Retarded Band Research Articles

Highly chromatic retardation via multi-twist liquid crystal films

Here we study birefringent films with highly customizable chromatic retardation spectra, using multi-twist liquid crystal (LC) films. These are made of two or more layers of chiral nematic LC polymer network materials, also known as reactive mesogens, which form a monolithic thin-film wherein the in-plane orientation of subsequent layers is automatically determined by the single alignment layer on the substrate. The multiple layer thicknesses and twists present many degrees of freedom to tailor the retardation. While prior work examined achromatic spectra, here we show how to use Mueller matrix analysis to create highly chromatic spectra. We experimentally demonstrate both a uniformly aligned retarder as a green/magenta color filter and a “hot” polarization grating (PG) that diffracts infrared while passing visible light. The three-twist color filter shows a contrast ratio in transmittance between polarizers as high as 10:1 between the half- and zero-wave retardation bands. The “hot” PG shows an average first-order efficiency of about 90% for 1000–2700 nm and an average zero-order efficiency of about 90% for 500–900 nm. The principles here can be extended to nearly any chromatic retardation spectra, including high/low/bandpass, and to nearly any LC orientation pattern, in general known as geometric-phase holograms.

Phosphate effect on filipin production and morphological differentiation in Streptomyces filipinensis and the role of the PhoP transcription factor.

The biosynthesis of the antifungal filipin in Streptomyces filipinensis is very sensitive to phosphate regulation. Concentrations as low as 2.5 mM block filipin production. This effect is, at least in part, produced by repression of the transcription of most filipin biosynthetic genes. The role of the two-component PhoRP system in this process was investigated. The phoRP system of S. filipinensis was cloned and transcriptionally characterised. PhoP binds to two PHO boxes present in one of its two promoters. Filipin production was greatly increased in ΔphoP and ΔphoRP mutants, in agreement with a higher transcription of the fil genes, and the effect of phosphate repression on the antibiotic production of these strains was significantly reduced. No PhoP binding was observed by electrophoretic mobility gel shift assays (EMSAs) with the promoter regions of the fil gene cluster thus suggesting an indirect effect of mutations. Binding assays with cell-free extracts from the wild-type and mutant strains on fil genes promoters revealed retardation bands in the parental strain that were absent in the mutants, thus suggesting that binding of the putative transcriptional regulator or regulators controlled by PhoP was PhoP dependent. Noteworthy, PhoP or PhoRP deletion also produced a dramatic decrease in sporulation ability, thus indicating a clear relationship between the phosphate starvation response mediated by PhoP and the sporulation process in S. filipinensis. This effect was overcome upon gene complementation, but also by phosphate addition, thus suggesting that alternative pathways take control in the absence of PhoRP.

Regulation of serine protease inhibitor Kazal type-5 (SPINK5) gene expression in the keratinocytes.

ObjectivesSerine protease inhibitor Kazal type-5 (SPINK5) plays a crucial role in deciding the timing of desquamation of the skin. Its gene expression is limited at the very surface of the stratum granulosum (SG), whereas expression of kallikreins (KLKs) encoding proteases is usually found throughout the stratum spinosum and SG.MethodsTo explore the difference in expression regulation of these proteases/inhibitors, the function of SPINK5 promoter was examined using luciferase assay.ResultsLuciferase assay targeting the SPINK5 promoters (nucleotide −676/−532 and −318/−146 from the major transcription start site) showed high intensity in NHEK human keratinocyte. These two sites had neither common cis-elements nor GATA3 element but electrophoretic mobility shift assay showed similar retardation bands. Moreover, DNA footprinting did not display specific protected bands. Thus, we could not identify cis-element(s) that controlled these elements. Differentiation induced by high Ca2+ medium failed to alter their luciferase activities. Transfection of GATA3 expressing vector significantly but slightly increased them and that of vector expressing its dominant negative form decreased.ConclusionsAlthough GATA3 is reportedly important for inhibition of proliferation and induction of differentiation of keratinocytes, its effect on SPINK5 expression was indirect and GATA3 alone was insufficient for final differentiation of keratinocytes where full SPINK5 expression was observed.

