Root Rot Disease Research Articles

Reduction of oxidative damage caused by Fusarium falciforme and Fusarium foetens in schefflera plants using chitosan nanoparticles loaded with l-proline or indole butyric acid

Abstract Background Root rot, wilt diseases, and rooting processes have been the major factors that constrain schefflera production. This study focuses on the impact of innovative applications of eco-friendly materials like chitosan nanoparticles loaded with l-proline or indole butyric acid to replace traditional chemical fungicides in controlling root rot and wilt diseases, as well as the vegetative propagation success of leafy stem schefflera cuttings. Results Fusarium foeten (strain 1) and Fusarium falciforme (strains 2 and 4) were first identified as root rot and wilt pathogens of schefflera in Egypt based on morphological features and confirmed with molecular analyses. Fusarium foetens (strain 1) and F. falciforme (strain 2) have the most aggressive action, as the infection percentages significantly increased in the pathogenicity test. The disease incidence reached 38.88 and 44.44%, respectively, whereas the disease severity was 18.51 and 26.84%, respectively. Chitosan nanoparticles at a concentration of 25 mg/L were the most effective dose, leading to a significant reduction in disease incidence to 25.00%, disease severity to 4.17%, and playing a vital role in activating plant defense, which correlates well with improved growth characteristics. The novel strategy of L-proline loaded on chitosan nanoparticles (LP-CSNPs) application occupied the first rank at protective influence against root rot and wilt disease-induced oxidative stress, signaling a defensive function that was freelance verified. L-proline loaded on chitosan nanoparticles (LP-CSNPs) at 0.125–0.25 g/L had a significant impact on reducing the incidence and severity of root rot and wilt diseases, as well as improving photosynthetic pigments and free radical scavenging activities, which included strengthening plant defense and further validating the findings from the biochemical trait analysis. The TT biplot graph was an influential statistical tool to study the impacts of treatments on schefflera production and its attributes and to discover the interrelationships among them. Conclusions Applying LP-CSNPs is one of the best techniques to manage schefflera root rot and wilt diseases, since it can be utilized as a growth stimulator and defense activator with sustainable increased efficiency. Graphical Abstract

Linalool and 1,8‐Cineole as Constitutive Disease‐Resistant Factors of Norway Spruce Against Necrotrophic Pathogen Heterobasidion Parviporum

ABSTRACTNorway spruce is an important coniferous species in boreal forests. Root and stem rot diseases caused by the necrotrophic pathogen Heterobasidion parviporum threaten the wood production of Norway spruce which necessitates the search for durable control and management strategies. Breeding for resistant traits is considered a viable long‐term strategy. However, identification of potential resistant traits and markers remains a major challenge. In this study, short‐term disease resistance screening was conducted using 218 Norway spruce clones from 17 families. Disease resistance was evaluated based on the size of necrosis lesion length following infection with the pathogen. A subset of needles/branches from clones with small (partial resistant) or large (susceptible) lesions were used for terpene analysis and transcriptomic profiling. The results revealed that the content of monoterpene linalool and 1,8‐cineole and their respective encoded genes were significantly more abundant and highly expressed in the partial resistant group. Furthermore, linalool and 1,8‐cineole were demonstrated to have inhibitory effect on the growth of the pathogen H. parviporum, with morphological distortion of the hyphae. RNAseq analysis revealed that transcript of pathogen genes involved in the regulation of carbohydrate metabolism and stress responses were significantly decreased in presence of the terpenes. The results suggest the relevance of monoterpenes together with jasmonic acid precursor and some genes involved in phenylpropanoid biosynthesis, as constitutive tolerance factors for Norway spruce tolerance against necrotrophic pathogen. The high level of necrosis related cell death gene expression might be factors critical for host susceptibility and disease development.

