RNA-dependent RNA Polymerase Protein Research Articles

Complete genome sequence of a novel mitovirus isolated from the phytopathogenic fungus Alternaria alternata causing apple leaf blotch.

In this study, a novel mitovirus, tentatively designated as "Alternaria alternata mitovirus 2" (AaMV2), was isolated from the fungus Alternaria alternata f. sp. mali causing apple leaf blotch disease. The complete genome of AaMV2 is 3,157 nucleotides in length, with an A+U content of 68.10%. The genome has a single large open reading frame (ORF) encoding an RNA-dependent RNA polymerase (RdRp) protein with a molecular mass of 98.10 kDa. BLAST analysis revealed that AaMV2 has the highest sequence identity to Leptosphaeria biglobosa mitovirus 6, with 79.76% and 82.86% identity at the amino acid and nucleotide level, respectively. Phylogenetic analysis suggested that AaMV2 is a new member of the genus Duamitovirus within the family Mitoviridae. This is the first report of the complete genome sequence analysis of a mitovirus in A. alternata.

The astrovirus N-terminal nonstructural protein anchors replication complexes to the perinuclear ER membranes.

An essential aspect of positive-sense RNA virus replication is anchoring the replication complex (RC) to cellular membranes. Positive-sense RNA viruses employ diverse strategies, including co-translational membrane targeting through signal peptides and co-opting cellular membrane trafficking components. Often, N-terminal nonstructural proteins play a crucial role in linking the RC to membranes, facilitating the early association of the replication machinery. Astroviruses utilize a polyprotein strategy to synthesize nonstructural proteins, relying on subsequent processing to form replication-competent complexes. This study provides evidence for the perinuclear ER membrane association of RCs in five distinct human astrovirus strains. Using tagged recombinant classical human astrovirus 1 and neurotropic MLB2 strains, we establish that the N-terminal domain guides the ER membrane association. We identified di-arginine motifs responsible for the perinuclear ER retention and formation of functional RCs through mutational analysis of the N-terminal domain in replicon and reverse genetics systems. In addition, we demonstrate the association of key components of the astrovirus replication complex: double-stranded RNA, RNA-dependent RNA polymerase, protease, and N-terminal protein. Our findings highlight the intricate virus-ER interaction mechanism employed by astroviruses, potentially leading to the development of novel antiviral intervention strategies.

Complete genome sequence of a novel amalgavirus in sponge gourd, Luffa cylindrica.

A novel monopartite dsRNA virus, tentatively named "sponge gourd amalgavirus 1" (SGAV1), was discovered by high-throughput sequencing in sponge gourd (Luffa cylindrica) displaying mosaic symptoms in Jiashan County, Zhejiang Province, China. The genome of SGAV1 is 3,447 nucleotides in length and contains partially overlapping open reading frames (ORFs) encoding a putative replication factory matrix-like protein and a fusion protein, respectively. The fusion protein of SGAV1 shares 57.07% identity with the homologous protein of salvia miltiorrhiza amalgavirus 1 (accession no. DAZ91057.1). Phylogenetic analysis based on the RNA-dependent RNA polymerase (RdRp) protein suggests that SGAV1 belongs to the genus Amalgavirus of the family Amalgaviridae. Moreover, analysis of SGAV1-derived small interfering RNAs indicated that SGAV1 was actively replicating in the host plant. Semi-quantitative RT-PCR showed higher levels of SGAV1 expression in leaves than in flowers and fruits. This is the first report of a novel amalgavirus found in sponge gourd in China.

COMPOSITION OF VOLATILE BIOACTIVE COMPOUNDS OF SEA CUCUMBER (HOLOTHURIA ATRA) EXTRACT AND THEIR BIOACTIVITY AS ANTIVIRALS FOR SARS-COV-2 COVID-19

