Root-lesion Nematode Pratylenchus Thornei Research Articles

A Quantitative Trait Locus with a Major Effect on Root-Lesion Nematode Resistance in Barley.

Although the root-lesion nematode Pratylenchus thornei is known to affect barley (Hordeum vulgare L.), there have been no reports on the genetic control of P. thornei resistance in barley. In this research, P. thornei resistance was assessed for a panel of 46 barley mapping parents and for two mapping populations (Arapiles/Franklin and Denar/Baudin). With both populations, a highly significant quantitative trait locus (QTL) was mapped at the same position on the long arm of chromosome 7H. Single-nucleotide polymorphisms (SNPs) in this region were anchored to an RGT Planet pan-genome assembly and assayed on the mapping parents and other barley varieties. The results indicate that Arapiles, Denar, RGT Planet and several other varieties likely have the same resistance gene on chromosome 7H. Marker assays reported here could be used to select for P. thornei resistance in barley breeding. Analysis of existing barley pan-genomic and pan-transcriptomic data provided a list of candidate genes along with information on the expression and differential expression of some of those genes in barley root tissue. Further research is required to identify a specific barley gene that affects root-lesion nematode resistance.

Transcriptome analysis reveals key genes associated with root-lesion nematode Pratylenchus thornei resistance in chickpea

The root-lesion nematode, Pratylenchus thornei, is one of the major plant-parasitic nematode species causing significant yield losses in chickpea (Cicer arietinum). In order to identify the underlying mechanisms of resistance to P. thornei, the transcriptomes of control and inoculated roots of three chickpea genotypes viz. D05253 > F3TMWR2AB001 (resistant advanced breeding line), PBA HatTrick (moderately resistant cultivar), and Kyabra (susceptible cultivar) were studied at 20 and 50 days post inoculation using the RNA-seq approach. On analyzing the 633.3 million reads generated, 962 differentially expressed genes (DEGs) were identified. Comparative analysis revealed that the majority of DEGs upregulated in the resistant genotype were downregulated in the moderately resistant and susceptible genotypes. Transcription factor families WRKY and bZIP were uniquely expressed in the resistant genotype. The genes Cysteine-rich receptor-like protein kinase 10, Protein lifeguard-like, Protein detoxification, Bidirectional sugar transporter Sugars Will Eventually be Exported Transporters1 (SWEET1), and Subtilisin-like protease were found to play cross-functional roles in the resistant chickpea genotype against P. thornei. The identified candidate genes for resistance to P. thornei in chickpea can be explored further to develop markers and accelerate the introgression of P. thornei resistance into elite chickpea cultivars.

Arbuscular mycorrhizal fungi acted synergistically with Bradyrhizobium sp. to improve nodulation, nitrogen fixation, plant growth and seed yield of mung bean (Vigna radiata) but increased the population density of the root-lesion nematode Pratylenchus thornei

Arbuscular mycorrhizal fungi acted synergistically with Bradyrhizobium sp. to improve nodulation, nitrogen fixation, plant growth and seed yield of mung bean (Vigna radiata) but increased the population density of the root-lesion nematode Pratylenchus thornei

Metabolomic profiling of wheat genotypes resistant and susceptible to root-lesion nematode Pratylenchus thornei.