Efficacy of Bio-Agents in Managing Root Rot of Okra Caused by Rhizoctonia solani

Okra or lady’s finger [Abelmoschus esculentus (L.) Moench] is one of the most important summer vegetables of Rajasthan as well as India. Okra is attacked by several diseases caused by fungi and important one is root rot caused by Rhizoctonia solani Kuhn, which is an important constraint to the crop and causes significant economic losses. During present study, two bio-agents were evaluated alone and in combination Trichoderma harzianum through seed (4 g/kg) and soil (4 kg/ha) applications for two consecutive years under artificial inoculation conditions in the field. Among these, seed + soil application of Trichoderma harzianum was found most effective in reducing disease incidence (48.76%) and in increasing pod yield (13.46%) followed by seed treatment with T. harzianum + soil application of Pseudomonas fluorescens (46.41% and 12.84%, respectively). Looking to the increasing demand of organically produces in the market, root rot disease can be managed effectively with these eco-friendly approaches for supplying organically produced vegetables to fulfil the ever-increasing demand among health-conscious people.

Bio-efficacy of Biochar's against Fusarium oxysporum f.sp. radicis-cucumerinum inciting Root and Stem Rot Disease of Cucumber in In vitro Condition

To assess in vitro evaluation of bio-efficacy different three biochar's viz., Green house waste (GHW), Eucalyptus wood (EW) and Citrus wood (CW) were evaluated at different three concentrations (each @ 1, 2 and 3%) against F. oxysporum f.sp. radicis-cucumerinum causing root and stem rot of cucumber by using poison food technique. Among the three different biochars, Green house waste (GHW) was found most effective by showing minimum mycelial growth of 50.78, 40.10 and 29.88 mm and 43.58, 55.44 and 66.80% per cent growth inhibition at 1, 2 and 3% concentrations, Whereas, Citrus wood (CW) depicted highest mycelial growth 66.26, 55.88, 44.30 mm with 26.38, 37.91 and 50.78% lowest per cent growth inhibition of the pathogen at same above concentrations, respectively.

Isolation, identification, characterization and in vitro assay of saline tolerant endophytes against groundnut root rot caused by Rhizoctonia bataticola (Taub.) Butler

Groundnut, known as Arachis hypogaea L., is India's significant oil seed crop. Dry root rot, caused by Rhizoctonia bataticola, poses a substantial challenge to cultivating groundnuts. During the roving survey, 60.50% dry root rot disease incidence was recorded in Namakkal district, Tamil Nadu. This study aims to acquire salt-tolerant endophytic bacteria residing in groundnuts with significant antagonistic activity against R. bataticola. A total of 27 bacterial strains were isolated from groundnuts. Among these strains, RMV 3 and RMV 2 are the most effective isolates, exhibiting 60.1% and 50% inhibition zones, respectively. The effective isolates were characterized through morphological, biochemical and phytostimulation activities and 16S rDNA sequencing. Among the isolates, RMV 3 and RMV 2 showed positive results for siderophore, indole acetic acid (IAA) and cellulase test. The strain RMV 3 was identified as Bacillus subtilis through 16S rDNA sequencing. GC-MS analysis identified twenty bioactive compounds produced by B. subtilis RMV 3, such as pyrrolo [12-a] pyrazine-14-dione hexahydro-3 (2-methylpropyl) and hexadecanoic acid methyl ester. The crude metabolite assay demonstrated a 96.6% inhibition of R. bataticola by RMV 3. This study demonstrated that Bacillus subtilis RMV 3, which exhibits a robust antagonistic effect on R. bataticola, can potentially be an effective biocontrol agent for groundnut dry root rot.

In Vitro Antimicrobial Bio-efficacy Assessment of Different Organic Formulations against Root and Stem Rot Disease of Cucumber Incited by Fusarium oxysporum f.sp. radicis-cucumerinum

In vitro evaluation of antimicrobial bio-efficacy of different four organic formulations viz., Neem oil (@ 0.5, 1.0, 1.5% con.), Azadirachtin (@ 0.10, 0.15, 0.20% con.), Bijamrut (@ 5, 10, 15% con.) and Jivamrut (@ 5, 10, 15% con.) were evaluated at different three concentrations against Fusarium oxysporum f.sp. radicis-cucumerinum causing root and stem rot disease of cucumber. Among the four different organic formulations, Azadirachtin was found most effective by showing minimum mycelial growth of 47.48, 31.63 and 21.70 mm and 47.25, 64.86 and 75.89% per cent growth inhibition at 0.10, 0.15 and 0.20% concentrations respectively. The Jivamrut depicted highest mycelial growth 63.88, 55.83, 43.95 mm with 29.03, 37.97 and 51.17% lowest per cent growth inhibition of the pathogen at 5, 10 and 15% concentrations, respectively.

