted RNA interference screen identified Terminal Nucleotidyl-transferase 4b (TENT4b/Papd5) as an essential participant in the amyloidogenic phase transition of nucleoli into solid-like Amyloid bodies. Full-length-and-mRNA sequencing uncovered starRNA, a class of unusually long untemplated RNA molecules synthesized by TENT4b. StarRNA consists of short rRNA fragments linked to long, linear mixed tails that operate as polyanionic stimulators of amyloidogenesis in cells and in vitro. Ribosomal intergenic spacer noncoding RNA (rIGSRNA) recruit TENT4b in intranucleolar foci to coordinate starRNA synthesis driving their amyloidogenic phase transition. The exoribonuclease RNA Exosome degrades starRNA and functions as a general suppressor of cellular amyloidogenesis. We propose that amyloidogenic phase transition is under tight enzymatic control by the RNA tailing and exosome axis.

Morphological and molecular characteristics of a Trypanosoma sp. from triatomines (Triatoma rubrofasciata) in China

BackgroundTriatomines (kissing bugs) are natural vectors of trypanosomes, which are single-celled parasitic protozoans, such as Trypanosoma cruzi, T. conorhini and T. rangeli. The understanding of the transmission cycle of T. conorhini and Triatoma rubrofasciata in China is not fully known.MethodsThe parasites in the faeces and intestinal contents of the Tr. rubrofasciata were collected, and morphology indices were measured under a microscope to determine the species. DNA was extracted from the samples, and fragments of 18S rRNA, heat shock protein 70 (HSP70) and glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) were amplified and sequenced. The obtained sequences were then identified using the BLAST search engine, followed by several phylogenetic analyses. Finally, laboratory infections were conducted to test whether Tr. rubrofasciata transmit the parasite to rats (or mice) through bites. Moreover, 135 Tr. rubrofasciata samples were collected from the Guangxi region and were used in assays to investigate the prevalence of trypanosome infection.ResultsTrypanosoma sp. were found in the faeces and intestinal contents of Tr. rubrofasciata, which were collected in the Guangxi region of southern China and mostly exhibited characteristics typical of epimastigotes, such as the presence of a nucleus, a free flagellum and a kinetoplast. The body length ranged from 6.3 to 33.9 µm, the flagellum length ranged from 8.7 to 29.8 µm, the nucleus index was 0.6 and the kinetoplast length was −4.6. BLAST analysis revealed that the 18S rRNA, HSP70 and gGAPDH sequences of Trypanosoma sp. exhibited the highest degree of similarity with those of T. conorhini (99.7%, 99.0% and 99.0%, respectively) and formed a well-supported clade close to T. conorhini and T. vespertilionis but were distinct from those of T. rangeli and T. cruzi. Laboratory experiments revealed that both rats and mice developed low parasitaemia after inoculation with Trypanosoma sp. and laboratory-fed Tr. rubrofasciata became infected after feeding on trypanosome-positive rats and mice. However, the infected Tr. rubrofasciata did not transmit Trypanosoma sp. to their offspring. Moreover, our investigation revealed a high prevalence of Trypanosoma sp. infection in Tr. rubrofasciata, with up to 36.3% of specimens tested in the field being infected.ConclusionsOur study is the first to provide a solid record of T. conorhini from Tr. rubrofasciata in China with morphological and molecular evidence. This Chinese T. conorhini is unlikely to have spread through transovarial transmission in Tr. rubrofasciata, but instead, it is more likely that the parasite is transmitted between Tr. rubrofasciata and mice (or rats). However, there was a high prevalence of T. conorhini in the Tr. rubrofasciata from our collection sites and numerous human cases of Tr. rubrofasciata bites were recorded. Moreover, whether these T. conorhini strains are pathogenic to humans has not been investigated.Graphical

Microsporidian heavy infection in a batch of salted and dried cod.