Structure–function analysis of the SaPIbov1 replication origin in Staphylococcus aureus

The SaPIs and their relatives are phage satellites and are unique among the known bacterial pathogenicity islands in their ability to replicate autonomously. They possess a phage-like replicon, which is organized as two sets of iterons arrayed symmetrically to flank an AT-rich region that is driven to melt by the binding of a SaPI-specific initiator (Rep) to the flanking iterons. Extensive deletion analysis has revealed that Rep can bind to a single iteron, generating a simple shift in a gel mobility assay; when bound on both sides, a second retarded band is seen, suggesting independent binding. Binding to both sites of the ori is necessary but not sufficient to melt the AT-rich region and initiate replication. For these processes, virtually the entire origin must be present. Since SaPI replication can be initiated on linear DNA, it is suggested that bilateral binding may be necessary to constrain the intervening DNA to enable Rep-driven melting.

Folic acid‐conjugated depolymerized quaternized chitosan as potential targeted gene delivery vector

AbstractLigand‐conjugated delivery vectors that target over‐expressed cell surface receptors have a potential impact on gene therapy. In the study reported, high‐molecular‐weight chitosan was depolymerized to medium and low molecular weight and trimethylated to render the polymer soluble over a wider pH range. Folate conjugation was introduced to the quarternized derivative to improve gene transfection efficiency. Complexes of the folic acid‐conjugated trimethylated depolymerized chitosan (FTMC) with plasmid DNA (pDNA) formed core–shell nanostructured particles. Gel electrophoretic band retardation showed efficient condensation of DNA. These derivatives and their complexes with pDNA were tested for toxicity and haemocompatibility and were found to be significantly less toxic and haemocompatible than polyethyleneimine. Transfection efficiency and nuclear uptake properties were tested in the human KB oral epidermoid cell line, which over‐expresses the folate receptor in the presence of 10% serum. Among the four FTMC derivatives investigated, folic acid‐conjugated chitosan having low molecular weight and medium folate conjugation was found to be a potential vector for gene delivery applications with good transfection and nuclear uptake properties, as proved by YOYO labelling of pDNA. Copyright © 2011 Society of Chemical Industry

An NPC1L1 gene promoter variant is associated with autosomal dominant hypercholesterolemia

Background and aims A substantial number of subjects with autosomal dominant hypercholesterolemia (ADH) do not have LDL receptor (LDLR) or apolipoprotein B (APOB) mutations. Some ADH subjects appear to hyperabsorb sterols from the intestine, thus we hypothesized that they could have variants of the Niemann–Pick C1-Like 1 gene (NPC1L1). NPC1L1 encodes a crucial protein involved in intestinal sterol absorption. Methods and results Four NPC1L1 variants (−133A>G, −18C>A, 1679C>G, 28650A>G) were analyzed in 271 (155 women and 116 men) ADH bearers without mutations in LDLR or APOB aged 30–70 years and 274 (180 women and 94 men) control subjects aged 25–65 years. The AC haplotype determined by the −133A>G and −18C>A variants was underrepresented in ADH subjects compared to controls ( p = 0.01). In the ADH group, cholesterol absorption/synthesis markers were significantly lower in AC homozygotes that in all others haplotypes. Electrophoretic mobility shift assay (EMSA) results revealed that the −133A-specific oligonucleotide produced a retarded band stronger than the −133G allele. Luciferase activity with NPC1L1 −133G variant was 2.5-fold higher than with the −133A variant. Conclusion The −133A>G polymorphism exerts a significant effect on NPC1L1 promoter activity. NPC1L1 promoter variants might explain in part the hypercholesterolemic phenotype of some subjects with nonLDLR/nonAPOB ADH.

The Central Region of BRCA1 Binds Preferentially to Supercoiled DNA

BRCA1 is a multifunctional tumor suppressor protein with implications in regulating processes such as cell cycle, transcription, DNA repair, and chromatin remodeling. The function of BRCA1 likely involves interactions with a vast number of proteins and likewise DNA. To this date there is only fragmentary evidence about BRCA1 binding to DNA. In this study, we provide detailed analyses of various BRCA1 protein constructs binding to linear and super-coiled (sc) DNAs. We demonstrate that the central region of human BRCA1 binds strongly to negatively sc plasmid DNA at a native superhelix density, as evidenced by electrophoretic retardation of sc DNA in agarose gels. At relatively low BRCA1:DNA ratios, binding of BRCA1 to sc DNA results in the appearance of one or more retarded DNA bands on the gels. After removal of BRCA1, the original mobility of the sc DNA is recovered. BRCA1 proteins at higher concentrations also bind to the same DNA but in linear state, leading to formation of a smeared retarded band. Our experiments not only demonstrate a preference for BRCA1 binding to sc DNA, but also show that the central region may contain at least two efficient DNA binding domains with strong affinity for sc DNA. The biological implications of the novel DNA binding activities of BRCA1 are discussed.