Genome sequencing and functional analysis of potential Trichoderma species for controlling Pythium schmitthenneri-Induced root rot in olive trees

Root rot disease caused by Pythium schmitthenneri is a significant challenge in olive (Olea europaea L.) cultivation. Due to the limitations of chemical control, this study explores the potential of Trichoderma species as a sustainable alternative with an overview in the genetic properties involved in it. Eight Trichoderma isolates were obtained from olive roots and identified using rDNA internal transcribed spacer (ITS) sequences, revealing four species: T. harzianum, T. longibrachiatum, T. virens, and T. viride. Among these, T. harzianum T-BM6 and T. virens T-KH4, showed 81.4 and 78.77 % inhibition rates of pathogen growth, respectively, in vitro. Greenhouse trials demonstrated that these isolates reduced disease severity to 18.75 % for T-BM6 and 31.25 % for T-KH4. All isolates produced cellulase, with T-BM6 exhibiting high cellulolytic activity. Genomic analysis highlighted key genes related to the MAPK signaling pathway, sulfur metabolism, and inositol phosphate metabolism in T-BM6, and phenylalanine, tyrosine, and tryptophan metabolism in T-KH4. These results suggest that T. harzianum T-BM6 and T. virens T-KH4 are promising candidates for biological control, offering a sustainable alternative to chemical treatments for managing olive root rot.

Dynamics of Cascading Failures in Biological Networks

Gene correlation networks were constructed for three species under various physiological states: normal soybean versus soybean with root rot disease, yeast grown anaerobically versus aerobically, and human prostate cancer versus healthy individuals, based on their respective gene expression profiles. Investigation of these networks using a cascading failure model revealed significant differences in dynamic stabilities across the different states. Structural key genes contributing to these differences were identified, and their biological functions were annotated. These key genes may play a role in the development of root rot disease in soybeans. This research elucidates the relevant functional mechanisms underlying these changes and provides a valuable tool for understanding the mechanisms of various life processes.

Oligonucleotide –based detection of three plant pathogenic species of Fusarium solani species complex (FSSC) causing tomato root rot and wilt disease

Oligonucleotide –based detection of three plant pathogenic species of Fusarium solani species complex (FSSC) causing tomato root rot and wilt disease

Improving the Efficiency of Bioagents Using Certain Chemical Inducers against Root Rot and Wilt Diseases of Soybean

Improving the Efficiency of Bioagents Using Certain Chemical Inducers against Root Rot and Wilt Diseases of Soybean

Development and Evaluation of Real-Time Quantitative PCR Assays for Detection of Phellinus noxius Causing Brown Root Rot Disease.

Brown root rot disease (BRRD) is a highly destructive tree disease. Early diagnosis of BRRD has been challenging because the first symptoms and signs are often observed after extensive tissue colonization. Existing molecular detection methods, all based on the internal transcribed spacer (ITS) region, were developed without testing against global Phellinus noxius isolates, other wood-decay fungi, or host plant tissues. This study aimed to develop SYBR Green real-time quantitative PCR (qPCR) assays for P. noxius. The primer pair Pn_ITS_F/Pn_ITS_R targets the ITS, and the primer pair Pn_NLR_F/Pn_NLR_R targets a P. noxius-unique group of homologous genes identified through a comparative genomics analysis. The homologous genes belong to the nucleotide-binding-oligomerization-domain-like receptor (NLR) superfamily. The new primer pairs and a previous primer pair G1F/G1R were optimized for qPCR conditions and tested for specificity using 61 global P. noxius isolates, 5 other Phellinus species, and 22 non-Phellinus wood-decay fungal species. Although all three primer pairs could detect as little as 100 fg (approximately 2.99 copies) of P. noxius genomic DNA, G1F/G1R had the highest specificity and Pn_NLR_F/Pn_NLR_R had the highest efficiency. To avoid false positives, the cutoff quantification cycle values were determined as 34 for G1F/G1R, 29 for Pn_ITS_F/Pn_ITS_R, and 32 for Pn_NLR_F/Pn_NLR_R. We further validated these qPCR assays using Ficus benjamina seedlings artificially inoculated with P. noxius, six tree species naturally infected by P. noxius, rhizosphere soil, and bulk soil. The newly developed qPCR assays provide sensitive detection and quantification of P. noxius, which is useful for long-term monitoring of BRRD status.