Metabolic profiling of Pratylenchus thornei resistant and susceptible wheat genotypes indicates that fatty acid, glycerolipid and flavonoid classes of metabolites constitutively expressed in resistant wheat roots could reduce nematode reproduction. The root-lesion nematode Pratylenchus thornei reduces wheat production in many parts of the world. In this study the metabolic profiles of two wheat genotypes ‘QT16258’ (moderately resistant) and ‘Janz’ (susceptible) were compared at 8 weeks post inoculation with or without P. thornei. We performed untargeted liquid chromatography mass spectrometry analysis (LC–MS) of the wheat root samples. A total of 11,704 MS features were identified, out of which 765 MS features were annotated using in-house chemical standards. Principal components analysis (PCA) and partial least square discriminant analysis (PLS-DA) indicated dissimilarity of the metabolome between P. thornei resistant and susceptible genotypes. Two-way analysis of variance indicated that metabolic differences were mainly constitutive rather than induced by inoculation with P. thornei. Eighty-four annotated metabolites were significantly (p ≤ 0.01) higher in relative concentration in ‘QT16258’ than ‘Janz’ and belonged to the following classes of metabolites: flavonoids, fatty acids, glycerolipids, alkaloids, tannins, nucleotides, steroid glycosides and terpenoids. Eighty-five annotated metabolites were significantly (p ≤ 0.01) higher in relative concentration in ‘Janz’ than ‘QT16258’ and belonged to the following classes of metabolites: amino acids, sugars, flavonoids and alkaloids. Several metabolites at higher concentration in ‘QT16258’, including quercetin-3,4'-O-di-beta-glucoside (flavonoid), linoleic acid (fatty acid), lysophosphatidylethanolamine (glycerolipid), hirsutine (alkaloid), 1-methylsulfinylbutenyl-isothiocyanate (glucosinolate), could potentially strengthen the root cell walls to inhibit nematode penetration and/or reduce nematode motility. Some metabolites at higher concentrations in susceptible ‘Janz’, including phenolics, coniferyl alcohol and indole acetic acid conjugates, could be nematode attractants as well as part of a hypersensitive browning reaction to nematode invasion.

Constitutive and Induced Expression of Total Phenol and Phenol Oxidases in Wheat Genotypes Ranging in Resistance/Susceptibility to the Root-Lesion Nematode Pratylenchus thornei.

Plant-derived phenolic compounds contribute to the defense against various pathogens, including root-lesion nematodes (Pratylenchus spp.). However, there are no reports on the role of phenolic compounds in wheat (Triticum aestivum) against Pratylenchus thornei. In this study, wheat genotypes ranging from resistant to very susceptible to P. thornei were used to investigate the level of total phenols and phenol oxidases, polyphenol oxidase (PPO), and peroxidase (POD) expressed in root tissues when grown in the presence and absence of P. thornei over time (2–8 weeks). Higher constitutive levels of total phenols were found in resistant synthetic hexaploid wheats CPI133872 (576 µg gallic acid equivalent (GAE)/g root) and CPI133859 (518 µg GAE/g root) at 8 weeks after sowing, compared with moderately resistant and susceptible genotypes (192 to 390 µg GAE/g root). The activity of PPO was induced in resistant (CPI133872) and moderately resistant (GS50a and its derivate QT8343) genotypes, becoming maximal at 4 weeks after P. thornei inoculation. The activity of POD was induced in CPI133872 at 6 weeks after P. thornei inoculation. Different genetic sources of resistance to P. thornei showed diverse defense mechanisms and differences in timing responses. The combined effects of total phenols and oxidative enzymes could be important for defense against P. thornei in some resistant wheat genotypes.

Pratylenchus thornei: The Relationship Between Presowing Nematode Density and Yield Loss in Wheat and Barley.

The root lesion nematode Pratylenchus thornei causes economic losses in wheat and barley internationally through both reduced grain yield and grain quality. This study investigated the relationships between the presowing P. thornei density and grain yield and the postharvest nematode densities. Four field experiments were conducted at the same site between 2010 and 2014. A range of presowing P. thornei densities was established in the first year by growing three cereal cultivars that ranged from resistant to susceptible. In the following year, plots were sown with the five same cereal cultivars. A linear relationship was observed between the natural log of the presowing P. thornei density and grain yield across all seasons. The results showed that grain yield losses varied between cultivars and seasons. The importance of season was significant, with this study conducted over several seasons, and it highlighted the variability in yield losses between seasons, which will need further investigation. The greatest yield losses observed were 25 to 28% when the maximum presowing P. thornei densities ranged between 150 and 250 P. thornei g of soil-1. An analysis of the relationship between the presowing and postharvest nematode densities revealed that increased presowing nematode densities resulted in decreased multiplication rates in all seasons and in all cultivars. Nematode multiplication rates also varied between seasons. These results explain why it is difficult to predict nematode levels based on cropping history, and additionally, they highlight the importance of growing resistant cultivars to maintain low levels of P. thornei to minimize risk of yield losses.

Resistance of Wheat Genotypes to Root-Lesion Nematode (Pratylenchus thornei) Can be Used to Predict Final Nematode Population Densities, Crop Greenness, and Grain Yield in the Field.