The aim of this work is the description and characterization of a severe microsporidian infection in a batch of salted and dried cod. Particularly, the case involves a batch of approximately 800 kg obtained from Gadus macrocephalus (Food and Agriculture Organization Zone 61 - Northwest Pacific Ocean), which, after rehydration and sectioning operations, underwent routine company checks before packaging. In about 20% of the samples, the presence of whitish nodules with a diameter ranging from 1 to 2 mm was observed on the surface of the fillets and in cross-section. The lesions ranged from a few units to 10 per cm2. Some samples were subjected to fresh microscopic observation with the stereomicroscope, confirming the nodular nature of the lesions, which were often confluent, alternating with empty spaces, giving the tissue a honeycombing aspect. The histological examination at low magnification allowed us to observe the heavy vacuolization of nodular lesions irregularly surrounded by a spongy-like wall. The observation at higher magnification of other sections allowed us to identify intra-myofibrillar cists containing presumptive microsporidian elements. The tissue damage derived from the technological processes and gravity of lesions did not allow a morphological characterization of presumptive protozoans. The molecular examination of the nodular lesions and the analysis of the sequence of an 897 bp fragment of the small subunit 16S rRNA revealed 100% identity with Microsporidium theragrae (GenBank accession number MT928885-89) first isolated from the skeletal muscles of Gadus chalcogrammus specimens from the Sea of Okhotsk. This finding confirms the importance of selecting suppliers and raw materials in the seafood industry, as well as the usefulness of an effective traceability system.

Effects of soil pH on the growth, soil nutrient composition, and rhizosphere microbiome of Ageratina adenophora.

Ageratina adenophora is an invasive weed species found in many countries. Methods to control the spread of this weed have been largely unsuccessful. Soil pH is the most important soil factor affecting the availability of nutrients for plant and impacting its growth. Understanding the mechanisms of the influence of soil pH on the growth of A. adenophora may help to develop effective control measures. In this study, we artificially changed the soil pH in pot experiments for A. adenophora. We studied the effects of acidic (pH 5.5), weakly acidic (pH 6.5), neutral (pH 7.2), and alkaline (pH 9.0) soils on the growth, availability of soil nutrients, activity of antioxidant enzymes, levels of redox markers in the leaves, and the structure and diversity of the rhizosphere microbiome. Soil with a pH 7.2 had a higher (47.8%) below-ground height versus soils of pH 5.5 at day 10; plant had a higher (11.3%) above-ground height in pH 7.2 soils than pH 9.0 soils at day 90; no differences in the fresh and dry weights of its above- and belowground parts, plant heights, and root lengths were observed in plants growing in acid, alkaline, or neutral pH soil were observed at day 180. Correspondingly, the antioxidant enzymes SOD (superoxide dismutase), POD (peroxidase), CAT (catalase) and redox markers GSH (glutathione) and MDA (malondialdehyde) were measured in the leaves. Significant differences existed in the activities of CAT and the levels of GSH between those growing in acidic and alkaline soils and those in neutral pH soil at day 90; however, only lower (36.8%) CAT activities in those grown at pH 5.5 than those grown at pH 7.2 were found at day 180. Similarly, significant differences in available P (16.89 vs 3.04 mg Kg-1) and total K (3.67 vs 0.96 mg Kg-1), total P (0.37 vs 0.25 g Kg-1) and total N (0.45 vs 1.09 g Kg-1) concentrations were found between the rhizosphere soils of A. adenophora grown at pH 9.0 and 7.2 at day 90; no such differences were seen at day 180. High throughput analyses of the 16S rRNA and ITS fragments showed that the rhizosphere microbiome diversity and composition under different soil pH conditions changed over 180 days. The rhizosphere microbiomes differed in diversity, phylum, and generic composition and population interactions under acid and alkaline conditions versus those grown in neutral soils. Soil pH had a greater impact on the diversity and composition of the prokaryotic rhizosphere communities than those of the fungal communities. A. adenophora responded successfully to pH stress by changing the diversity and composition of the rhizosphere microbiome to maintain a balanced nutrient supply to support its normal growth. The unusual pH tolerance of A. adenophora may be one crucial reason for its successful invasion. Our results suggest that attempts use soil pH to control its invasion by changing the soil pH (for example, using lime) will fail.