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Scleraxis and NFATc Regulate the Expression of the Pro-α1(I) Collagen Gene in Tendon Fibroblasts

The combinatorial action of separate cis-acting elements controls the cell-specific expression of type I collagen genes. In particular, we have shown that two short elements located between -3.2 and -2.3 kb and named TSE1 and TSE2 are needed for expression of the mouse COL1a1 gene in tendon fibroblasts. In this study, we analyzed the trans-acting factors binding to TSE1 and TSE2. Gel shift experiments showed that scleraxis (SCX), which is a basic helix-loop-helix transcription factor that is expressed selectively in tendon fibroblasts, binds TSE2, preferentially as a SCX/E47 heterodimer. In transfection experiments, overexpression of SCX and E47 strongly enhanced the activity of reporter constructs harboring either four copies of TSE2 cloned upstream of the COL1a1 minimal promoter or a 3.2-kb segment of the COL1a1 proximal promoter. Analysis of TSE1 showed that it contains a consensus binding site for NFATc transcription factors. This led us to show that the NFATc4 gene is expressed in tendons of developing mouse limbs and in TT-D6 cells, a cell line that has characteristics of tendon fibroblasts. In gel shift assays, TSE1 bound NFATc proteins present in nuclear extracts from TT-D6 cells. In transfection experiments, overexpression of NFATc transactivated a reporter construct harboring four copies of TSE1 cloned upstream of the COL1a1 minimal promoter. By contrast, inhibition of the nuclear translocation of NFATc proteins in TT-D6 cells strongly inhibited the expression of the COL1a1 gene. Taken together, these results suggest that SCX and NFATc4 cooperate to activate the COL1a1 gene specifically in tendon fibroblasts.

Analysis of the binding of the N-terminal conserved domain of yeast Cbf5p to a box H/ACA snoRNA

During ribosome biogenesis, the RNA precursor to mature rRNAs undergoes numerous post-transcriptional chemical modifications of bases, including conversions of uridines to pseudouridines. In archaea and eukaryotes, these conversions are performed by box H/ACA small ribonucleoprotein particles (box H/ACA RNPs), which contain a small guide RNA responsible for the selection of substrate uridines and four proteins, including the pseudouridine synthase, Cbf5p. So far, no in vitro reconstitution of eukaryotic box H/ACA RNPs from purified components has been achieved, principally due to difficulties in purifying recombinant eukaryotic Cbf5p. In this study, we present the purification of a truncated derivative of yeast Cbf5p (Cbf5(Delta)p) that retains the highly conserved TRUB and PUA domains. We have used band retardation assays to show that Cbf5(Delta)p on its own binds to box H/ACA small nucleolar (sno)RNAs. We demonstrate that the conserved H and ACA boxes enhance the affinity of the protein for the snoRNA. Furthermore, like its archaeal homologs, Cbf5(Delta)p can bind to a single stem-loop-box ACA RNA. Finally, we report the first enzymatic footprinting analysis of a Cbf5-RNA complex. Our results are compatible with the view that two molecules of Cbf5p interact with a binding platform constituted by the 5' end of the RNA, the single-stranded hinge domain containing the conserved H box, and the 3' end of the molecule, including the conserved ACA box.

Genetic Deletion of NAD(P)H:Quinone Oxidoreductase 1 Abrogates Activation of Nuclear Factor-κB, IκBα Kinase, c-Jun N-terminal Kinase, Akt, p38, and p44/42 Mitogen-activated Protein Kinases and Potentiates Apoptosis

