RL95-2 Cells Research Articles

The Expression and Activation of Cytochrome P450 1A1 in Endometrial Carcinoma Cells Are Involved in Benzo[a]Pyrene-Induced Cytotoxicity

Benzo[a]pyrene (B[a]P) is a member of the polycyclic aromatic hydrocarbons, compounds that are found in combustion products such as cigarette smoke and diesel exhaust and thought to be carcinogens capable of tumor initiation, promotion, and progression. B[a]P binds to the aryl hydrocarbon receptor (AhR) as a ligand and induces the expression of cytochrome P4501A1 (CYP1A1). Subsequently, B[a]P is metabolized by CYP1A1 to 7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE), which can eventually induce mutations or oxidative DNA damage. Research study In the present study, B[a]P has been exposed to endometrial adenocarcinoma cells (RL95-2) to investigate the potential cytotoxicological role of B[a]P in this cell type. The cells were cultured for 72 hrs in the medium containing 10% fetal bovine serum, and the various concentrations (0.01-100 uM) of B[a]P treatment revealed that significant cellular changes occurred from at 10 uM B[a]P during the treatment. B[a]P treatment caused increase of S phase in cell cycle and also reduced cell viability. Importantly, CYP1A1 protein and its activity were significantly elevated after B[a]P exposure, which indicates that B[a]P can be potentially converted into more cytotoxic forms (i.e., BPDE) in RL95-2 cells. The CYP1A1 was also localized in the cells by immunocytochemistry to confirm the protein expression in cellular level. Finally, α-naphtoflavone, a inhibitor of CYP1A1, treatment with B[a]P completely abolished the effect of B[a]P in the cells. These results suggest that B[a]P might be able to transduce its signal on endometrial cells by CYP1A1 activation.

Molecular mechanisms in uterine epithelium during trophoblast binding: the role of small GTPase RhoA in human uterine Ishikawa cells

BackgroundEmbryo implantation requires that uterine epithelium develops competence to bind trophoblast to its apical (free) poles. This essential element of uterine receptivity seems to depend on a destabilisation of the apico-basal polarity of endometrial epithelium. Accordingly, a reorganisation of the actin cytoskeleton regulated by the small GTPase RhoA plays an important role in human uterine epithelial RL95-2 cells for binding of human trophoblastoid JAR cells. We now obtained new insight into trophoblast binding using human uterine epithelial Ishikawa cells.MethodsPolarity of Ishikawa cells was investigated by electron microscopy, apical adhesiveness was tested by adhesion assay. Analyses of subcellular distribution of filamentous actin (F-actin) and RhoA in apical and basal cell poles were performed by confocal laser scanning microscopy (CLSM) with and without binding of JAR spheroids as well as with and without inhibition of small Rho GTPases by Clostridium difficile toxin A (toxin A). In the latter case, subcellular distribution of RhoA was additionally investigated by Western blotting.ResultsIshikawa cells express apical adhesiveness for JAR spheroids and moderate apico-basal polarity. Without contact to JAR spheroids, significantly higher signalling intensities of F-actin and RhoA were found at the basal as compared to the apical poles in Ishikawa cells. RhoA was equally distributed between the membrane fraction and the cytosol fraction. Levels of F-actin and RhoA signals became equalised in the apical and basal regions upon contact to JAR spheroids. After inhibition of Rho GTPases, Ishikawa cells remained adhesive for JAR spheroids, the gradient of fluorescence signals of F-actin and RhoA was maintained while the amount of RhoA was reduced in the cytosolic fraction with a comparable increase in the membrane fraction.ConclusionIshikawa cells respond to JAR contact as well as to treatment with toxin A with rearrangement of F-actin and small GTPase RhoA but seem to be able to modify signalling pathways in a way not elucidated so far in endometrial cells. This ability may be linked to the degree of polar organisation observed in Ishikawa cells indicating an essential role of cell phenotype modification in apical adhesiveness of uterine epithelium for trophoblast in vivo.