The root-lesion nematode Pratylenchus thornei is a major pathogen of wheat (Triticum aestivum) in many regions globally. Resistance of wheat genotypes to P. thornei can be determined from final nematode population densities in glasshouse experiments but combining results across multiple experiments presents challenges. Here, we use a factor analytic method for multiexperiment analysis of final population densities of P. thornei for 1,096 unique wheat genotypes in 22 glasshouse experiments. The resistance to P. thornei of the genotypes was effectively represented by a two-factor model with rotation of the axes to a principal components solution. Principal axes 1 and 2 (PA1 and PA2) accounted for 79 and 11% of the genetic variance, respectively, over all experiments. Final population densities of P. thornei as empirical best linear unbiased predictors (PA[1+2]-eBLUPs) from the combined glasshouse experiments were highly predictive (P < 0.001) of final nematode population densities in the soil profile, crop canopy greenness (normalized difference vegetation index), and grain yield of wheat genotypes in P. thornei-infested fields in the Australian subtropical grain region. Nine categories of resistance ratings for wheat genotypes from resistant to very susceptible were based on subdivision of the range of PA(1+2)-eBLUPs for use in growers' sowing guides. Nine genotypes were nominated as references for future resistance experiments. Most (62%) Australian wheat genotypes were in the most susceptible three categories (susceptible, susceptible to very susceptible, and very susceptible). However, resistant germplasm characterized in this study could be used in plant breeding to considerably improve the overall resistance of Australian wheat crops.

Molecular and morphometric characterization of root lesion nematodePratylenchus thorneiSher and Allen, 1953 from hazelnut orchards in Ordu, Turkey

Root-lesion nematode Pratylenchus thornei is one of the most economically important and widely distributed species worldwide. Hazelnut (Corylus avellana L.) is a main perennial crop in Turkey. This study reports the molecular and morphological characterization of P. thornei from hazelnut orchards from Ordu province. In June 2016, soil samples were collected from around the roots of hazelnut trees in Ordu. Nematodes were extracted from soil using a modified Baermann funnel method. The standard morphometric characters were measured for root-lesion nematodes and compared with previous studies. For molecular characterization, DNA was extracted from adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA. The PCR product was purified and sequenced. The sequence was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 100% with P. thornei (e.g., GenBank Accession Nos. KT213559.1, and JX261954.1). This study indicated that P. thornei is the species occurring on hazelnut in Ordu provinces, Turkey.

Resistance to the root lesion nematodes Pratylenchus thornei and P. neglectus in cereals: Improved assessments in the field

The root lesion nematodes (RLN) Pratylenchus thornei and P. neglectus cause yield losses in intolerant field crops, internationally. They both have wide host ranges, invading grass and broadleaf grain crops, pasture species and weeds. Plant resistance, the ability of the plant to prevent nematode reproduction, is the main method of control, but requires accurate information on varietal resistance rankings to plan effective management strategies. This study used a multi environment trial (MET) analysis to examine the effect of cereal varieties (wheat, durum, barley and triticale) on the multiplication of P. thornei and P. neglectus when grown in a range of field environments at high and low pre-sowing nematode densities across a range of growing years. The study measured multiplication of P. thornei (68 varieties) and P. neglectus (62 varieties) in six and seven field experiments, respectively, each with high and low pre-sowing nematode densities, conducted during the years 2011–2014. This study showed genetic variation in the resistance ranking between cereal types and varieties for both P. thornei and P. neglectus. This provides management options to growers and information to breeding programs, which can be used to improve the resistance of future varieties. The consistent rankings across the field experiments and observed high genetic correlation between environments was unexpected given experiments were conducted across a range of years, soil types, geographic locations and different pre-sowing nematode densities. These high correlations suggested that varietal resistance can be determined with small numbers of field experiments, thus reducing the costs and time taken to determine varietal resistance. Finally, it was found that a lower pre-sowing nematode density resulted in a higher nematode multiplication rate compared to the high pre-sowing nematode density. This highlights the need to select resistant varieties to avoid large increases in nematode densities in fields with low nematode densities. This analysis of field experimental data for nematodes is novel and indicates that field data can be used to accurately assess varietal resistance (nematode multiplication) across environments. Therefore, accurate data on varietal resistance that is applicable over wide area can be produced with fewer experiments, resulting in varieties with increased resistance being planted, thus reducing grain yield losses due to root lesion nematodes.