The NAD(P)H:quinone oxidoreductase 1 (NQO1) is a phase II enzyme that reduces and detoxifies quinones and their derivatives. Although overexpressed in tumor cells, the NQO1 has been linked with the suppression of carcinogenesis, and the effect of NQO1 on tumor necrosis factor (TNF), a cytokine that mediates tumorigenesis through proliferation, invasion, angiogenesis, and metastasis of tumors, is currently unknown. The purpose of our study was to determine the role of NQO1 in TNF cell signaling by using keratinocytes derived from wild-type and NQO1 gene-deleted mice. TNF induced nuclear factor (NF)-kappaB activation in wild-type but not in NQO1-deleted cells. The treatment of wild-type cells with dicoumarol, a known inhibitor of NQO1, also abolished TNF-induced NF-kappaB activation. NF-kappaB activation induced by lipopolysaccharide, phorbol ester, and cigarette smoke, was also abolished in NQO1-deleted cells. The suppression of NF-kappaB activation was mediated through the inhibition of IkappaBalpha kinase activation, IkappaBalpha phosphorylation, and IkappaBalpha degradation. Further, the deletion of NQO1 abolished TNF-induced c-Jun N-terminal kinase, Akt, p38, and p44/p42 mitogen-activated protein kinase activation. TNF also induced the expression of various NF-kappaB-regulated gene products involved in cell proliferation, antiapoptosis, and invasion in wild-type NQO1 keratinocytes but not in NQO1-deleted cells. The suppression of these antiapoptotic gene products increased TNF-induced apoptosis in NQO1-deleted cells. We also found that TNF activated NQO1, and NQO1-specific small interfering RNA abolished the TNF-induced NQO1 activity and NF-kappaB activation. Overall, our results indicate that NQO1 plays a pivotal role in signaling activated by TNF and other inflammatory stimuli and that its suppression is a potential therapeutic strategy to inhibit the proliferation, survival, invasion, and metastasis of tumor cells.

Functional Analysis of a Metal Response Element in the Regulatory Region of Flounder Cytochrome P450 1A and Implications for Environmental Monitoring of Pollutants

Cytochrome P450 1A (CYP 1A) is a member of a multigene family of xenobiotic metabolizing enzymes. CYP 1A is highly inducible by numerous environmental contaminants including polycyclic aromatic hydrocarbons (PAHs) and is widely used in biomonitoring studies. Therefore, understanding the regulation of this gene is important for accurate interpretation of biomarker data. We describe here the functional role of a metal response element (MRE) in the European flounder CYP 1A promoter region. To help elucidate the potential role of this MRE, reporter gene constructs, with or without site-directed mutagenesis, were used in conjunction with a dual-luciferase assay. The electrophoretic mobility shift assay (EMSA) was also used to investigate potential protein binding at this MRE site. Treatment with the prototypical PAH 3-methylcholanthrene (3MC) (1.0 microM) produced a dose-dependent response at the CYP 1A promoter, whereas treatment with cadmium (0-1.0 microM) produced little transcriptional activity at either the wild-type or mutated promoter. Cotreatment with cadmium (1.0 microM) and 3MC (1.0 microM) reduced induction at this promoter to 1.83-fold compared to 3MC treatment alone (4.0-fold induction). Mutation of the MRE site resulted in abolishment of this cadmium-related loss of 3MC-dependent activity. Furthermore, a retarded band was observed in the EMSA when the MRE was used as a probe and incubated with liver nuclear protein from flounder treated with cadmium. The results not only add to knowledge of the diversity in vertebrate CYP 1A regulation but also raise the complexity of interpretation of CYP 1A induction in monitoring studies that involve mixtures of PAHs and metals.

Aprataxin Forms a Discrete Branch in the HIT (Histidine Triad) Superfamily of Proteins with Both DNA/RNA Binding and Nucleotide Hydrolase Activities

Ataxia with oculomotor apraxia type 1 (AOA1) is an early onset autosomal recessive spinocerebellar ataxia with a defect in the protein Aprataxin, implicated in the response of cells to DNA damage. We describe here the expression of a recombinant form of Aprataxin and show that it has dual DNA binding and nucleotide hydrolase activities. This protein binds to double-stranded DNA with high affinity but is also capable of binding double-stranded RNA and single-strand DNA, with increased affinity for hairpin structures. No increased binding was observed with a variety of DNA structures mimicking intermediates in DNA repair. The DNA binding observed here was not dependent on zinc, and the addition of exogenous zinc abolished DNA binding. We also demonstrate that Aprataxin hydrolyzes with similar efficiency the model histidine triad nucleotide-binding protein substrate, AMPNH2, and the Fragile histidine triad protein substrate, Ap4A. These activities were significantly reduced in the presence of duplex DNA and to a lesser extent in the presence of single-strand DNA, and removal of the N-terminal Forkhead associated domain did not alter activity. Finally, comparison of sequence relationships between the histidine triad superfamily members shows that Aprataxin forms a distinct branch in this superfamily. In addition to its capacity for nucleotide binding and hydrolysis, the observation that it also binds DNA and RNA adds a new dimension to this superfamily of proteins and provides further support for a role for Aprataxin in the cellular response to DNA damage.