Inhibition of AKT survival pathway by a small molecule inhibitor in human endometrial cancer cells

The PTEN (phosphatase and tensin homolog deleted on chromosome 10) tumour suppressor is mutated in 40–50% of human endometrial cancers. PTEN exerts its effects in part via inhibition of the antiapoptotic protein AKT. We demonstrate that two endometrial cancer cell lines that harbour PTEN mutations, Ishikawa and RL95-2, have high levels of phosphorylated AKT and high AKT kinase activity. Two additional endometrial cancer cell lines that express wild-type PTEN, Hec1A and KLE, have little phosphorylated AKT and minimal demonstrable AKT kinase activity. We tested a potential inhibitor of the AKT pathway, API-59CJ-OMe, in these four cell lines. We found that API-59CJ-OMe inhibits AKT kinase activity and induces apoptosis in the Ishikawa and RL95-2 cell lines with high AKT activity, but has little effect on Hec1A and KLE cells without AKT activity. API-59CJ-OMe may therefore have therapeutic potential for those endometrial cancers that harbour PTEN mutations and AKT activation.

Expression of Toll-like receptors in human endometrial epithelial cells and cell lines.

Are toll-like receptors (TLRs) expressed by human endometrium and endometrial cell lines? Expression of each TLR mRNA species was determined by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of proliferative-phase human endometrium, separated endometrial epithelial cells, and the Ishikawa and RL95-2 endometrial epithelial cell lines. U-937 and SKW 6.4 cell lines were used as positive controls. Functional relevance of PCR findings was tested by enzyme-linked immunsorbent assay (ELISA)analysis of IL-8 production after stimulating cell lines with ligands for TLR2-5. TLR1-6 and 9 mRNA species were detected in both whole endometrium and separated endometrial epithelial cells. Ishikawa cells expressed TLR2 and TLR5, while RL95-2 cells expressed TLR3, 5, and 9. Response of RL95-2, Ishikawa, and U-937 cells to TLR2-5 ligands was consistent with RT-PCR findings except response to flagellin by Ishikawa cells. These studies provide the first evidence of TLR expression in the endometrium of any species and suggest the usefulness of endometrial cell lines to study TLR function.

HGF and ligation of αvβ5 integrin induce a novel, cancer cell-specific gene expression required for cell scattering

Hepatocyte growth factor (HGF), a cytokine involved in tumorigenesis and most metastases, initiates cell migration by binding to the protooncogene c-Met receptor. In epithelial carcinoma cells, c-Met activation causes the breakdown of E-cadherin cell–cell contacts leading to cell spreading. While the breakdown of E-cadherin contacts is immediate, HGF-induced migration requires transcription. To test the hypothesis that this de novo mRNA synthesis includes cancer cell-specific transcripts, we performed subtraction hybridization to isolate HGF-induced transcripts from an endometrial epithelial carcinoma cell line, RL95-2 (RL95), known to migrate but not to proliferate with HGF treatment. One novel cDNA we call Mig-7 is induced by HGF in endometrial epithelial carcinoma cell lines RL95 and HEC-1A before migration ensues. Ovarian, oral squamous cell, and colon metastatic tumors but not normal tissues express Mig-7. HGF did not induce Mig-7 in normal primary endometrial epithelial cells. In addition, blocking antibodies to αvβ5 integrin inhibited HGF induction of Mig-7 in RL95 cells. Most importantly, Mig-7-specific antisense oligonucleotides inhibited scattering of RL95 cells in vitro. These results are the first to demonstrate that Mig-7 expression may be used as a cancer cell-specific target to inhibit cell scattering.

An intronic alternative promoter of the human lactoferrin gene is activated by Ets

Lactoferrin expresses in a variety of tissues and involves in various aspects of host defense mechanisms. The lactoferrin gene is differentially regulated through multiple signaling pathways. Recently, an alternative form of human lactoferrin mRNA (ΔLF) was found in normal human tissues but absent from the tumor cells. In this study, we identified the transcription start sites of the ΔLF in mammary gland and bone marrow and demonstrated that the ΔLF is the product of an alternative (P2) promoter present in the first intron of the lactoferrin gene. The P2 promoter has high activity in Jurkat and U937 and low activity in RL95-2 and HEC-1B cell lines. Nonetheless, the promoter activity in HEC-1B cells was dramatically enhanced with overexpression of the Ets-1 transcription factor. The GFP-tagged lactoferrin is present in the cytoplasm whereas GFP-tagged ΔLF is found in both nucleus and cytoplasm as examined by fluorescence and confocal microscopy.