COVID-19 is a pandemic that has an impact on all aspects of life. This pandemic is caused by the SARS-CoV-2 virus, which has a fast pathogenesis cycle, so alternatives are needed, such as incredibly natural and marine ingredients that can be used as drug candidates. Holothuria atra is an animal candidate that has great potential. This study aims to describe the potential of H. atra as an antiviral candidate for COVID-19 through in silico analysis. The research began with extracts and GC-MS tests to identify the compound content in H. atra. Molecular docking analysis, Lipinski druglikeness, and toxicity predictions were carried out to determine the potential of the compound as an antiviral candidate for COVID-19 through inhibition of RNA-dependent RNA-polymerase protein (RdRp) and human Angiotensin Converting Enzym-2 (hACE2). The research results showed that there were five volatile compounds in the methanol extract of H. atra with one potential compound as a COVID-19 antiviral, namely Cyclohexanone, 2,6-bis((4-methoxyphenyl)methylene)-. Lipinskis druglikeness analysis and toxicity prediction provide support as a COVID-19 antiviral. Further research, such as in vitro and in vivo testing, can be carried out to give an overview of living cells and its activity as an antiviral for COVID-19.

A Novel Cryptic Virus Isolated from Galphimia spp. in Mexico.

Galphimia spp. is a plant employed in traditional medicine in Mexico because of its anxiolytic and sedative effects. Viruses have been associated with different alterations in plants, although asymptomatic agents (i.e., cryptic viruses) are also known. High-throughput sequencing (HTS) allows for the detection of pathogenic and non-pathogenic viral agents in plants, including potential novel viruses. The aim of this study was to investigate the presence of viral agents in two populations of Galphimia spp. by HTS. Sequencing was conducted on an Illumina NextSeq 550 platform, and a putative novel virus was identified. Two contigs showed homology to partitiviruses, and these encoded the RNA-dependent RNA polymerase and coat protein. These proteins showed the highest identities with orthologs in the recently discovered Vitis cryptic virus. A phylogenetic analysis of both RNAs showed that the new virus clusters into the monophyletic genus Deltapartitivirus along with other plant-infecting viruses. The result of the HTS analysis was validated by conventional RT-PCR and Sanger sequencing. A novel virus was discovered in a symptomless Galphimia spp. plant and tentatively named the Galphimia cryptic virus (GCV). This is the first virus discovered in medicinal plants in Mexico.

Molecular characterization of birch toti-like virus, a plant-associated member of the new family Orthototiviridae.

A novel totivirus, named "birch toti-like virus" (BTLV), was discovered in European white birch (Betula pendula) plants. The genome of BTLV is 4,967 nucleotides long and contains two overlapping open reading frames (ORFs) coding for the capsid protein (CP) and an RNA-dependent RNA-polymerase (RdRP). The encoded CP and RdRP proteins shared 46.9% and 60.2% amino acid sequence identity, respectively, with those of Panax notoginseng virus B. The presence of a putative slippery heptamer signal 82 nt upstream of the stop codon of ORF1 suggests that a -1 translational frameshifting strategy is involved in the expression of ORF2, like in other totiviruses. Phylogenetic analysis based on the CP and RdRP amino acid sequences placed this virus within a clade of plant-associated totiviruses, with taro-associated virus as its closest relative. Hence, based on its distinct host and the amino acid sequence similarity between BTLV and its relatives, we conclude that birch toti-like virus is a new member of the genus Totivirus.

Complete genome analysis of a novel narnavirus in sweet viburnum (Viburnum odoratissimum).

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This isthe first report of a narnavirus in V. odoratissimum.

Novel Aquareovirus isolated from channel catfish (Ictalurus punctatus) used in mussel restoration efforts in Wisconsin.

Channel catfish (Ictalurus punctatus) are a food fish extensively reared in aquaculture facilities throughout the world and are also among the most abundant wild catfish species in North America, making them a popular target of anglers. Furthermore, channel catfish are important members of aquatic ecosystems; for example, they serve as a glochidial host for the endangered winged mapleleaf mussel (Quadrula fragosa), making them critical for conserving this species through hatchery-based restoration efforts. During a routine health inspection, a novel aquareovirus was isolated from channel catfish used in mussel propagation efforts at a fish hatchery in Wisconsin. This virus was isolated on brown bullhead cells (ATCC CCL-59) and identified through metagenomic sequencing as a novel member of the family Spinareoviridae, genus Aquareovirus. The virus genome consists of 11 segments, as is typical of the aquareoviruses, with phylogenetic relationships based on RNA-dependent RNA polymerase and major outer capsid protein amino acid sequences showing it to be most closely related to golden shiner virus (aquareovirus C) and aquareovirus C/American grass carp reovirus (aquareovirus G) respectively. The potential of the new virus, which we name genictpun virus 1 (GNIPV-1), to cause disease in channel catfish or other species remains unknown.