Exploring fish communities in the mud volcano polluted river using environmental DNA metabarcoding

In ecosystems subjected to environmental disturbances such as mud volcanoes, understanding the dynamics of fish communities is essential for ecological assessment and conservation. This study employs environmental DNA (eDNA) metabarcoding for the first time to explore fish communities within a challenging and unique environment—a mud volcano-polluted river. High-throughput sequencing was utilized to assess alpha and beta diversity, revealing distinct patterns in fish community composition in response to mud discharge activity. The results indicate that affected sites exhibit remarkably different communities during active and inactive mud discharge, with the impact extending downstream to the river mouth. Notably, the application of eDNA metabarcoding identified a vulnerable species, Rasbora lateristriata, emphasizing its utility in detecting high-risk species. Despite challenges in species identification and reference databases, the use of longer 16S rRNA fragments offered enhanced taxonomic resolution and interspecific sequence variation. This approach showcases the potential of eDNA metabarcoding in assessing fish diversity and community dynamics in polluted aquatic ecosystems, emphasizing its significance in biodiversity surveys and ecological monitoring. The study underscores the value of eDNA metabarcoding as an efficient and comprehensive tool for studying freshwater ecosystems and highlights the need for expanding reference databases to address genetic coverage gaps, particularly in less-studied environments.

Characterization of Vaginal Lactobacilli with Potential Probiotic Properties Isolated from Healthy Women in Northern Iran.

Vaginal lactobacilli protect against bacterial vaginosis and vaginal candidiasis. They may have probiotic properties and help maintain the balance and health of the vaginal ecosystem while the loss of these bacteria predisposes females to urinary and genital infections. The aim of this study was to investigate the probiotic potential of vaginal Lactobacillus among healthy females in northern Iran. The Lactobacillus strains were isolated from vaginal samples and were identified by sequencing of the 16S rRNA fragment. Functional properties such as tolerance to low pH, H2O2 production, adherence ability to Hela cells and antagonistic activity against Candida albicans was examined. A total of 38 vaginal lactobacilli strains from five species, including Lactobacillus crispatus (n = 13), Lactobacillus gasseri (n = 10), Lactobacillus acidophilus (n = 6), Lactobacillus jensenii (n = 5) and Lactobacillus johnsonii (n = 4), were identified. All of the species showed significant tolerance to low pH over 24h (p < 0.001). The best adherence ability to Hela cells was seen in Lactobacillus gasseri strains. Nearly 17 of the strains had higher anti-candida activity compared to the other strains. According to the findings, four lactobacilli strains isolated in the vaginal samples of healthy Iranian women had the best probiotic potential.

Linking metabolomics to machine learning reveals the metabolic fates of the refractory industrial pollutant 1-Hexadecene

In order to solve the low removal efficiency of 1-Hexadecene in industrial wastewater treatment plants and fill the knowledge gap of its microbial metabolic mechanisms, this work studied the 1-Hexadecene degrading microorganisms enrichment and its metabolic pathway using continuous bioreactors and batch incubation tests. With the successful enrichment of hexadecene-degrading microorganisms, the biodegradation rates of 1-Hexadecene at 50–200 mg/L could range from 58.6 % to 72.5 %. The 16S rRNA fragment and microbial community analysis identified Flavihumibacter, Gemmatimonas, and Caulobacter as putative 1-Hexadecene degraders. Through mass spectrum qualification analysis, Principal component analysis and orthogonal partial least squares discriminant analysis, totally 81 featured metabolites associated with 1-Hexadecene biogradation were screened out. The machine learning based support vector machines and random forests further identified 18 biomarkers during those featured metabolites. Based on the coupling metabolomics analysis with machine learning, three potential metabolic pathways with Heptane, 2,5-dimethyl hexane, 3-ethyl-3-methyl-heptane as the respective end products were proposed through biomarkers. These results provide new insights for the analysis of metabolic pathway of 1-Hexadecene, and theoretical support for the bioaugmentation of its treatment processes.

FIRST REPORT ON TRUFFLE-INHABITING FUNGI AND METAGENOMIC COMMUNITIES OF TUBER AESTIVUM COLLECTED IN RUSSIA

Truffles are one of the least studied groups of fungi in terms of their biological and biotechnological aspects. This study aimed to isolate truffle-inhabiting fungi and assess the metagenomic communities of the most common Russian summer truffle, Tuber aestivum. This study is the first to characterize the biodiversity of prokaryotic and eukaryotic organisms living in the truffle T. aestivum using molecular analysis and sequencing. Plant pathogens involved in a symbiotic relationship with truffles were identified by sequencing the hypervariable fragments of the 16S rRNA and 18S rRNA genes. In addition, some strains of fungal symbionts and likely pathogens were isolated and recognized for the first time from the truffles. This study also compared and characterized the general diversity and distribution of microbial taxa of T. aestivum collected in Russia and Europe. The results revealed that the Russian and European truffle study materials demonstrated high similarity. In addition to the truffles, representatives of bacteria, fungi, and protists were found in the fruiting bodies. Many of these prokaryotic and eukaryotic species inhabiting truffles might influence them, help them form mycorrhizae with trees, and regulate biological processes. Thus, truffles are interesting and promising sources for modern biotechnological and agricultural studies.