Human Uterine Epithelial RL95-2 Cells Reorganize Their Cytoplasmic Architecture with Respect to Rho Protein and F-Actin in Response to Trophoblast Binding

Embryo implantation is initiated by interaction of trophoblast with uterine epithelium via the apical cell poles of both partners. Using spheroids of human trophoblastoid JAR cells and monolayers of human uterine epithelial RL95-2 cells to simulate this initial interaction, we previously demonstrated that formation of stable cell-to-cell bonds depends on actin cytoskeleton (F-actin) and small GTPases of the Rho family, most likely RhoA. In this study, we determined the apical as well as the basal distribution of these proteins by fluorescence confocal microscopy before and after binding of JAR spheroids. We focussed on changes in cytoplasmic organization with respect to apicobasal polarity of RL95-2 cells. Before binding of spheroids, significantly higher fluorescence signals of RhoA [37 ± 6 grey scale values (gsv)] and of F-actin (41 ± 3 gsv) were found in the basal region of RL95-2 cells as compared to the apical pole (RhoA: 24 ± 3 gsv, F-actin: 28 ± 2 gsv). After binding of JAR spheroids, this apicobasal asymmetry was inverted (RhoA: 55 ± 10 gsv apical vs. 25 ± 3 gsv basal; F-actin: 108 ± 17 gsv apical vs. 57 ± 7 gsv basal). Inactivation of Rho GTPases in RL95-2 cells by Clostridium difficile toxin A leads to a loss of their apical adhesion competence, as previously published. Here, we observed a uniform distribution of RhoA and F-actin between apical and basal region rather than an asymmetric one in toxin A-treated cells. These data suggest that activation of Rho GTPases and coordinated rearrangement of F-actin within uterine epithelial cells in response to trophoblast binding are part of a generalized structural and functional reorganization of the cytoplasm. This involves not only the immediate contact zone (apical) but also the opposite (basal) cell pole and may be a critical element of uterine epithelial reactions during transition between trophoblast adhesion and transmigration.

Adhesiveness of human uterine epithelial RL95-2 cells to trophoblast: rho protein regulation.

Embryo implantation involves adhesion of trophoblast cells to the epithelial lining of the endometrium. Using an in-vitro model to simulate this initial interaction, we previously reported that attachment of human trophoblast-like JAR spheroids to human uterine epithelial RL95-2 cells provokes a Ca(2+) influx in RL95-2 cells depending on apically localized integrin receptors. Here, we demonstrate that adhesiveness of RL95-2 cells for JAR spheroids, measured by a centrifugal force-based adhesion assay, is dependent on Rho GTPases, most likely RhoA. Cellular expression and distribution of RhoA were studied by fluorescence confocal microscopy, focusing on the localization of RhoA and F-actin within the adhesion sites between JAR and RL95-2 cells. Contact areas contained high amounts of RhoA and F-actin fibres near the plasma membrane. To determine whether Rho GTPases may influence JAR cell binding, we treated RL95-2 cells with Clostridium difficile toxin A, which specifically inactivates Rho GTPases. Toxin A treatment changed the subcellular distribution of endogenous RhoA in RL95-2 cells and altered RhoA and F-actin colocalization. Adhesion of JAR spheroids to RL95-2 cells treated with toxin A was largely suppressed. These data indicate that Rho GTPases, most likely RhoA, play an important role in uterine epithelial RL95-2 cells for trophoblast binding, and suggest that RhoA may be involved in local signalling cascades during early embryo implantation in vivo.

Benzo(a)pyrene exposure induces CYP1A1 activity and expression in human endometrial cells

Estrogen is a major risk factor for endometrial cancer and it has been well-established that smokers have a significantly reduced risk of endometrial cancer. Localized levels of estrogen within the uterus may determine the estrogenic response. The objective of this research was to investigate effects of cigarette smoke related hydrocarbons (benzo(a)pyrene, BP) on uterine CYP1A1/2 and 1B1, enzymes involved in estrogen metabolism. Human endometrium epithelial cells (RL95-2) were incubated with various concentrations (0.05, 0.1, 0.5, 1, and 10 mM) of BP for 48 h. CYP1 catalytic activity, protein and mRNA levels were determined. Selective chemical and immuno-inhibitors were used to determine the contribution of individual CYP1 isoenzymes. Cells expressing CYP1A1, CYP1A2 and CYP1B1 were used for comparisons. CYP1A1/2 protein and mRNA levels were significantly elevated by BP. Low level of constitutive CYP1 activity was observed in RL95-2 cells, which was significantly induced by BP exposure (12-fold at 1 mM). CYP1 activity in BP-induced cells was significantly inhibited by specific anti-CYP1A1 and high concentration of α-naphthoflavone (ANF, 100 nM), but not by selective CYP1A2 (furafylline) and CYP1B1 (homoeriodictoyl) inhibitors and low concentration of ANF (5 nM). These studies suggest that CYP1A2 and CYP1B1 are not induced by BP in the endometrial cells. It also appears that CYP1A1 is one of the major CYP450 enzymes induced by BP.