The effect of organic amendment input and crop management practices on the nematode community and suppression of root-lesion nematode (Pratylenchus thornei) in a grain-growing soil

The root-lesion nematode Pratylenchus thornei is a major pest in the northern grain-growing region of Australia, costing the wheat industry alone $38 million/year in lost production. Biological suppression is being examined as a potential method of reducing populations of P. thornei, which is complementary to the current research focus of breeding tolerant and resistant varieties and using resistant hosts in crop sequences to manage the pest. This study aimed to examine the effect of key farm practices of soil suppressiveness to P. thornei. A field trial was established to determine whether suppressiveness is enhanced by organic amendments (a single application of 0, 5, 10 and 20 t organic matter/ha incorporated into the top soil) and various cropping regimes (bare fallow with residue removed, sorghum with residue retained, sorghum with residue removed). We found that the treatments did not improve soil organic carbon levels but the results of soil nematode analyses indicated that the soil’s biological status changed when these treatments were applied. In the first year after rotation with sorghum, the suppressiveness of the soil increased compared to the fallow treatment. However, in the next year after re-applying the crop management treatments following several months of fallow, soil suppressiveness had declined and difference between treatments were not significant. With the following wheat planting, the soils showed higher suppressiveness in the sorghum residue-retained treatment but that treatment did not affect the yield of two susceptible wheat varieties. The trial also showed that intensive cropping is more likely to induce suppressiveness to root-lesion nematode than a single application of up to 20 t/ha of organic matter.

In vitro nematicidal activity of naphthoquinones against the root-lesion nematode Pratylenchus thornei

The root-lesion nematode Pratylenchus thornei is a widely distributed and important parasite of cereals and legumes. As migratory endoparasites, P. thornei are difficult to manage because they enter and leave host roots and may remain quiescent inside roots or in soil when conditions are unfavourable for plant growth. The number of available nematicides to manage these nematodes is restricted, so new, effective and eco-friendly sustainable management strategies are needed. The effects of naphthoquinones (juglone, 1,4-naphtoquinone and plumbagin) produced by some plants species, including walnut (Juglandaceae), were assessed against P. thornei . An additional treatment of a mixture of juglone and 1,4-naphtoquinone (2:1, w/w), was included because these compounds are frequently found at these propotion in walnut extracts. Juveniles and adult nematodes were exposed to different concentrations of each naphthoquinone and nematode mortality was assessed. Juglone and 1,4-naphthoquinone (at 500 ppm) were more effective than plumbagin, and gave 100% mortality after 24 h of exposure. A synergistic effect was not detected when juglone and 1,4-naphthoquinone (2:1, w/w) were combined. Estimated lethal concentrations causing 50% P. thornei mortality (LC 50 s) (72 h exposure) were: 134.7 ppm for juglone, 161.2 ppm for 1,4-naphthoquinone, 207.6 ppm for juglone + 1,4-naphthoquinone (2:1, w/w), and 178.8 ppm for plumbagin. This study has demonstrated the nematicidal potential of these naphthoquinones against P. thornei , and has shown that walnut residues may be valuable sources for extraction of these compounds.

Modelling population densities of root-lesion nematode (Pratylenchus thornei) from soil profile temperatures to choose an optimum sowing date for wheat in a subtropical region

