Retail Garden Centers Research Articles

Seeing Red? The Role of Font Color, Size, and Sale Sign Location in Retail Garden Center Displays1

AbstractThe goal of this study was to better understand consumers' likelihood to buy a plant when the word “sale” was presented in red font on a white sign, with a range of font sizes, showing an equivalent discounted price in three ways (dollar amount, 25% percent off, and buy-3-get-1-free), with the sale sign location either on the left or right side of the display. Researchers constructed a partial factorial design with three plant types producing 16 images for the study. They recruited 154 subjects from two states. Results of the rating-based conjoint study revealed that plant type comprised 45% of the purchase decision, which was consistent with prior research. Price (23.8%) was the next most important factor in likely to buy followed by sale font size. Sale sign location and sale font color were similar and third and fourth, respectively, in relative importance. The synergistic effect of sale font size and color indicate that when red fonts were used for the word “sale” they should be larger than other font sizes and placed to the right in the display. Consumer gaze appeared to move from left to right as though study participants “read” the display. Results showed the red font had greater attention-grabbing power on the right side of the display and when it appeared in a larger or smaller font size.Index words: consumer, eye-tracking, price, survey, signage.Species used in this study: Pepper [Capsicum annuum L. (C. frutescens)], parsley Petroselinum crispum J. Hill, petunia (Petunia x hybrida Juss.), rosemary Rosmarinus officinalis L., sage (Salvia officinalis L.), tomato (Solanum lycopersicum L.).

Incidence of Phytophthora infestans (Mont.) de Bary on potato and tomato in Maine, 2006–2010

Abstract Late blight, caused by Phytophthora infestans (Mont.) de Bary, is a devastating disease which is found worldwide. In Maine, United States (US), we recorded late blight on potato and tomato during the 2006-2009 cropping seasons. From 2006 to 2008, over 90% of the diseased samples were collected in potato fields from northern and central Aroostook County in Northern Maine, US. Then, in 2009, an unprecedented influx of inoculum on infected tomato transplants shipped to retail garden centers throughout the Northeast US significantly changed the late blight infection patterns. In 2009, 43% of diseased samples obtained were from tomato, and 57% from potato, and disease was found to occur all over the state. Moran’s index and spatial autocorrelation analysis of disease occurrence, geographical locations, host factors, and infection levels from previous years, were not statistically significant (p > 0.05). Therefore, random distributions of late blight incidences were recorded across locations and years. Nearest neighbor analysis revealed that mean spatial distances for late blight occurrence ranged from 1.51 to 71.4 km from 2006 to 2008, and 7.4 to 126.5 km in 2009. The frequency and locations of late blight outbreaks in 2009 were substantially greater than in 2006, 2007, and 2008, as affected by the influx of inoculum and movement of infected tomato seedlings as well as conducive environmental conditions. All were contributing factors for late blight occurrence in Maine. In 2010, few disease samples were collected, indicating that the influx of inoculum in 2009 did not persist to cause widespread disease in 2010. The reduction of inocula sources, fungicide protection of susceptible hosts, and the removal and destruction of infected tomato seedlings and potato cull piles or volunteer plants, can greatly reduce late blight occurrences and improve potato production. These actions should be considered as an integral part of late blight management programmes in regions where late blight commonly occurs

First Report of the Invasive SlugBoettgerilla pallensSimroth, 1912 (Boettgerillidae) in the United States

Boettgerilla pallens Simroth, 1912 is reported for the first time in the United States. Identification was based on combined morphological and molecular data (mitochondrial cytochrome c oxidase I and 16S rRNA sequences) of a specimen collected in a retail garden center in northern California. We provide some background information on the biology and ecology of the slug and discuss the pest status of the species.