Benzo( a)pyrene, but not 2,3,7,8-tetrachlorodibenzo- p-dioxin, alters cell adhesion proteins in human uterine RL95-2 cells

This study compared the effects of benzo( a)pyrene (BaP) and 2,3,7,8-tetrachlorodibenzo- p-dioxin (TCDD), two aryl hydrocarbon receptor agonists, on cell attachment and adherens junction proteins in RL95-2 human uterine endometrial cells. Exposure to 10 μ M BaP significantly decreased cell attachment to Matrigel, whereas 10 nM TCDD had no effect. Immunocytochemistry and Western immunoblot analysis showed that BaP, but not TCDD, produced a marked loss of plasma membrane epidermal growth factor receptor (EGF-R) localized along intercellular boundaries. BaP-treated cells exhibited significant decreases in β-catenin and cadherin protein levels, while vinculin levels remained unchanged relative to control. In contrast, TCDD treatment had no effect on the levels of β-catenin, cadherin, or vinculin. Further studies using the fluorescein labeled peptide phalloidin showed the presence of continuous subcortical actin filaments in control cells, whereas BaP-treated cells had subcortical actin aggregates. Thus, in contrast to TCDD, BaP produces a loss of cell attachment involving decreased localization of molecules important for cell–cell interactions in RL95-2 cells.

Calcium influx in human uterine epithelial RL95-2 cells triggers adhesiveness for trophoblast-like cells. Model studies on signalling events during embryo implantation.

RL95-2 is a human uterine epithelial cell line that exhibits adhesion competence on its apical surface for trophoblast-like JAR cells. Using confocal microscopy and an adhesion assay we have found that changes in intracellular free calcium ([Ca(2+)](i)) in RL95-2 cells are involved in binding of JAR spheroids. Impact of spheroids upon, and movement of spheroids across, monolayers of RL95-2 cells produced a transient increase in [Ca(2+)](i). Pretreatment of RL95-2 cells with the Ca(2+) channel inhibitor, diltiazem, reduced the [Ca(2+)](i) increase. Interestingly, resting of JAR spheroids on RL95-2 cells caused no detectable alterations in [Ca(2+)](i) although cell-cell bonds were formed during prolonged contact. However, separation of established bonds did produce an increase in [Ca(2+)](i) which could be reduced by the Ca(2+) channel blocker, SKF-96365, but not by diltiazem. SKF-96365 also reduced adhesion of JAR spheroids to RL95-2 cells. In all experiments, the increase in [Ca(2+)](i) was due to influx from the external medium, as it could be blocked both by removing extracellular Ca(2+) and by nickel. These results suggest that the plasma membrane of uterine RL95-2 cells contains two types of Ca(2+) channels that are involved in trophoblast adhesion, i.e. diltiazem-sensitive channels contributing to initiation of JAR cell binding and SKF-96365-sensitive channels participating in a feedback loop that controls the balance of bonds.

Increased Adhesiveness in Cultured Endometrial-Derived Cells Is Related to the Absence of Moesin Expression1