Fluorophore-Labeled Primers Improve the Sensitivity, Versatility, and Normalization of Denaturing Gradient Gel Electrophoresis

Denaturing gradient gel electrophoresis (DGGE) is widely used in microbial ecology. We tested the effect of fluorophore-labeled primers on DGGE band migration, sensitivity, and normalization. The fluorophores Cy5 and Cy3 did not visibly alter DGGE fingerprints; however, 6-carboxyfluorescein retarded band migration. Fluorophore modification improved the sensitivity of DGGE fingerprint detection and facilitated normalization of samples from multiple gels by the application of intralane standards.

생쥐 도파민 수용쳬 조절인자 (DRRF) 유전자의 전사조절

생쥐의 도파민 수용체 조절인자 (DRRF)유전자는 몇몇 Spl 결합부위를 가지고 TATA가 없는 프로모터로부터 전사된다. 본 연구에서는 이 유전자의 발현을 조절하는 기능성 조절인자들을 밝힌다. <TEX>$D_2$</TEX> 도파민 수용체를 발현하는 NB41A3 세포에서 Spl은 pCAT-DRRF-l153/+17에 포함된 DRRF 프로모터부터 의 전사를 촉진시키지만 DRRF는 전사를 억제시켰다. -1153과 -1122 사이의 31 bp 단편의 결손에 의해 전사활성은 약 <TEX>$60\%$</TEX> 정도 감소하였다. 이 단편은 기능성 AP1 결합부위를 포함하고 있다 게다가, -901과 -772사이의 129 bp영역의 결손에 의해 전사활성이 더욱 더 감소하였다. 이 영역은 기능성 AP2 결합부위를 가진다. DRRF_AP1 (bases -1153 to -1121) 탐침을 이용한 gel shift실험에서 특정 벤드가 관찰되었고, 이 벤드는 API 상보성 경쟁자에 의해 효과적으로 사라졌다. 더욱이, DRRF_AP2 (bases -873 to -846) 탐침을 이용한 gel shift실험에서도 특정 벤드가 관찰되었고, 이 벤드도 AP2상보성 경쟁자에 의해 효과적으로 사라졌다. 본 연구결과로, Spl과 DRRF가 DRRF 프로모터를 효과적으로 조절한다는 사실과, AP1과 AP2 역시 이 유전자를 조절한다는 사실을 알 수 있었다. The murine dopamine receptor regulating factor (DRRF) gene is transcribed from a TATA-less promoter that has several putative Sp1 binding sites. The present investigation identifies functional transcription factors that modulate the expression of this gene, In the <TEX>$D_2-expressing$</TEX> NB41A3 cells, Spl potently activates transcription from the DRRF promoter in pCAT-DRRF-1153/+17, but DRRF effectively inhibits it. Deletion of the 31 bp fragment between -1153 and -1122 decreased transcription down to about <TEX>$60\%$</TEX>. This fragment contains a functional API binding site. In addition, deletion of the 129 bp region between -901 and -772 further decreased transcription. The latter region has a functional AP2 binding site. Using a DRRF_AP1 (bases -1153 to -1121) probe, a specific retarded band was observed, and the unlabeled AP1 consensus competitor could effectively compete away this retarded band. In addition, using a DRRF_AP2 (bases -873 to -846), a specific retarded band was observed, and the unlabeled AP2 consensus competitor could effectively compete away this retarded band. The present observations suggest that Spl and DRRF regulate the DRRF promoter and that both API and AP2 also modulate this gene.