The root-lesion nematode Pratylenchus thornei is widely distributed in many wheat growing countries and is particularly damaging to wheat in subtropical environments. This study aimed to investigate by simulation the effects of soil profile temperatures after different sowing dates on reproduction of P. thornei in susceptible and moderately resistant wheat cultivars in the subtropical grain region of eastern Australia. A quadratic regression model relating P. thornei population densities to thermal time was produced from experimental data for susceptible, intolerant wheat cv. Gatcher and moderately resistant, tolerant wheat cv. GS50a, and applied to soil profile temperatures after four sowing dates from 25 April to 24 July. Simulated final population densities of P. thornei throughout the soil profile to 60cm depth were least at 18 weeks after 25 May sowing. For Gatcher and GS50a, respectively, there were 5.7 and 3.5 times as many nematodes after 24 July sowing as after 25 May sowing, 2.0 and 1.6 after 24 June, and 1.4 and 1.3 after 25 April sowings. GS50a had 78% (May) to 86% (July) fewer nematodes in the soil profile than Gatcher. These simulations indicated that an optimum sowing date can be chosen to limit P. thornei reproduction in both susceptible and moderately resistant wheat cultivars. Gatcher had a 61% increase in measured grain yield and GS50a had an 8% increase from sowing in late May rather than in the third week of June. Sowing wheat at an optimum time in subtropical grain regions to ensure roots grow in cool soil can be a useful component of integrated management by reducing the rate of P. thornei reproduction and increasing grain yield.

Diploid and tetraploid progenitors of wheat are valuable sources of resistance to the root lesion nematode Pratylenchus thornei

The root lesion nematode Pratylenchusthornei is widely distributed in Australian wheat (Triticumaestivum) producing regions and can reduce yield by more than 50%, costing the industry AU$50 M/year. Genetic resistance is the most effective form of management but no commercial cultivars are resistant (R) and the best parental lines are only moderately R. The wild relatives of wheat have evolved in P. thornei-infested soil for millennia and may have superior levels of resistance that can be transferred to commercial wheats. To evaluate this hypothesis, a collection of 251 accessions of wheat and related species was tested for resistance to P. thornei under controlled conditions in glasshouse pot experiments over two consecutive years. Diploid accessions were more R than tetraploid accessions which proved more R than hexaploid accessions. Of the diploid accessions, 11 (52%) Aegilopsspeltoides (S-[B]-genome), 10 (43%) Triticummonococcum (Am-genome) and 5 (24%) Triticumurartu (Au-genome) accessions were R. One tetraploid accession (Triticumdicoccoides) was R. This establishes for the first time that P. thornei resistance is located on the A-genome and confirms resistance on the B-genome. Since previous research has shown that the moderate levels of P. thornei resistance in hexaploid wheat are dose-dependent, additive and located on the B and D-genomes, it would seem efficient to target A-genome resistance for introduction to hexaploid lines through direct crossing, using durum wheat as a bridging species and/or through the development of amphiploids. This would allow resistances from each genome to be combined to generate a higher level of resistance than is currently available in hexaploid wheat.

De novo analysis and functional classification of the transcriptome of the root lesion nematode, Pratylenchus thornei, after 454 GS FLX sequencing

The migratory endoparasitic root lesion nematode Pratylenchus thornei is a major pest of the cereals wheat and barley. In what we believe to be the first global transcriptome analysis for P. thornei, using Roche GS FLX sequencing, 787,275 reads were assembled into 34,312 contigs using two assembly programs, to yield 6,989 contigs common to both. These contigs were annotated, resulting in functional assignments for 3,048. Specific transcripts studied in more detail included carbohydrate active enzymes potentially involved in cell wall degradation, neuropeptides, putative plant nematode parasitism genes, and transcripts that could be secreted by the nematode. Transcripts for cell wall degrading enzymes were similar to bacterial genes, suggesting that they were acquired by horizontal gene transfer. Contigs matching 14 parasitism genes found in sedentary endoparasitic nematodes were identified. These genes are thought to function in suppression of host defenses and in feeding site development, but their function in P. thornei may differ. Comparison of the common contigs from P. thornei with other nematodes showed that 2,039 were common to sequences of the Heteroderidae, 1,947 to the Meloidogynidae, 1,218 to Radopholus similis, 1,209 matched expressed sequence tags (ESTs) of Pratylenchus penetrans and Pratylenchus vulnus, and 2,940 to contigs of Pratylenchus coffeae. There were 2,014 contigs common to Caenarhabditis elegans, with 15.9% being common to all three groups. Twelve percent of contigs with matches to the Heteroderidae and the Meloidogynidae had no homology to any C. elegans protein. Fifty-seven percent of the contigs did not match known sequences and some could be unique to P. thornei. These data provide substantial new information on the transcriptome of P. thornei, those genes common to migratory and sedentary endoparasitic nematodes, and provide additional understanding of genes required for different forms of parasitism. The data can also be used to identify potential genes to study host interactions and for crop protection.