Human endometrial epithelial cells (EECs) are nonadhesive for embryos throughout most of the menstrual cycle. During the so-called implantation window, the apical plasma membrane of EECs acquire adhesive properties by undergoing a series of morphological and biochemical changes. The human endometrial-derived epithelial cell line, RL95-2, serves as an in vitro model for receptive uterine epithelium because of its high adhesiveness for trophoblast-derived cells. In contrast, the HEC-1-A cell line, which displays poor adhesive properties for trophoblast cells, is considered to be less receptive. The ezrin, radixin, and moesin protein family members, which are present underneath the apical plasma membrane, potentially act to link the cytoskeleton and membrane proteins. In the present study, we have further investigated the adhesive features in these two unrelated endometrial-derived cell lines using an established in vitro model for embryonic adhesion. We have also analyzed the protein pattern and mRNA expression of ezrin and moesin in RL95-2 cells versus HEC-1-A cells. The results demonstrate that RL95-2 cells were indeed more receptive (81% blastocyst adhesion) compared with HEC-1-A cells (46% blastocyst adhesion). An intermediate adhesion rate was found in primary EECs cultured on extracellular matrix gel, thus allowing a partial polarization of these cells (67% blastocyst adhesion). Furthermore, we found that moesin was absent from RL95-2 cells. In contrast, ezrin is expressed in both cell lines, yet it is reduced in adherent RL95-2 cells. Data are in agreement with the hypothesis that uterine receptivity requires down-regulation or absence of moesin, which is a less-polarized actin cytoskeleton.

Adhesion of trophoblast to uterine epithelium as related to the state of trophoblast differentiation: In vitro studies using cell lines

At the initial phase of embryo implantation, the trophoblast must have acquired competence for adhesion to the uterine epithelium, a condition whose cell biological basis is far from understood. In the present study, trophoblast-type cells (BeWo, JAr, and Jeg-3 choriocarcinoma cell lines) were treated with retinoic acid, methotrexate, dibutyryl-cAMP, or phorbol-12-myristate-13-acetate in order to modulate their ability to adhere to uterine epithelial cells (RL95-2). In an established model, multicellular spheroids of choriocarcinoma cells were transferred onto the surface of monolayer cultures of RL95-2 cells followed by a centrifugal force-based adhesion assay. In controls, about 45% of BeWo and JAr cell spheroids and 75% of Jeg-3 spheroids adhered to uterine monolayers within 30 min. Pretreatment of spheroids with either of the agents stimulated differentiation as indicated by the rate of chorionic gonadotropin secretion, but consistently reduced the adhesion to the endometrial monolayer in all three choriocarcinoma cell lines. While previous investigations had shown that invasiveness of trophoblast cells (into extracellular matrix) does not seem to be linked to the differentiation program in a simple manner, the present data suggest that such an (inverse) link may indeed exist with respect to the ability to initiate an adhesive interaction with the uterine epithelium. These observations support the view that epithelial cell interactions as typical for the initial phase of embryo implantation are regulated in a way that is clearly different from cell–matrix interactions governing later phases of trophoblast invasion into the endometrial stroma Mol. Reprod. Dev. 57:135–145, 2000. © 2000 Wiley-Liss, Inc.

Comparative Effects of 2,3,7,8-Tetrachlorodibenzo-p-dioxin on MCF-7, RL95-2, and LNCaP Cells: Role of Target Steroid Hormones in Cellular Responsiveness to CYP1A1 Induction

A study was conducted to investigate whether target hormones affect 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible gene expression, using as an experimental model system three human cancer cell lines, breast (MCF-7), uterine (RL95-2), and prostate (LNCaP). Exposure to TCDD induced the CYP1A1 gene in all three cell lines. MCF-7 and RL95-2 cells showed more than 15- and 10-fold induction of EROD (7-ethoxyresorufin O-deethylase) activity, respectively, compared with the less responsive LNCaP cells. Surprisingly, however, TCDD-induced reporter gene activity driven by a single XRE element was similar in RL95-2 and LNCaP cells. The steady-state levels of expression of aryl hydrocarbon receptor (AhR) and aryl hydrocarbon receptor nuclear translocator (ARNT) were similar in all three cell lines. Expression of the CYP1B1 and PAI-2 genes was induced by TCDD in MCF-7 and RL95-2, but not in LNCaP, cells. Transient coexpression of estradiol receptor-α (ER-α) with a TCDD-responsive reporter plasmid and subsequent TCDD treatment increased responsiveness to TCDD in RL95-2 and LNCaP cells. Treatment with AZA-C, a DNA methyltransferase inhibitor, enhanced responsiveness to TCDD, in terms of EROD activity in LNCaP cells, but not in MCF-7 and RL95-2 cells, suggesting that DNA methylation in the CpG dinucleotide within the XRE core sequence is another factor involved in silencing of CYP1A1 in LNCaP cells. TCDD markedly inhibited E2- or testosterone-induced reporter gene activities in all three cell lines. Conversely, these target hormones inhibited TCDD-induced EROD activity in the three cell lines. These findings suggest that TCDD and the target steroid hormones negatively regulate each other's activity.