Synergy between bio-control agents to trigger the defensive responses against Rhizoctonia root rot and enhance the growth, yield, and physiological and anatomical traits of pea plants

AbstractRhizoctonia solani (Rs) is the fungus that causes the primary and deadly disease that attacks pea plants throughout the cool growing season. It causes seed rot, damping off, and pea root rot diseases. The current study used arbuscular mycorrhizal fungi; Rhizoglomus clarum, Gigaspora margarita, Rhizophagus irregularis and Funneliformis mosseae (AMF), Pseudomonas fluorescens HE21 (Pf), and Trichoderma harzianum HL9 (TH) singly or in combination to suppress Rhizoctonia root rot of pea in a greenhouse. Using the in vitro dual culture assay, TH and Pf inhibited the radial growth of the Rs by 73.3 and 60.0%, respectively. The results of greenhouse experiments showed that all treatments significantly decreased the percentages of pre- and post-emergence damping while significantly increasing the number of surviving plants, particularly in the dual and triple combination treatments. Furthermore, all treatments improved yield and seed quality in addition to plant growth, total phenol content and antioxidant enzyme activity. There were also noted modifications to the treated plants’ anatomical, physiological, and distinctive features. The synergistic triple treatment consisting of M, TH, and Pf achieved the maximum reduction of disease severity (78.5%) compared to the untreated control treatment. As a result of the synergistic triple treatment due to their effectiveness and eco-safety, we recommend using the synergistic triple by M + Pf + TH to manage the root rot disease in peas caused by Rs and to enhance the crop’s growth, yield, and seed quality.

Ecological shifts in soil microbiota and root rot disease progress during ginseng monoculture

Ecological shifts in soil microbiota and root rot disease progress during ginseng monoculture

Opportunities for the Early Diagnosis and Selection of Scots Pine with Potential Resistance to Root and Butt Rot Disease

Pine stands affected by root and butt rot (Heterobasidion annosum s.l.) contain pines (Pinus sylvestris L.) that can survive for a long time without showing external symptoms of the disease (‘conditionally resistant’ refers to trees that survive without symptoms despite infection). The establishment of stands from the seeds of such trees can significantly increase the effectiveness of artificial afforestation. Since the growth and development of pine trees is determined to a certain extent by the number of cotyledons after seed germination, this article examines this trait in the progeny of trees that are potentially resistant and those that have already been attacked by root pathogens. The number of cotyledons and the resilience of trees is fascinating and not generally known. Presumably, the number of cotyledons can be linked to disease resistance based on increased vigour. Biologically, a larger area for carbon assimilation leads to better photosynthetic efficiency and the production of more assimilates (sugars) necessary to trigger defence processes in the event of infection. From an ecological point of view, this can give tree populations in areas potentially threatened by root system diseases a chance of survival. The aim of this study was to analyze the potential of using the number of cotyledons and other seedling characteristics to predict the resistance of trees to root and butt rot disease. The collected data show that the seedlings from the group of diseased trees exhibited lower growth rates and vigour. However, the seedlings from the group of potentially resistant trees are similar to the control, meaning the trees that show no disease symptoms because they have not come into contact with the pathogen. Our observations suggest that monitoring germinating cotyledons could serve as an early diagnostic tool to identify disease-resistant pines, although further research is needed.

Synergistic interactions of biocontrol agents and chemical fungicides enhance the disease resistance in Vigna radiata (L.) against Macrophomina phaseolina-associated with dry root rot