Florida Foliage House Plant Care: Adenium obesum

Adenium obesum and its many hybrids are often seen in retail garden centers. They have vibrant floral displays in shades of red, white, pink, and yellow. Flowers average 2–3 inches in diameter and may be single, double, or even triple. The plants must be stationed in high light, 6 hours or more per day, to maintain flowering during the summer. Adenium obesum makes a dramatic specimen for a deck or patio but should be moved indoors in winter. This 2-page fact sheet was written by R. J. Henny and J. Chen, and published by the UF Department of Environmental Horticulture, May 2013.
 http://edis.ifas.ufl.edu/ep474

Minnesota horticultural industry survey on invasive plants

Horticultural commerce of ornamental plants has been the source of many of our most troublesome plant invaders worldwide. The purpose of this research was to document the knowledge gap of industry perspectives and knowledge of invasive ornamental crops by surveying industry professionals in the Midwest region of the U.S. (primarily in the state of Minnesota). An invasive plant survey was created to assess this information and was mailed to n = 500 individuals and companies randomly chosen from the Minnesota Nursery and Landscape Association (MNLA) membership, which included wholesale/retail nurseries, landscape design, installation & maintenance firms, and retail garden centers. A total of n = 167 surveys (33.4%) were returned and analyzed. A majority of respondents, 62%, felt that the invasive plant issue was very important and 89% tried to direct their customers away from potentially invasive plants. Many respondents, 76%, indicated that they were responsible for educating their customers about invasive ornamental plants. Sixty-nine percent said that they would not sell a plant if it was potentially invasive; however, 57% indicated that this would be true if a competing business was selling the plant. Respondent’s knowledge about specific invasive plants varied from 75% to 89% on the identification of three terrestrial invasive plant crops. Far less, 20% and 21%, were able to identify Butomus umbellatus and Salvinia molesta, respectively, two invasive aquatic species. When asked about regulation of invasive ornamental crops, 43% preferred national, state, or USDA regulation while 22% felt industry self-regulation was best, and 21% approved of private regulation. Opportunities exist for educating horticulture industry professionals about invasive plants and providing information to the public through commercial businesses.

First Report of Tomato yellow leaf curl virus in South Carolina.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5'GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5'GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of "across-state" distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

The Economic Impact of the Green Industry in the United States

The United States environmental horticulture industry, also known as the Green Industry, is comprised of wholesale nursery and sod growers; landscape architects, designers/builders, contractors, and maintenance firms; retail garden centers, home centers, and mass merchandisers with lawn and garden departments; and marketing intermediaries such as brokers and horticultural distribution centers (re-wholesalers). Environmental horticulture is one of the fastest growing segments of the nation's agricultural economy. In spite of the magnitude and recent growth in the Green Industry, there is surprisingly little information regarding its economic impact. Thus, the objective of this study was to estimate the economic impacts of the Green Industry at the national level. Economic impacts for the U.S. Green Industry in 2002 were estimated at $147.8 billion in output, 1,964,339 jobs, $95.1 billion in value added, $64.3 billion in labor income, and $6.9 billion in indirect business taxes, with these values expressed in 2004 dollars. In addition, this study evaluated the value and role of urban forest trees (woody ornamental trees); the total output of tree production and care services was valued at $14.55 billion, which translated into $21.02 billion in total output impacts, 259,224 jobs, and $14.12 billion in value added.

Louisiana Select—Plant Promotion, Marketing, and Recommendation Efforts for the Nursery and Landscape Industry

The LSU Agricultural Center and Louisiana Nursery and Landscape Association initiated an ornamental plant promtion, marketing, and recommendation program in 1996. Called `Louisiana Select', this program is intended to actively promote outstanding ornamental plants to Louisiana's gardening consumers. In addition, it provides county agents and industry professionals information on plants that should be recommended. The selection committee consists of an extension horticulturist, two county agents, a landscape contractor, a wholesale greenhouse grower, a wholesale woody ornamental producer, and two representatives from retail garden centers. Plants are usually promoted in the spring and fall of each year. Plants previously named as Louisiana Select recipients include `New Orleans Red' (Red Ruffle) coleus, mayhaw, `Henry's Garnet' virginia sweetspire, `Homestead Purple' perennial verbena, `Telstar' dianthus, bald cypress, `New Gold' lantana, `Confetti' lantana, `Trailing Purple' lantana, `Dallas Red' lantana, `Silver Mound' lantana, `Lady in Red' salvia, `New Wonder' scaevola, `Goldsturm' rudbeckia, and `Foxy' fox-glove. A theme (“Fall is for Planting Native Trees”) has also been promoted. Point of purchase signs promoting the Louisiana Select program and individual plants are made available to garden centers. Significant sales increases ranging from 300% to 2500% have been reported for seelcted plants with annual bedding plants and perennial flowers enjoying the greater sales volume increases.