Anti-CD9 monoclonal antibody-stimulated invasion of endometrial cancer cell lines in vitro: possible inhibitory effect of CD9 in endometrial cancer invasion.

Cell surface marker CD9 has been reported to play a role in inhibiting trophoblastic cell invasion. Since the invasive properties of cancer cells may resemble those of trophoblasts, we decided to investigate the role of CD9 in the invasion of endometrial cancer cells. In normal human endometrium, CD9 was found to be constitutively expressed on epithelial cells, as reported previously. While epithelial cells of endometrial hyperplasia (n = 5) were also positive for the expression of CD9, endometrial adenocarcinomas (n = 15) showed reduced expression. In order to clarify the significance of this reduced CD9 expression in endometrial cancer, an in-vitro invasion assay system was used to assess the effect of anti-CD9 monoclonal antibody (mAb) on the invasive properties of endometrial cancer cell line. Anti-CD9 mAb significantly enhanced invasion of the RL95-2 and Ishikawa cell lines, without affecting cell proliferation. Since CD9 is associated with the integrin subunits beta(1), alpha(3) and alpha(6) in human endometrium, we investigated the functional relationship between CD9 and these integrins in the RL95-2 cell line. Monoclonal antibodies against the integrins beta(1), alpha(3) and alpha(6) inhibited RL95-2 cell invasion. However, anti-CD9 mAb continued to show a stimulatory effect on RL95-2 cell invasion after treatment with anti-integrin alpha(3) mAb. In contrast, the anti-CD9 mAb had no effect after treatment with the mAb for integrins alpha(6) and beta(1). These findings indicate that CD9 is involved in regulating the invasive properties of endometrial carcinoma cells and that this effect is partially mediated by integrin subunits alpha(6) and beta(1). Thus, CD9 appears to be involved in the prevention of endometrial cancer invasion.

Retinoic Acid Affects the EGF-R Signaling Pathway during Differentiation Induction of Human Endometrial Adenocarcinoma Cells

We have shown that moderately differentiated endometrial adenocarcinoma (RL95-2) cells differentiate in response to retinoic acid treatment, illustrated by their reorganization of actin filaments and cell enlargement (Carter et al., Anticancer Res.16, 17–24, 1996). Tyrphostin, an inhibitor of epidermal growth factor receptor (EGF-R)-associated protein tyrosine kinases, caused a dramatic reorganization of actin filaments in RL95-2 cells, similar to retinoic-acid-treated cells (Carter and Bellido, J. Cell. Physiol.178, 320–332, 1999). We evaluated the possibility that the differentiating effects of retinoids are due to retinoic-acid-induced decreases in phosphorylation of EGF-R and changes in downstream effector proteins. Retinoic acid caused a decrease in tyrosine phosphorylation of EGF-R. Retinoic acid treatment induced a dramatic actin filament reorganization and cell enlargement. Treatment with EGF reversed this effect, because cells treated with retinoic acid followed by EGF only possessed disrupted actin aggregates and appeared small, thus resembling medium controls. Retinoic acid induced a relocalization and decrease in the amount of Shc protein, another actin-binding protein which is an adaptor protein for EGF-R signaling. In addition, retinoic acid induced a relocalization of gelsolin from the plasma membrane to the cytoplasm. Retinoic acid decreased cell detachment in detachment assays; one-half as many retinoic-acid-treated cells detached as in controls. These results are consistent with the idea that retinoic acid induces differentiation of RL95-2 cells by interfering with the EGF-R signaling pathway.

Adhesion of trophoblast to uterine epithelium as related to the state of trophoblast differentiation: in vitro studies using cell lines.