Parkin Phosphorylation and Modulation of Its E3 Ubiquitin Ligase Activity

Mutations in the PARKIN gene are the most common cause of hereditary parkinsonism. The parkin protein comprises an N-terminal ubiquitin-like domain, a linker region containing caspase cleavage sites, a unique domain in the central portion, and a special zinc finger configuration termed RING-IBR-RING. Parkin has E3 ubiquitin-protein ligase activity and is believed to mediate proteasomal degradation of aggregation-prone proteins. Whereas the effects of mutations on the structure and function of parkin have been intensely studied, post-translational modifications of parkin and the regulation of its enzymatic activity are poorly understood. Here we report that parkin is phosphorylated both in human embryonic kidney HEK293 cells and human neuroblastoma SH-SY5Y cells. The turnover of parkin phosphorylation was rapid, because inhibition of phosphatases with okadaic acid was necessary to stabilize phosphoparkin. Phosphoamino acid analysis revealed that phosphorylation occurred mainly on serine residues under these conditions. At least five phosphorylation sites were identified, including Ser101, Ser131, and Ser136 (located in the linker region) as well as Ser296 and Ser378 (located in the RING-IBR-RING motif). Casein kinase-1, protein kinase A, and protein kinase C phosphorylated parkin in vitro, and inhibition of casein kinase-1 caused a dramatic reduction of parkin phosphorylation in cell lysates. Induction of protein folding stress in cells reduced parkin phosphorylation, and unphosphorylated parkin had slightly but significantly elevated autoubiquitination activity. Thus, complex regulation of the phosphorylation state of parkin may contribute to the unfolded protein response in stressed cells.

Interaction of RNA polymerase II general transcription complex proteins with oligoribonucleotides

Saccharomyces cerevisiae RNA polymerase II general transcription complex proteins (RNA polymerase II, TBP, TFIIB, TFIIF, TFIIE, and TFIIH) were tested for interaction with oligoribonucleotides. Electrophoretic mobility shift assays showed that 32P-labeled CU-rich oligonucleotide p-17 (5′-ACUCUCUUCCG-CAUCGC- 3′) interacted with the proteins to yield three types of complexes, corresponding to three retardation bands. All complexes were RNA-specific, because [32P]p-17 was displaced by an excess of nonlabeled S. cerevisiae RNA and was not displaced by a 500-fold molar excess of a nonlabeled oligodeoxyribonucleotide. The complexes corresponding to the middle retardation band were specific for p-17, because [32P]p-17 was displaced almost completely by a 100-fold molar excess of nonlabeled p-17 and was not displaced by a 500-fold molar excess of an AU-rich oligoribonucleotide. The complexes corresponding to the upper retardation band were RNA-specific, and those corresponding to the lower band were assumed to result from nonspecific sorption of [32P]p-17 on a protein. Oligoribonucleotides and oligodeoxyribonucleotides did not compete for the binding with RNA polymerase II general transcription complex proteins.

Evidence for a new human CYP1A1 regulation pathway involving PPAR-α and 2 PPRE sites

Cytochrome P450 1A1 catalyzes the degradation of endobiotics (estradiol, fatty acids, and so on) and the bioactivation of numerous environmental procarcinogens, such as arylamines and polycyclic aromatic hydrocarbons, that are found in food. Several peroxisome proliferators and arachidonic acid derivatives enhance cytochrome P450 1A1 activity, but the mechanisms involved remain unknown. The aim of this work was to study the role of peroxisome proliferator-activated receptors in cytochrome P450 1A1 gene induction. The role of peroxisome proliferator-activated receptor transcription factors in cytochrome P450 1A1 induction was assessed by means of enzymatic activities, quantitative real-time polymerase chain reaction, gene reporter assays, mutagenesis, and electrophoretic mobility shift assay. We show that peroxisome proliferator-activated receptor-alpha agonists (WY-14643, bezafibrate, clofibrate, and phthalate) induce human cytochrome P450 1A1 gene expression, whereas 2,4-thiazolidinedione, a specific peroxisome proliferator-activated receptor-gamma agonist, represses it. The induction of cytochrome P450 1A1 transcripts by WY-14643 was associated with a marked increase of ethoxyresorufin O -deethylase activity (10-fold at 200 mumol/L). Transfection of peroxisome proliferator-activated receptor-alpha complementary DNA enhanced cytochrome P450 1A1 messenger RNA induction by WY-14643, although WY-14643 failed to activate xenobiotic responsive element sequences. Two peroxisome proliferator response element sites were located at positions -931/-919 and -531/-519 of the cytochrome P450 1A1 promoter. Their inactivation by directed mutagenesis suppressed the inductive effect of WY-14643 on cytochrome P450 1A1 promoter activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay experiments showed that the 2 cytochrome P450 1A1 peroxisome proliferator response element sites bind the peroxisome proliferator-activated receptor-alpha/retinoid X receptor-alpha heterodimer. We describe here a new cytochrome P450 1A1 induction pathway involving peroxisome proliferator-activated receptor-alpha and 2 peroxisome proliferator response element sites, indicating that peroxisome proliferator-activated receptor-alpha ligands, which are common environmental compounds, may be involved in carcinogenesis.