Introduction of Tomato Yellow Leaf Curl Virus in Florida and Implications for the Spread of This and Other Geminiviruses of Tomato.

In July 1997, symptoms characteristic of tomato yellow leaf curl virus (TYLCV-Is) were observed on one tomato plant in a field in Collier County, Florida, and on several tomato plants in a retail garden center in Sarasota, Florida. Amplification with three sets of primers, analysis of amplified fragments using restriction enzyme digestion, and hybridization with a clone of TYLCV-Is indicated that TYLCV-Is was present in symptomatic plants. The sequence of a 1,300-bp amplified fragment was 99% identical to TYLCV-Is from the Dominican Republic and 98% identical to an isolate from Israel. It appears that TYLCV-Is entered the United States in Dade County, Florida, in late 1996 or early 1997. Subsequently, infected tomato transplants produced for retail sale at two Dade County facilities were rapidly distributed via retail garden centers throughout the state. Infected plants purchased by homeowners and placed in and around homes appeared to be the source of TYLCV-Is for nearby commercial nurseries and production fields. It appears that transplants have played a role in the movement of this and probably other geminiviruses. A number of regulatory procedures, as well as field management practices, were implemented in the 1997-98 production season to minimize the movement of TYLCV-Is within and out of the state.

497 Customers in Seven U.S. Markets Assess Service Quality In Traditional and Non-traditional Retail Garden Center Outlets

SERVQUAL has been demonstrated to be a reliable and valid tool to measure customer perceptions and expectations of service quality. Two previous uses of the survey in the horticulture industry were identified. In Spring 1997, we adapted the SERVQUAL instrument to survey 701 customers of 10 retail garden centers (TR) and four nontraditional retail or mass-merchandise outlets (MM) in seven U.S. markets. Among the seven markets, customers differed on only two of six demographic characteristics: income and number of people residing in the household. Demographic characteristics of TR and MM customers were similar in terms of age (47 and 45 years), people residing in the household (2), percent female respondents (77% and 73%), and family status. Customers differed demographically on 1996 household income ($50,722 and $44,753). Customers of TR and MM had similarly high expectations for three of five service quality and one product quality dimensions. However, TR customer perceptions were consistently higher on all service and product quality dimensions than MM customers. This yielded consistently higher service quality gaps for MM customers when compared to TR customers. We concluded that TR hold an advantage in these seven markets with higher customer perceptions of product and service quality.

Louisiana Select: Taking the Plants to the People

The LSU Agricultural Center and Louisiana Association of Nurserymen initiated an ornamental plant promotion and recommendation program in 1996. Called `Louisiana Select', this program is intended to actively promote outstanding ornamental plants to Louisiana's gardening consumers. Plants are promoted in the spring and fall of each year and have included `New Orleans Red' coleus, mayhaw, `Henry's Garnet' Virginia willow, `Homestead Purple' verbena, `Watchet' azalea, `Telstar' dianthus, bald cypress, `New Wonder' scaevola, “Fall is for Planting Native Trees”, and lantana (`New Gold', `Dallas Red', `Confetti', `Trailing Purple', and `Silver Mound'). Point of purchase signs and banners promoting the `Louisiana Select' program and individual plants are provided to retail garden centers. Significant sales increases ranging from 300% to 2500% have been reported for the selected plants, with annual bedding plants and perennial flowers enjoying the greater sales increases. Plants for promotion are selected by a committee of wholesale greenhouse producers, retailers, landscape contractors, and cooperative extension service personnel.