At the initial phase of embryo implantation, the trophoblast must have acquired competence for adhesion to the uterine epithelium, a condition whose cell biological basis is far from understood. In the present study, trophoblast-type cells (BeWo, JAr, and Jeg-3 choriocarcinoma cell lines) were treated with retinoic acid, methotrexate, dibutyryl-cAMP, or phorbol-12-myristate-13-acetate in order to modulate their ability to adhere to uterine epithelial cells (RL95-2). In an established model, multicellular spheroids of choriocarcinoma cells were transferred onto the surface of monolayer cultures of RL95-2 cells followed by a centrifugal force-based adhesion assay. In controls, about 45% of BeWo and JAr cell spheroids and 75% of Jeg-3 spheroids adhered to uterine monolayers within 30 min. Pretreatment of spheroids with either of the agents stimulated differentiation as indicated by the rate of chorionic gonadotropin secretion, but consistently reduced the adhesion to the endometrial monolayer in all three choriocarcinoma cell lines. While previous investigations had shown that invasiveness of trophoblast cells (into extracellular matrix) does not seem to be linked to the differentiation program in a simple manner, the present data suggest that such an (inverse) link may indeed exist with respect to the ability to initiate an adhesive interaction with the uterine epithelium. These observations support the view that epithelial cell interactions as typical for the initial phase of embryo implantation are regulated in a way that is clearly different from cell-matrix interactions governing later phases of trophoblast invasion into the endometrial stroma.

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

Role of Estradiol Receptor-α in Differential Expression of 2,3,7,8-Tetrachlorodibenzo-p-dioxin-Inducible Genes in the RL95-2 and KLE Human Endometrial Cancer Cell Lines

The present study was conducted to investigate the mechanism of the response of human uterine endometrial carcinoma cells, RL95-2 and KLE, to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). RL95-2 cells were highly responsive to TCDD in terms of cytochrome P4501A1 (CYP1A1), cytochrome P4501B1 (CYP1B1), and plasminogen activator inhibitor-2 (PAI-2), whereas KLE cells showed little stimulatory effects only at high doses. Neither showed any growth inhibition upon exposure to TCDD. KLE cells expressed higher levels of aryl hydrocarbon receptor (AhR) than RL95-2 and gel mobility shift assay also identified more liganded AhR–ARNT complex bound to xenobiotic response elements (XRE). TCDD had no downregulatory effects on the expression of either AhR or the estradiol receptor (ER). Though both cell types expressed ER-α almost equally, immunofluorescence demonstrated a defect in its nuclear translocation in KLE cells where ER-α was mainly cytoplasmic and estradiol-17β (E2) was unable to translocate it to the nucleus. However, both cells were nonresponsive to E2 in terms of transcriptional activation and transient expression of normal ER-α restored the E2 responsiveness. Transient expression of ER-α in KLE cells also restored its responsiveness to TCDD on transcriptional activation. Collectively, these results indicate that ER-α acts as a positive modulator in regulation of the TCDD-inducible genes.

Decrease in protein tyrosine phosphorylation is associated with F-actin reorganization by retinoic acid in human endometrial adenocarcinoma (RL95-2) cells.

Transformed cells often express elevated levels of tyrosine-phosphorylated proteins. Inhibition of protein tyrosine kinases causes reversion of malignant cells to the normal phenotype. In the present study, we evaluated the possibility that the reversion of human endometrial adenocarcinoma RL95-2 cells to a stationary phenotype induced by retinoic acid was associated with inhibition of tyrosine phosphorylation of cellular proteins. We found that retinoic acid decreased the levels of tyrosine-phosphorylated proteins, as assessed by immunostaining and immunoprecipitations using specific anti-phosphotyrosine antibodies. In addition, the inhibitors of tyrosine kinases herbimycin A and tyrphostin mimicked retinoic acid, inducing F-actin reorganization and increasing the size of RL95-2 cells, as determined by measurement of cell perimeters. Because focal adhesions that connect actin filaments with the plasma membrane are major sites of tyrosine phosphorylation, we further investigated whether selected focal adhesion proteins were affected by retinoic acid. We found that retinoic acid altered the localization of focal adhesion kinase. All-trans retinoic acid was effective in reducing the levels of focal adhesion kinase and paxillin protein. Thirteen-cis retinoic acid increased the levels of vinculin protein in the cytosolic fraction of cells. These changes are consistent with actin reorganization and reversion toward a stationary phenotype induced by retinoic acid in endometrial adenocarcinoma RL95-2 cells. Our results indicate that the differentiating effects of retinoids on endometrial cells are associated with decreases in tyrosine phosphorylation and changes in the levels and distribution of focal adhesion proteins. These findings suggest that signaling pathways that involve tyrosine kinases are potential targets for drug design against endometrial cancer.