Macrophomina phaseolina, a necrotrophic fungus responsible for dry root rot disease in Vigna radiata L. (greengram) causes extensive yield losses. Biocontrol agents are reported to suppress phytopathogens, mitigate biotic stress, and improve growth and yield of plants. Here, Bacillus subtilis PSB-5 and Trichoderma sp. TD-6 along with chemical fungicides; mancozeb (MZB) and carbendazim (CBZM) were evaluated alone/or in combination for their effectiveness against M. phaseolina-induced root rot disease in greengram. B. subtilis and Trichoderma sp. suppressed phyto-fungal growth by 72 and 78 %, respectively. Both bioagents synthesized indole-3-acetic acid, ammonia, and solubilized insoluble phosphate, released antimicrobial substances including siderophore, hydrogen cyanide, and various extracellular lytic enzymes. Further, efficacy of bioagents and fungicides (at 50 and 100 ppm) were tested (single and combined) against M. phaseolina-infected greengram cultivated in pot soils. While evaluating, bioagents and fungicides increased plant height, biomass, and vigor indices of infected greengram in order: PSB-5 + TD-6 > PSB-5 > TD-6 > MZB + CBZM (100 ppm) > CBZM (100 ppm) > MZB (100 ppm). Further, among treatment, dual inoculation of bioagents (B. subtilis + Trichoderma), maximally increased total chlorophyll (59.4 %), carotenoid (68 %), root phosphorous (69.6 %), root nitrogen (65.7 %), total soluble protein (80 %), soluble sugar (76 %), pod yield (82.3 %) and seed protein (68 %) over infected plants. Moreover, biotic stress-induced oxidative stress biomarkers (proline, malondialdehyde, electrolyte leakage) and reactive oxygen species were significantly (p ≤ 0.05) lowered in fungal-infected greengram following fungicides and bioagents application. Furthermore, combined inoculation of bioagents significantly (p ≤ 0.05) reduced percent disease index (PDI) and increased % protection in biotic-stressed greengram. Besides, bioagents potentially increased disease resistance in M. phaseolina-infected greengram plants by modulating defense responses such as activities of β-1, 3 glucanase, catalase, phenylalanine ammonia lyase, polyphenol oxidase, peroxidase, and superoxide dismutase which significantly protected plants from fungal pathogen. Soil populations of pathogen and bioagents declined and considerably increased, respectively, at harvest. Application of antagonistic bacterial and fungal strains enhances greengram resistance to M. phaseolina while concurrently offering agriculture an environmentally friendly choice. Also, these strains can be applied as biocontrol agents in disease suppression over chemical fungicides.

Mitigating root rot in Panax notoginseng: The synergistic effects of biochar and Chaetomium globosum YIM PH30719

Root rot is the main soilborne disease that causes the replant failure of Panax notoginseng, a famous medicinal plant in Asia. Biochar and biocontrol agents have been shown to reduce replant failure separately; however, a knowledge gap still exists regarding the effectiveness and mechanisms of their combined application on the root rot incidence of P. notoginseng. In this study, we conducted a pot experiment using a randomized block design, biochar derived from tobacco stems was applied at 0, 1, 2, and 3 % (T0, T1, T2, T3) to the soil that cultivating P. notoginseng for 10 years continuously; moreover, Chaetomium globosum YIM PH30719, a newly screened biocontrol strain, was applied at 0, 1.0×107, and 1.0×1010 cfu·mL−1 (C0, C1, C2) to the soil. Six months post-transplantation of P. notoginseng seedlings, root rot incidence, soil physicochemical properties, fungal communities, and abundance of the primary pathogen Fusarium oxysporum were investigated. The results showed that, comparing with the single application of YIM PH30719, the combined application with biochar was more efficient in reducing the root rot incidence (P<0.05). P. notoginseng experienced a root rot incidence of 65.4 % under the T0+C0 treatment, however, under T3+C2 treatment, the root rot incidence was only 5.6 % (P<0.05). The reduction in root rot incidence might be linked to changes in soil pH, organic matter, and essential nutrient contents, as well as the increased soil fungal diversity and the relative abundance (RA) of beneficial Chaetomium and Trichoderma, and the decreased RA of pathogenic Fusarium and Alternaria. Consequently, the joint use of biochar and biocontrol agents (YIM PH30719) synergistically decreased the occurrence of root rot by modifying soil physicochemical characteristics and fungal communities. Since root rot is commonly found in agriculture, the results of this study may help in controlling root rot disease in other crops.