Complete genome sequence of a new putative member of the genus Pelarspovirus that infects Quercus aliena Blume in South Korea.

The complete nucleotide sequence of a newly discovered virus infecting Quercus aliena Blume, tentatively named "quercus leafroll virus" (QLRV), was determined through high-throughput and Sanger sequencing. The sequence comprises 3,940 nucleotides, has five open reading frames, and has a typical pelarspovirus genome organization, with neither 3' polyadenylation nor a 5' cap. The proteins encoded by QLRV share 17.9 to 44.2% amino acid sequence identity with known pelarspovirus proteins. The highest amino acid sequence identity values for the RNA-dependent RNA polymerase (RdRp) and coat protein were 67.5% and 55.2%, respectively, which are below the current thresholds for pelarspovirus species demarcation. On the basis of these results, we propose classifying QLRV as a new member of the genus Pelarspovirus, family Tombusviridae.

Molecular and biological characterization of a partitivirus from Paecilomyces variotii.

Paeciliomyces variotii is a thermo-tolerant, ubiquitous fungus commonly found in food products, indoor environments, soil and clinical samples. It is a well-known biocontrol agent used against phytopathogenic fungi and its metabolites have many industrial applications. Rare reports of P. variotii-related human infections have been found in the medical literature. In this study, we report for the first time the infection of P. variotii isolated from a soil sample collected in a rice field with a double-stranded RNA virus, Paeciliomyces variotii partitivirus 1 (PvPV-1) in the family Partitiviridae. P. variotii harboured icosahedral virus particles 30 nm in diameter with two dsRNA segments 1758 and 1356 bp long. Both dsRNA1 and dsRNA2 have a single open reading frame encoding proteins of 63 and 40 kDa, respectively. These proteins have significant similarity to the RNA-dependent RNA polymerase and capsid protein encoded by the genomic segments of several viruses from the family Partitiviridae. Phylogenetic analysis revealed that PvPV-1 belongs to the family Partitiviridae but in an unclassified group/genus, tentatively nominated Zetapartitivirus. PvPV-1 was found to increase the growth rate of the host fungus, as indicated by time course experiments performed on a range of different media for virus-infected and virus-free isogenic lines. Further, dual-culture assays performed for both isogenic lines confirmed the antagonistic potential of P. variotii against other phytopathogenic fungi. The findings of this study assist us in understanding P. variotii as a potential biocontrol agent, together with plant-fungus-virus interactions.

Targeting H3N2 influenza virus RNA dependent RNA polymerase dependent inhibitory activity by principal components from latex of Calotropis gigantean

The H3N2 influenza virus is spiking dramatically, which is a major concern worldwide and in India. The multifunctional hetero-trimer influenza virus RNA-dependent RNA polymerase (RdRP) is involved in the generation of viral mRNA and is crucial for viral infectivity, which is directly related to the virus’s ability to survive. The goal of the current work was to use molecular docking to determine how the RdRP protein might be affected by powerful bioactive chemicals found in Calotropis gigantia latex. By applying CB-dock 2 analysis and 2D interactions, an in-silico docking study was conducted using a GC-FID (gas chromatography with flame-ionization detection) based composition profile. Tocospiro A (15%), Amyrin (7%), and Gombasterol A were found by GC-FID to be the main phytocompounds in the latex of Calotropis gigantia. The docking result showed that ligands were effectively bound to RdRP. According to interaction studies, RdRP/ligand complexes create hydrogen bonds, van der Waals forces, pi-alkyl bonds, alkyl bonds, and pi-Sigma bonds. Therefore, it was suggested that Calotropis gigantia latex may represent a possible herbal remedy to attenuate H3N2 infections based on the above findings of the fragrance profile and docking.