Detection and Quantification ofPratylenchus thorneiin DNA Extracted from Soil Using Real-Time PCR

The root-lesion nematode Pratylenchus thornei is one of the most important pests restricting productivity of wheat in the Pacific Northwest (PNW). It is laborious and difficult to use microscopy to count and identify the nematodes in soils. A SYBR Green I-based real-time polymerase chain reaction (PCR) assay was developed to detect and quantify this species from DNA extracts of soil. A primer set, designed from the internal transcribed spacer region (ITS1) of rDNA, was highly specific to P. thornei and did not amplify DNA from 27 isolates of other Pratylenchus spp., other nematodes, and six fungal species present in PNW wheat fields. A standard curve relating threshold cycle and log values of nematode number was generated from artificially infested soils. The standard curve was supported by a high correlation between the numbers of P. thornei added to soil and the numbers quantified using real-time PCR. Examination of 15 PNW dryland field soils and 20 greenhouse samples revealed significant positive correlations between the numbers determined by real-time PCR and by the Whitehead tray and microscopic method. Real-time PCR is a rapid, sensitive alternative to time-consuming nematode extractions, microscopic identification, and counting of P. thornei from field and greenhouse soils.

Hybridisation of Australian chickpea cultivars with wild Cicer spp. increases resistance to root-lesion nematodes (Pratylenchus thornei and P. neglectus)

Australian and international chickpea (Cicer arietinum) cultivars and germplasm accessions, and wild annual Cicer spp. in the primary and secondary gene pools, were assessed in glasshouse experiments for levels of resistance to the root-lesion nematodes Pratylenchus thornei and P. neglectus. Lines were grown in replicated experiments in pasteurised soil inoculated with a pure culture of either P. thornei or P. neglectus and the population density of the nematodes in the soil plus roots after 16 weeks growth was used as a measure of resistance. Combined statistical analyses of experiments (nine for P. thornei and four for P. neglectus) were conducted and genotypes were assessed using best linear unbiased predictions. Australian and international chickpea cultivars possessed a similar range of susceptibilities through to partial resistance. Wild relatives from both the primary (C. reticulatum and C. echinospermum) and secondary (C. bijugum) gene pools of chickpea were generally more resistant than commercial chickpea cultivars to either P. thornei or P. neglectus or both. Wild relatives of chickpea have probably evolved to have resistance to endemic root-lesion nematodes whereas modern chickpea cultivars constitute a narrower gene pool with respect to nematode resistance. Resistant accessions of C. reticulatum and C. echinospermum were crossed and topcrossed with desi chickpea cultivars and resistant F4 lines were obtained. Development of commercial cultivars with the high levels of resistance to P. thornei and P. neglectus in these hybrids will be most valuable for areas of the Australian grain region and other parts of the world where alternating chickpea and wheat crops are the preferred rotation.

Inheritance of resistance to root-lesion nematode (Pratylenchus thornei) in wheat landraces and cultivars from the West Asia and North Africa (WANA) region

The root-lesion nematode Pratylenchus thornei causes substantial loss to bread wheat production in the northern grain region of Australia and other parts of the world. West Asia and North Africa (WANA) wheat accessions with partial resistance to P. thornei were analysed for mode of inheritance in a half-diallel crossing design of F1 hybrids (10 parents) and F2 populations (7 parents). General combining ability was more important than specific combining ability as indicated by components of variance ratios of 0.93 and 0.95 in diallel ANOVA of the F1 and F2 generations, respectively. General combining ability values of the ‘resistant’ parents were predictive of the mean nematode numbers of their progeny in crosses with the susceptible Australian cv. Janz at the F1 (R2 = 0.86, P &lt; 0.001, 8 crosses), F2 (R2 = 0.83, P &lt; 0.001, 9 populations) and F∞ (R2 = 0.71, P &lt; 0.05, 5 doubled-haploid populations). The F2 and F∞ populations showed relatively continuous distributions. Heritability was 0.68 for F2 populations in the half-diallel of resistant parents and 0.82–0.92 for 5 ‘resistant’ parent/Janz doubled-haploid populations (narrow-sense heritability on a line mean basis). The results indicate polygenic inheritance of P. thornei resistance with a minimum of from 2 to 6 genes involved in individual F∞ populations of 5 resistant parents crossed with Janz. Morocco 426 and Iraq 43 appear to be the best of the parents tested for breeding for resistance to P. thornei. None of the P. thornei-resistant WANA accessions was resistant to Pratylenchus neglectus.