Training Alabama Garden Center Employees

Before analyzing the responses of Alabama garden center employees about the training they had received, we determined how satisfied 100 Alabama Master Gardeners were with the employee-s who helped them in the store from which they most often purchased plants for their homes, landscapes, or gardens. We mailed the primary survey to 472 employees of 130 retail garden center businesses in Alabama to determine the percentage of employees who received job training and the amount, frequency, and methods of training they received while working for their current employers (37% responded). Employees were categorized as managers (28%) or subordinate employees (72%) and full-time (72%) or part-time (28%). Forty-four percent of the employees had received some training at the time they were hired. Training continued for 68% of the respondents. Only 39% of the employees had a written description of their job responsibilities discussed with them. Most (85%) believed the training they received had prepared them to do their jobs well, but 82% said more training would increase their confidence in their work performance. Most employees were trained by one-on-one instruction (60%) and small-group sessions (5 or fewer persons) (65%). Few employees received training from videotapes (5%) or educational seminars (26%), and most that did were managers and full-time employees.

HORTICULTURAL YOUTH EDUCATION: THE MISSING LINK

Most college professors spend little time helping youth (kindergarten to 12th grade) learn about horticulture, and the elementary and secondary schools seem to have created a dividing line between scientific concepts and practical life-long skills. Biology classes continue to emphasize the chemical processes of photosynthesis and deemphasize the nurturing, caring, dependability, responsibility, sense of accomplishment, and other life-long skills that can be obtained from growing plants. However, retail garden centers and chain stores are increasingly offering books and supplies on gardening and related activities for children. Seed companies market and package seeds just for children. Botanical gardens and arboretums are including youth horticultural activities as part of their on-going educational programs. The involvement of university educators in horticultural youth education can assist the “trickle up” theory to the parents of children along with affecting future voters. Take the first step to see what classroom horticultural materials are available in your state. Currently many teachers have an interest in learning more about horticulture but need educational materials. In addition, there is a large number of volunteers interested in this endeavor. Do your part and help develop accurate horticultural materials for these instructors to use in formal and informal educational settings.

POINT OF PURCHASE BROCHURES FOR EXTENSION CONSUMER HORTICULTURE EDUCATION THROUGH RETAIL GARDEN CENTERS

A series of 20 informational brochures has been produced cooperatively by representatives from five departments and the horticulture industry. These brochures focus on environmentally sound, residential landscape practices. The brochures are designed for purchase by retail garden centers, nurseries, and landscape contractors for distribution to their customers, providing educational information and freeing employee time from answering questions. An order blank has been prepared, and the material is being promoted through the Virginia Nurseryman's Association and state and regional trade shows. Topics covered are planting shrubs, planting trees, making compost, using compost, storing pesticides, choosing pesticides, pesticide labels, integrated pest management, pruning trees and shrubs, applying pesticides, healthy soil, water-wise landscaping, diagnosing plant problems, fertilizing trees/shrubs, landscaping for less in the landfill, maintaining lawns, establishing lawns, choosing turfgrass, fertilizing lawns, and selecting hand tools.

SURVEY OF RETAIL GARDEN CENTER EMPLOYEE TRAINING IN ALABAMA

A survey was conducted with 130 retail garden centers in Alabama to assess personnel training. The 59 item survey was mailed to 472 employees of these garden centers on 1 June 1992 requesting the amount, frequency, and methods of training they had received from their current employer. 176 surveys were returned for a 37% response rate. 69% of employees received verbal policies and standards from their employer when hired, whereas only 37% were given a written job description of responsibilities. 42% of the employees had received some kind of formal training with 56% received all of their training on an individual basis. Of the employees who received training in small groups, it was performed one to three times among 47% of employees and more than 10 times with 25% of employees. Significant decreases were shown in the amount of training received between the first week and the end of the first six months on the job. The results suggest not enough emphasis is being placed on employee training in the management and operation of retail garden centers in Alabama.

A Conjoint/Logit Analysis of Nursery Stock Purchases

Product attributes that determine nursery-stock sales from wholesalers to retail garden centers and landscapers were studied. Conjoint analysis was used to obtain data on buyer preferences. The data were analyzed using ordinary least squares and logit procedures to determine the attributes that are preferred by buyers. It was determined that good- to excellent-quality stock, offerings with a full line of additional plants, taller plants, and cash discounts are desirable attributes. Quality is the dominant attribute affecting preferences. Packaging the preferred attributes together significantly increases the probability of a plant being purchased by buyers.