The repurposing of FDA-approved drugs to stop viral replication in COVID-19 treatment: a comprehensive molecular docking and dynamics analysis

Amidst a public health crisis such as the SARS-CoV-2 induced COVID-19 pandemic, the urgency to develop and provide access to novel drugs becomes paramount. In these scenarios, repurposing existing drugs emerges as an appealing strategy due to their established safety profiles and prior regulatory approvals, potentially streamlining their adoption for new therapeutic purposes. There has been a notable interest in investigating the repurposing potential of FDA-approved drugs to combat the disease triggered by the SARS-CoV-2 virus. This investigation was conducted with the objective of identifying FDA-approved antiviral drugs that could target both the original and mutant forms of the SARS-CoV-2 RNA-dependent RNA polymerase (RdRp) protein, given the escalating prevalence of SARS-CoV-2 mutations that undermined vaccine efficacy and underscored the need for alternative treatment avenues. Despite ongoing clinical trials, the selection of drugs specifically designed to combat SARS-CoV-2 remains limited. The present study aimed to assess the inhibitory potential of eight approved antiviral drugs. The wild-type and mutant (P323L) RdRp protein (PDB ID: 7BV2). By utilizing molecular docking techniques, the selected drugs were evaluated based on their binding affinities with both the mutant and wild-type RdRp protein. Subsequently, the protein-ligand complexes exhibiting the highest binding affinities were subjected to a 150 ns molecular dynamics simulation to evaluate their stability. The outcomes of the molecular docking analysis pinpointed Dolutegravir and Beclabuvir as possessing the most robust binding affinities for both mutant and wild-type RdRp systems. These findings prompted the selection of these drugs for an in-depth molecular dynamic simulation (MDS) investigation. The comprehensive analysis of Root Mean Square Deviation (RMSD), Root Mean Square Fluctuation (RMSF), Radius of Gyration (Rg), Solvent Accessible Surface Area (SASA) and Secondary Structure Dynamics confirmed that Dolutegravir and Beclabuvir are potent inhibitors of the NSP12 protein. Collectively, the computational assessments put forth two potential contenders: Dolutegravir and Beclabuvir as promising inhibitors against both the wild-type and mutant RdRp proteins. To further validate these drug candidates, rigorous in vitro and in vivo investigations are warranted which could eventually position them as valuable therapeutic agents in the fight against COVID-19.

Identification of a Novel Polerovirus in Cocoa (Theobroma cacao) Germplasm and Development of Molecular Methods for Use in Diagnostics.

The cocoa crop (Theobroma cacao L.) is known to be a host for several badnaviruses, some of which cause severe disease, while others are asymptomatic. Recently, the first preliminary evidence has been published concerning the occurrence of a polerovirus in cacao. We report here the first near-complete genome sequence of cacao polerovirus (CaPV) by combining bioinformatic searches of cacao transcript databases, with cloning from the infected germplasm. The reported novel genome has all the genome features known for poleroviruses from other species. Pairwise identity analyses of RNA-dependent RNA polymerase and coat protein indicates < 60% similarity of CaPV with any reported poleroviruses; hence, we propose that the polerovirus isolate reported in this study is a novel polerovirus. The genome sequence information was also used to develop a multiplex RT-PCR assay, which was applied to screen a selected range of germplasms and to identify several infected clones. Although there is no evidence that this virus causes any severe disease, this new information, together with a robust diagnostic assay, are of strategic importance in developing protocols for the safe international transfer of cacao germplasms.

Promising Experimental Anti-SARS-CoV-2 Agent "SLL-0197800": The Prospective Universal Inhibitory Properties against the Coming Versions of the Coronavirus.