Selective covalent binding of a positively charged water-soluble benzoheterocycle triosmium cluster to single- and double-stranded DNA

The water-soluble triosmium cluster [Os 3(CO) 9(μ-η 2-(4-CHO)C 9H 5N)(μ-H)(P(OCH 2CH 2N(CH 3) 3I) 3)] ( 4) was tested for its reactivity with plasmid DNA. In contrast to the band retardation previously observed with a related series of positively charged clusters, an intensification and retardation of three discrete bands was observed with increasing cluster concentration. In order to further investigate the apparent modification of DNA by 4, its interaction with a 22-oligomer (sequence 5′-AGT TGT GGT GAC TTT CCC AGG C-3′) was examined. Incubation with this oligonucleotide (pH 7.4 in Tris–HCl buffer and 100 mM NaCl) followed by HPLC analysis revealed the formation of three dose dependent products assigned as covalent modifications at three sites of the oligonucleotide. Incubation of 4 with 32P-ATP labeled oligonucleotide at the 5′-end followed by treatment with piperidine and comparison with the standard Maxam–Gilbert sequencing protocol products revealed only general background cleavage, indicating that the modification products are piperidine labile and suggesting that the modification involved formation of a Schiff base. An alternative approach was then pursued which involved annealing the 4-oligonucleotide products with their complementary strand and treatment of the resulting duplex DNAwith the exonuclease, Exo III. This assay indicated three exonuclease stops, consistent with the three products observed by HPLC whose electrophoretic mobility approximately matched guanine containing fragments when compared with the Maxam–Gilbert sequencing lanes. Reduction of the 4-oligonucleotide products with borohydride reducing agents, followed by treatment with piperidine, resulted in the formation of one product (by HPLC) with the same electrophoretic mobility as the AGTT fragment based on comparison with the Maxam–Gilbert sequencing lanes. This product most likely results from reduction of an initially formed Schiff base adduct (to the corresponding amine) with the guanine of the TGT fragment of the oligonucleotide, and corresponds to the most stable of the three Schiff base adducts detected by HPLC and by incubation with the exonuclease. The other two products are less stable and competitive reduction of the free aldehyde functionality on the cluster in equilibrium with these adducts precludes their detection after treatment with the reducing agents. The formation of the Schiff base adduct is further corroborated by the model reaction of [Os 3(CO) 10(μ-η 2-(4-CHO)C 9H 5N)(μ-H)] ( 4′) with acetylated guanine in nonaqueous solvents where disappearance of the aldehyde resonance and the appearance of several new resonances in the 6–9 ppm region of the 1H NMR of the reaction mixture is noted.

Structural analysis and identification of cis-elements of rice osRACD gene.

The osRACD gene correlated with fertility transformation in the photoperiod sensitive genic male sterile rice (PGMR), Nongken 58S, encoded a rice (Oryza sativa L. ssp. japonica) small GTPase belonging to the Rac/Rho family. Inverse PCR was performed to amplify a fragment about 1.4 kb in 5' upstream region of the osRACD promoter. Deletion mutation and gel mobility shift assay characterized two fragments (-799 to -686 nt, and -686 to -431 nt) in the osRACD promoter that could be involved in its transcriptional regulation. When these two deletion fragments were used as probe respectively, a retarded band appeared in the nuclear extracts of fertile 58S rice under short day (58S-SD). Whereas no retarded band was shown in the nuclear extracts of sterile 58S rice under long day (58S-LD). Competition assay indicated that the factors in the retarded bands binding to these two fragments were the same trans-acting factor (termed rice factor, RF). The binding affinity of RF was affected by phosphorylation and was higher in SD-growth rice than that of LD-growth rice.