Effects of color variation and physiological state on ascidian microbiomes.

Ascidians, known for their color variation, host species-specific microbial symbiont communities. Some ascidians can also transition into a nonfiltering (resting) physiological state. Recent studies suggest that the microbial symbiont communities may vary across different physiological states and color morphs of the host. The colonial ascidian, Polyclinum constellatum, which exhibits several color morphs in the Caribbean Sea, periodically ceases its filtering activity. To investigate if color variation in P. constellatum is indicative of sibling speciation, we sequenced fragments of the ribosomal 18S rRNA and the mitochondrial cytochrome oxidase subunit I genes. Additionally, we sequenced a fragment of the 16S rRNA gene to characterize the microbial communities of two common color morphs (red and green) in colonies that were either actively filtering (active) or nonfiltering (resting). Phylogenetic analyses of both ascidian genes resulted in well-supported monophyletic clades encompassing all color variants of P. constellatum. Interestingly, no significant differences were observed among the microbial communities of the green and red morphs, suggesting that color variation in this species is a result of intraspecific variation. However, the host's physiological state significantly influenced the microbial community structure. Nonfiltering (resting) colonies hosted higher relative abundances of Kiloniella (Alphaproteobacteria) and Fangia (Gammaproteobacteria), while filtering colonies hosted more Reugeria (Alphaproteobacteria) and Endozoicomonas (Gammaproteobacteria). This study demonstrates that microbial symbiont communities serve as reliable indicators of the taxonomic state of their host and are strongly influenced by the host's feeding condition.

Development and validation of a universal primer pair for the taxonomic and phylogenetic studies of vertebrates.

Recent studies in the field of molecular identification have described 16S rRNA gene as a highly informative fragment of mitochondrial DNA for species discrimination. This study presents a newly developed universal primer pair yielding an approximately 350bp fragment of mitochondrial 16S rRNA, variable enough to encompass and identify all vertebrate classes. The primers were designed by aligning and analyzing over 1500 16S rRNA sequences downloaded from the NCBI nucleotide database. A total of 93 vertebrate species, spanning 27 orders and 55 families, were PCR-amplified to validate the primers. All the target species were successfully amplified and identified when aligned with reference sequences from the NCBI nucleotide database. Using the Kimura 2-parameter model, low intra-species genetic divergence of the target region was observed - from 0 to 4.63%, whereas relatively higher inter-species genetic divergence was observed, ranging from 4.88% to 69.81%. Moreover, the newly developed primers were successfully applied to a direct PCR protocol, making the workflow very cost-effective, time-saving and less laborious in comparison to conventional PCR. The short length, high variability and conserved priming sites of the target fragment across all vertebrate species make it a highly desirable marker for species identification and discrimination.

Small RNAs from mitochondrial genome recombination sites are incorporated into T. gondii mitoribosomes.

The mitochondrial genomes of apicomplexans comprise merely three protein-coding genes, alongside a set of thirty to forty genes encoding small RNAs (sRNAs), many of which exhibit homologies to rRNA from E. coli. The expression status and integration of these short RNAs into ribosomes remains unclear and direct evidence for active ribosomes within apicomplexan mitochondria is still lacking. In this study, we conducted small RNA sequencing on the apicomplexan Toxoplasma gondii to investigate the occurrence and function of mitochondrial sRNAs. To enhance the analysis of sRNA sequencing outcomes, we also re-sequenced the T. gondii mitochondrial genome using an improved organelle enrichment protocol and Nanopore sequencing. It has been established previously that the T. gondii genome comprises 21 sequence blocks that undergo recombination among themselves but that their order is not entirely random. The enhanced coverage of the mitochondrial genome allowed us to characterize block combinations at increased resolution. Employing this refined genome for sRNA mapping, we find that many small RNAs originated from the junction sites between protein-coding blocks and rRNA sequence blocks. Surprisingly, such block border sRNAs were incorporated into polysomes together with canonical rRNA fragments and mRNAs. In conclusion, apicomplexan ribosomes are active within polysomes and are indeed assembled through the integration of sRNAs, including previously undetected sRNAs with merged mRNA-rRNA sequences. Our findings lead to the hypothesis that T. gondii's block-based genome organization enables the dual utilization of mitochondrial sequences as both messenger RNAs and ribosomal RNAs, potentially establishing a link between the regulation of rRNA and mRNA expression.