Resistance to the root-lesion nematode Pratylenchus thornei in wheat landraces and cultivars from the West Asia and North Africa (WANA) region

Resistance to the root-lesion nematode Pratylenchus thornei was sought in wheat from the West Asia and North Africa (WANA) region in the Watkins Collection (148 bread and 139 durum wheat accessions) and the McIntosh Collection (59 bread and 43 durum wheat accessions). It was considered that landraces from this region, encompassing the centres of origin of wheat and where P. thornei also occurs, could be valuable sources of resistance for use in wheat breeding. Resistance was determined by number of P. thornei/kg soil after the growth of the plants in replicated glasshouse experiments. On average, durum accessions produced significantly lower numbers of P. thornei than bread wheat accessions in both the Watkins and McIntosh Collections. Selected accessions with low P. thornei numbers were re-tested and 13 bread wheat and 10 durum accessions were identified with nematode numbers not significantly different from GS50a, a partially resistant bread wheat line used as a reference standard. These resistant accessions, which originated in Iran, Iraq, Syria, Egypt, Sudan, Morocco, and Tunisia, represent a resource of resistance genes in the primary wheat gene pool, which could be used in Australian wheat breeding programs to reduce the economic loss from P. thornei.

Effect of oat (Avena sativa) on the population density of Pratylenchus thornei in the field

The effect of eight oat cultivars on the end-of-season population density of the root lesion nematode Pratylenchus thornei was determined in the field in two seasons in the Wimmera region of Victoria. There was no difference among the oat cultivars tested on their effect on final population density of P. thornei. The oat cultivars tested were all found to result in significantly lower population densities of P. thornei than the susceptible wheat but population densities were similar to, or slightly higher than, the resistant barley and bare fallow treatments. Oat was regarded as a crop with useful resistance that can be grown in paddocks to reduce the population density of P. thornei.

Interactions of Pratylenchus thornei and Fusarium oxysporum f. sp. ciceris on Chickpea

ABSTRACT Fusarium oxysporum f. sp. ciceris and the root-lesion nematode Pratylenchus thornei coinfect chickpeas in southern Spain. The influence of root infection by P. thornei on the reaction of Fusarium wilt-susceptible (CPS 1 and PV 61) and wilt-resistant (UC 27) chickpea cultivars to F. oxysporum f. sp. ciceris race 5 was investigated under controlled and field conditions. Severity of Fusarium wilt was not modified by coinfection of chickpeas by P. thornei and F. oxysporum f. sp. ciceris, in simultaneous or sequential inoculations with the pathogens. Root infection with five nematodes per cm(3) of soil and 5,000 chlamydospores per g of soil of the fungus resulted in significantly higher numbers of propagules of F. oxysporum f. sp. ciceris with the wilt-susceptible cultivar CPS 1, but not with the wilt-resistant one. However, infection with 10 nematodes per cm(3) of soil significantly increased root infection by F. oxysporum f. sp. ciceris in both cultivars, irrespective of fungal inoculum densities (250 to 2,000 chlamydospores per g of soil). Plant growth was significantly reduced by P. thornei infection on wilt-susceptible and wilt-resistant chickpeas in controlled and field conditions, except when shorter periods of incubation (45 days after inoculation) were used under controlled conditions. Severity of root necrosis was greater in wilt-susceptible and wilt-resistant cultivars when nematodes were present in the root, irrespective of length of incubation time (45 to 90 days), densities of nematodes (5 and 10 nematodes per cm(3) of soil), fungal inocula, and experimental conditions. Nematode reproduction on the wilt-susceptible cultivars, but not on the wilt-resistant one, was significantly increased by F. oxysporum f. sp. ciceris infections under controlled and field conditions.