Herbal materials used as soil amendments alleviate root rot of Panax ginseng

Root rot is a serious soil-borne fungal disease that seriously affects the yield and quality of Panxa ginseng. To develop a sustainable strategy for alleviating ginseng root rot, an herb-based soil amendment is suggested in this study. Mixed powers of medicinal herbs (MP) and corn stalks (CS) were used as soil amendments, respectively, along with a control group (CK) without treatment. The application of MP and CS led to significant relief from ginseng root rot. The disease index (%) represents both the incidence rate and symptom severity of the disease. The disease index of the MP and CS group was 18.52% and 25.93%, respectively, lower than that of CK (40.74%). Correspondingly, three soil enzyme activities improved; the antifungal components in the soil increased; and the relative abundances of root rot pathogens decreased in response to MP Soil enzyme activities were negatively correlated with disease grades. MP group also led to possible interactive changes in the communities of soil fungi and chemical components. In conclusion, our results suggest that the use of herb-based soil amendments has significant potential as an ecological and effective approach to controlling root rot disease of ginseng by the changing rhizosphere fungal community and soil compositions.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Efficacy of Pseudomonas fluorescens and Organic Amendments Against Black Root Rot Disease Caused by Rhizoctonia solani in strawberry (Fragaria x ananassa Duch.)

Black root rot of strawberry caused by Rhizoctonia solani is one of the devastating soil borne disease. An experiment was conducted to evaluate the efficacy of organic amendments, PGPR (Pseudomonas Fluorescens) and botanical treatment for the management of R. solani on strawberry. The study was laid out in Randomized Block design (RBD) including 4 r eplications with 8 treatments in pot condition at the greenhouse of Department of Plant Pathology, Sam Higginbottom University of Agriculture, Technology and Sciences, Prayagraj, Uttar Pradesh, during Rabi season 20232024. The treatments consisted of combination of FYM, vermicompost, biomix compost, neem cake, cocopeat and botanical neem leaf extract were used as soil amendments and P. fluorescens as root treatment for evaluation on the plant growth, yield, physicochemical parameters (TSS and total ascorbic acid), disease intensity (%) and benefit cost ratio of strawb erry. The present investigation results revealed that T7 – P. fluorescens (0.3%) + FYM @ 100g + biomix compost @ 15g + vermicompost @ 15g + neem leaf extract @10% had the most promising results in term of maximum plant height (14.9 cm), maximum leaf number(15.75), days taken to first flowering (86 days), berry length (4.08 cm), berry diameter (2.84 cm), yield (38.87 qha-1), TSS (8.80 °Brix), total ascorbic acid (51.60mg/100g) and B:C ratio (1:2.24). It was also observed that T7 superior over other treatments giving least per cent disease intensity (30.75 %) followed by T6 – FYM @1 00g + P. fluorescens (0.3%) + biomix compost @15g + neem cake @15g + neem leaf extract @10% (35.50%). These findings highlight the potential of organic amendments, PGPR (P. fluorescens) and botanical treatments, as effective alternatives for managing black root rot disease caused by R. solani in strawberry cultivation.

Genome-wide characterization and expression analysis of WRKY transcription factors reveals biotic stress response potential mechanisms in Panax notoginseng

WRKY transcription factors (TFs), among the largest families of transcriptional regulators, are essential players in defense responses in plants. Panax notoginseng, a traditional and precious herbal medicine in China, is widely cultivated due to its excellent medicinal and edible value. However, P. notoginseng is frequently affected by various diseases (like Black blot disease, Root rot disease and Viral diseases). Therefore, the present study aimed to identify and characterize PnWRKYs in the P. notoginseng genome, reveal their structural attributes, regulatory elements, and potential functions in defense responses. 68 PnWRKY TFs that have conserved domains and different physicochemical characteristics were identified in the genome. They can be divided into four groups according to phylogenetic relationships and conserved domain structures. Furthermore, Group II WRKY TFs can be classified into five subgroups (IIa, IIb, IIc, IId, and IIe) according to their zinc finger-like motif. The PnWRKY family expands mainly via segmental duplication. Additionally, the promoter regions of PnWRKYs contain many hormone-responsive and stress-responsive elements. Expression patterns under different hormones (salicylic acid, methyl jasmonate, and melatonin) and disease (root rot disease, black blot disease, and virus disease) treatment analysis highlighted their wide involvement in plant hormone-induced disease defense responses. These findings affirmed the potential functions of PnWRKY TFs in disease-mediated defense responses and provided valuable insights for future agricultural applications.