Isoquinoline derivatives having some nucleosidic structural features are considered as candidate choices for effective remediation of the different severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections and their following disease, the coronavirus disease 2019 (COVID-19). SLL-0197800 is a recently discovered isoquinoline compound with potential strong universal anticoronaviral activities against SARS-CoV-2 and its previous strains. SLL-0197800 nonspecifically hits the main protease (Mpro) enzyme of the different coronaviruses. Herein in the present study, we tested the probability of the previous findings of this experimental agent to be extended to comprise any coronavirus through concurrently disrupting the mutable-less replication enzymes like the RNA-dependent RNA polymerase (RdRp) protein as well as the 3'-to-5' exoribonuclease (ExoN) protein. The in vitro anti-RdRp/ExoN assay revealed the potent inhibitory activities of SLL-0197800 on the coronaviral replication with minute values of anti-RdRp and anti-RdRp/ExoN EC50 (about 0.16 and 0.27 μM, respectively). The preliminary in silico outcomes significantly supported these biochemical findings. To put it simply, the present important results of these extension efforts greatly reinforce and extend the SLL-0197800's preceding findings, showing that the restraining/blocking actions (i.e., inhibitory activities) of this novel investigational anti-SARS-CoV-2 agent against the Mpro protein could be significantly extended against other copying and multiplication enzymes such as RdRp and ExoN, highlighting the potential use of SLL-0197800 against the coming versions of the homicidal coronavirus (if any), i.e., revealing the probable nonspecific anticoronaviral features and qualities of this golden experimental drug against nearly any coronaviral strain, for instance, SARS-CoV-3.

Targeting H3N2 Influenza Virus RNA-dependent RNA Polymerase by Using Bioactives from Essential Oils from Eucalyptus polybrachtea, Cymbopogon citratus and Cymbopogon khasianus

A dramatic surge of H3N2 influenza virus is of grave concern worldwide and particularly in India. H3N2 cause acute respiratory infection, however, a few drugs are available for its mitigation. Subsequently, researchers have been involved in efforts to discover novel antiviral mechanisms that can lay the basis for new anti-influenza drugs. Influenza virus RNA-dependent RNA polymerase (RdRP) is a multi-functional hetero-trimer, implicated in the production of viral mRNA, hence plays a major role in viral infectivity thus directly associated with survival of the virus. RdRP have been cited as anappropriate target for therapeutic drug design. In the present study molecular docking was designed to estimate the effect of potent bioactive moleculesfrom essential oils from Eucalyptus polybrachtea (eucalyptus oil, EO), Cymbopogon citratus (lemon grass essential oil, LEO) and Cymbopogon khasianus (palmarosa essential oil, PEO) against RdRP protein. GC-FID (gas chromatography with flame-ionization detection) based composition profile, and in-silico docking study was conducted by using CB-dock 2 analysis followed by 2D interactions. GC-FID revealed eucalyptol, geranial and geraniolas major phytocompounds in EO, LEO and PEO respectively. The docking score indicated effective binding of ligands to RdRP. Interactions results indicated that, RdRP/ligand complexes form hydrogen, van der waals forces, pi-alkyl, alkyl, and pi-Sigma interactions. Based on above findings of aroma profile and docking, therefore, it was recommended that essential oils from above mentioned aromatic cropsmay represent potential herbal treatment to mitigate H3N2 infections.

Co-folding and RNA activation of poliovirus 3Cpro polyprotein precursors

Positive-strand RNA viruses use long open reading frames to express large polyproteins that are processed into individual proteins by viral proteases. Polyprotein processing is highly regulated and yields intermediate species with different functions than the fully processed proteins, increasing the biochemical diversity of the compact viral genome while also presenting challenges in that proteins must remain stably folded in multiple contexts. We have used circular dichroism spectroscopy and single molecule microscopy to examine the solution structure and self-association of the poliovirus P3 region protein composed of membrane binding 3A, RNA priming 3B (VPg), 3Cpro protease, and 3Dpol RNA-dependent RNA polymerase proteins. Our data indicate that co-folding interactions within the 3ABC segment stabilize the conformational state of the 3C protease region, and this stabilization requires the full-length 3A and 3B proteins. Enzymatic activity assays show that 3ABC is also an active protease, and it cleaves peptide substrates at rates comparable to 3Cpro. The cleavage of a larger polyprotein substrate is stimulated by the addition of RNA, and 3ABCpro becomes 20-fold more active than 3Cpro in the presence of stoichiometric amounts of viral cre RNA. The data suggest that co-folding within the 3ABC region results in a protease that can be highly activated toward certain cleavage sites by localization to specific RNA elements within the viral replication center, providing a mechanism for regulating viral polyprotein processing.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Rapid Identification of Jasmine Virus H Infecting Ixora coccinea by Nanopore Metatranscriptomics.

