Restriction Fragment Patterns Research Articles

Вивчення життєздатних бактеріофагів за допомогою активації псевдолізогенного стану Pectobacterium carotovorum

The rare occurrence of viable bacteriophages is an issue in studying bacterial-phage systems of the phytopathogenic bacterium Pectobacterium carotovorum subsp. carotovorum (Pcc). Aim. To obtain viable bacteriophages by activating pseudolysogeny of the Pcc strains. Methods. To obtain bacteriophage F66, isogenic clones of Nalr mutants of strains Pcc 66A and Pcc M2-4 were used. To study the properties of the phage, ultracentrifugation of viral particles, electron microscopy, electrophoretic separation, and comparative restriction analysis of virion DNA were used. Results. It was shown that some isogenic clones of Nalr -mutants of Pcc 66A and Pcc M2-4 can produce viable bacteriophages under conditions of intensive aeration. At the same time, induced phages are able to reproduce on the parent bacterial strains, which they were isolated from (pseudolysogenic response). A pure line was obtained for the phage isolate induced from pseudolysogenic Pcc 66A Nalr by consecutive single colony passages. This phage, named F66, was shown to be temperate and able to lyse and lysogenize strains of pectolytic bacteria isolated from soft rot affected potato tubers. Phage F66 has а virion with the A1 morphotype characterized by an isometric head with an average diameter of 52.0 ± 2.1 nm and a contractile tail with a length of 115.4 ± 3.2 nm. Showing low stability under environmental conditions, phage F66 differs significantly from the temperate phage ZF40 P. carotovorum, which has a similar virion morphology. Compared phages also differ in the restriction fragment patterns obtained using endonucleases HindIII, BamHI, and HpaI. Conclusions. Temperate phage F66 is a novel P. carotovorum virus. The method for activating the pseudolysogenic state proposed in the article is useful for obtaining viruses of phytopathogenic bacteria.

A Nitrate-Transforming Bacterial Community Dominates in the Miscanthus Rhizosphere on Nitrogen-Deficient Volcanic Deposits of Miyake-jima.

The perennial gramineous grass Miscanthus condensatus functions as a major pioneer plant in colonizing acidic volcanic deposits on Miyake-jima, Japan, despite a lack of nitrogen nutrients. The nitrogen cycle in the rhizosphere is important for the vigorous growth of M. condensatus in this unfavorable environment. In the present study, we identified the nitrogen-cycling bacterial community in the M. condensatus rhizosphere on these volcanic deposits using a combination of metagenomics and culture-based analyses. Our results showed a large number of functional genes related to denitrification and dissimilatory nitrate reduction to ammonium (DNRA) in the rhizosphere, indicating that nitrate-transforming bacteria dominated the rhizosphere biome. Furthermore, nitrite reductase genes (i.e., nirK and nirS) related to the denitrification and those genes related to DNRA (i.e., nirB and nrfA) were mainly annotated to the classes Alpha-proteobacteria, Beta-proteobacteria, and Gamma-proteobacteria. A total of 304 nitrate-succinate-stimulated isolates were obtained from the M. condensatus rhizosphere and were classified into 34 operational taxonomic units according to amplified 16S rRNA gene restriction fragment pattern analysis. Additionally, two strains belonging to the genus Cupriavidus in the class Beta-proteobacteria showed a high in vitro denitrifying activity; however, metagenomic results indicated that the DNRA-related rhizobacteria appeared to take a major role in the nitrogen cycle of the M. condensatus rhizosphere in recent Miyake-jima volcanic deposits. This study elucidates the association between the Miscanthus rhizosphere and the nitrate-reducing bacterial community on newly placed volcanic deposits, which furthers our understanding of the transformation of nitrogen nutrition involved in the early development of vegetation.

Biological, morphological, and molecular characterization of the baculovirus PlxyMNPV_LBIV-11, and its virulence towards Plutella xylostella, Trichoplusia ni, and Spodoptera frugiperda larvae.