Genetic heterogeneity of &lt;i&gt;Rickettsia helvetica&lt;/i&gt; population

Background. To date, the genetic variability of Rickettsia helvetica has not been sufficiently studied.The aim. To study the prevalence and genetic variability of R. helvetica in Ixodes spp. collected in Western Siberia and the Russian Far East.Materials and methods. Ixodes spp. collected from rodents in the Omsk province, Western Siberia (n = 280) and collected by flagging on Putyatin and Russky Islands in Primorsky Krai, Russian Far East (n = 482) were analyzed for the presence of Rickettsia spp. All positive samples were genotyped for the gltA gene fragment. For a number of R. helvetica samples, fragments of the 16S rRNA, ompA, ompB, sca4, htrA, and groEL genes and 23S–5S intergenic spacer were additionally sequenced.Results. Four Rickettsia species (R. helvetica, “Candidatus Rickettsia tarasevichiae”, “Candidatus Rickettsia uralica”, and “Candidatus Rickettsia mendelii”) were found. Of them, R. helvetica was identified in 72.2 % of Ixodes apronophorus and 18.8 % of Ixodes trianguliceps from the Omsk province and in single Ixodes persulcatus from the Omsk province and Putyatin Island. This is the first finding of Rickettsia spp. in I. apronophorus. All known R. helvetica sequences from this study and the GenBank database belonged to four well supported monopheletic groups forming genetic lineages I–IV. Lineage I included European isolates from Ixodes ricinus, Western Siberian isolates from I. persulcatus, and some sequences from I. apronophorus. All R. helvetica sequences from I. trianguliceps from the Omsk province and I. persulcatus from the Komi Republic and one sequence from I. apronophorus were assigned to lineage II. Most sequences from I. apronophorus formed lineage III; all known R. helvetica sequences from I. persulcatus from the Far East formed genetic lineage IV.Conclusion. The genetic heterogeneity of R. helvetica population was first demonstrated. Known isolates of R. helvetica are reliably assigned to four genetic lineages, but not in all cases the association of different lineages with a specific tick species or specific territory was observed.

Morphological and molecular characterization of Sarcocystis spp. in pigs (Sus scrofa domestica) from Argentina

Sarcocystis spp. are intracellular protozoan parasites with an obligatory heteroxenous life cycle. The objective of this study was to identify Sarcocystis spp. in pig muscles from Argentina, by light and transmission electron microscopy (TEM), and molecular studies. Muscles samples from 561 pigs (Sus scrofa domestica) were classified according to the breeding system in: intensive farming (IF, n = 295; animals kept in confinement during most of their productive cycle), or semi-extensive farming (SEF, n = 266; animals bred outdoors, generally family or backyard production). Results showed that 24.8% (139/561) were positive by light microscopy, with a significantly higher prevalence in the SEF (34.6%; 92/266) than the IF pigs (15.9%; 47/295) (p < 0.05). Of the 202 samples analyzed by PCR, 96 were positive (47.5%) for the 18S rRNA (18S ribosomal RNA) fragment. All samples analyzed by the S. suihominis specific coxI (mitochondrial cytochrome c oxidase subunit I) PCR (n = 235; 96 positives by 18S rRNA PCR and 139 positives by light microscopy) were negative. Fourteen individual cysts were positive for the 18S rRNA PCR and sequenced. Consensus sequences obtained from the 18S rRNA fragment PCR ranged from 613 to 880 bp and showed 100% of identity between them and with previously reported S. miescheriana sequences. In all the pig samples analyzed by TEM, cyst wall ultrastructure was compatible with S. miescheriana. This is the first study that provides infection rates and describes and identifies morphological and molecular features of Sarcocystis spp. cysts in pigs from Argentina.