The global climate change and international trade have facilitated the movement of plants across borders, increasing the risk of introducing novel plant viruses in new territories. Ixora coccinea exhibited virus-like foliar symptoms, including mosaic and mild mottle. An Oxford Nanopore Technologies-based compact and portable MinION platform was used to identify the causal viral pathogen. The complete genome sequence of jasmine virus H (JaVH; 3867 nt, JaVH-CNU) was determined and found to share 88.4-90.3% nucleotide identity with that of Jasminum sambac JaVH isolate in China. Phylogenetic analysis based on the complete amino acid sequences of RNA-dependent RNA polymerase and coat protein revealed that JaVH-CNU was grouped separately with other JaVH isolates. This is the first report of a natural JaVH infection of &gt;i&lt;I. coccinea. The application of rapid nanopore sequencing for plant virus identification was demonstrated and is expected to provide accurate and rapid diagnosis for virus surveillance.

Argonaute 1 and 5 proteins play crucial roles in the defence against cucumber green mottle mosaic virus in watermelon.

RNA silencing, a core part of plants' antiviral defence, requires the ARGONAUTE, DICER-like, and RNA-dependent RNA polymerase proteins. However, how these proteins contribute to watermelon's RNA interference (RNAi) pathway response to cucumber green mottle mosaic virus (CGMMV) has not been characterized. Here, we identifyseven ClAGO, four ClDCL, and 11 ClRDR genes in watermelon and analyse their expression profiles when infected with CGMMV. ClAGO1 and ClAGO5 expression levels were highly induced by CGMMV infection. The results of ClAGO1 and ClAGO5 overexpression and silencing experiments suggest that these genes play central roles in watermelon's antiviral defence. Furthermore, co-immunoprecipitation and bimolecular fluorescence complementation experiments showed that ClAGO1 interacts with ClAGO5 in vivo, suggesting that ClAGO1 and ClAGO5 co-regulate watermelon defence against CGMMV infection. We also identified the ethylene response factor (ERF) binding site in the promoters of the ClAGO1 and ClAGO5 genes, and ethylene (ETH) treatment significantly increased ClAGO5 expression. Two ERF genes (Cla97C08G147180 and Cla97C06G122830) closely related to ClAGO5 expression were identified using co-expression analysis. Subcellular localization revealed that two ERFs and ClAGO5 predominantly localize at the nucleus, suggesting that enhancement of resistance to CGMMV by ETH is probably achieved through ClAGO5 but not ClAGO1. Our findings reveal aspects of the mechanisms underlying RNA silencing in watermelon against CGMMV.

Genome-wide analysis of key gene families in RNA silencing and their responses to biotic and drought stresses in adzuki bean

BackgroundIn plants, RNA silencing is an important conserved mechanism to regulate gene expression and combat against abiotic and biotic stresses. Dicer-like (DCL) and Argonaute (AGO) proteins and RNA-dependent RNA polymerase (RDR) are the core elements involved in gene silencing and their gene families have been explored in many plants. However, these genes and their responses to stresses have not yet been well characterized in adzuki bean.ResultsA total of 11 AGO, 7 DCL and 6 RDR proteins were identified, and phylogenetic analyses of these proteins showed that they clustered into six, four and four clades respectively. The expression patterns of these genes in susceptible or resistant adzuki bean cultivars challenged with drought, bean common mosaic virus and Podosphaera xanthii infections were further validated by quantitative RT-PCR. The different responses of these proteins under abiotic and biotic stresses indicated their specialized regulatory mechanisms.ConclusionsIn this study, 24 genes of the DCL, AGO and RDR gene families in adzuki bean were identified, and the sequence characterization, structure of the encoded proteins, evolutionary relationship with orthologues in other legumes and gene expression patterns under drought and biotic stresses were primarily explored, which enriched our understanding of these genes in adzuki bean. Our findings provide a foundation for the comparative genomic analyses of RNA silencing elements in legume plants and further new insights into the functional complexity of RNA silencing in the response to various stresses in adzuki bean.