PlxyMNPV_LBIV-11 is an alphabaculovirus strain, isolated from Plutella xylostella larvae. This work characterized this strain at a biological, morphological, and molecular level to evaluate its similarity with other baculoviruses. Its ultrastructure showed a multiple arrangement of nucleocapsids within enveloped virions, all occluded within large cubical polyhedra. PlxyMNPV_LBIV-11 showed infectivity on the Hi5 and Sf9 cell lines, despite these being from heterologous origin. This in vitro infectivity was observed using either BVs or by transfection with genomic DNA. Restriction fragment patterns of PlxyMNPV_LBIV-11, using the enzymes EcoRI, BamHI and HindIII, showed a high relationship with those patterns shown by AcMNPV, except for one or two differential bands with each enzyme. Sequences of core genes lef-8 and lef-9 and the conserved polh gene showed identities ranging from 98 to 100% when compared with those of AcMNPV. Somewhat lower was the sequence identity of the gp64 gene (94%) as compared with those of AcMNPV and PlxyMNPV_CL3, which might be related to the difference in virulence. Besides, the presence of this gene in PlxyMNPV_LBIV-11 indicates that it belongs to group 1 of alphabaculoviruses. A phylogram was estimated with the core and conserved gene sequences, corroborating its high relationship with AcMNPV and PlxyMNPV_CL3. Bioassays were performed with P. xylostella larvae reared on a meridic diet, whose LC50 values indicated lower virulence than AcMNPV when tested against P. xylostella, Spodoptera frugiperda, and Trichoplusia ni larvae. Its virulence against S. frugiperda was only seven times lower than AcMNPV. Its potential as a biological control agent is discussed.

Rolling circle amplification of begomoviral DNA from a single nucleus isolated by laser dissection microscopy

Laser dissection microscopy (LDM) is a method for isolating organelles, a specific cell or cells/tissue of interest from microscopic regions with the help of a laser. Here we describe a LDM-based isolation of begomovirus infected Nicotiana benthamiana epidermal cells and nuclei, in combination with a fast method to prepare non-fixed leaf epidermal samples for LDM. The bipartite Abutilon mosaic virus (AbMV) was used in which the coat protein gene of DNA A was deleted and replaced by the open reading frame (ORF) coding for the green fluorescent protein (GFP, accession: U87624), agro-infiltrated together with DNA B, to visualize infected cells. GFP expressing epidermal cells or nuclei were isolated by LDM with the MMi Cellcut system and viral circular DNA was amplified by rolling circle amplification (RCA). Subsequently, the RCA product was incubated with the restriction enzymes BamHI and PstI and restriction fragments were separated on an agarose gel to prove presence of the viral genome. It was shown that even a single-isolated nucleus harbored enough material to produce a sufficient restriction fragment pattern to identify a begomovirus infected cell/nucleus.

A simple means for MHC-Y genotyping in chickens using short tandem repeat sequences.

Described here is a new, more efficient method for defining major histocompatibility complex-Y (MHC-Y) genotypes in chickens. The MHC-Y region is genetically independent from the classical MHC (MHC-B) region. MHC-Y is highly polymorphic and potentially important in the genetics of disease resistance. MHC-Y haplotypes contain variable numbers of specialized MHC class I-like genes, along with members of four additional gene families. Previously, MHC-Y haplotypes were defined by patterns of restriction fragments (RF) generated in labor-intensive procedures that were difficult to use to define MHC-Y genotypes for large numbers of samples. The method reported here is much simpler. MHC-Y genotypes are distinguished via patterns of PCR products generated from heritable short tandem repeat (STR) regions found immediately upstream of the MHC class I-like genes located throughout MHC-Y haplotypes. To validate the method, fully pedigreed families were analyzed for STR-defined haplotypes in light of haplotypes defined previously by RF patterns. STR-defined MHC-Y patterns segregate in fully pedigreed families as expected and correspond with haplotypes assigned by RF patterns. The patterns provided in STR chromatograms generated by capillary electrophoresis are distinct for different haplotypes and can be scored easily. Investigations into the influence of MHC-Y genetics on immune responses can now realistically be conducted with large sample sets.

Quantitative Proteomics Reveal Peroxiredoxin Perturbation Upon Persistent Lymphocytic Choriomeningitis Virus Infection in Human Cells.

Experimental data indicate that during persistent infection, lymphocytic choriomeningitis virus (LCMV) may both directly or indirectly modulate regulatory cellular processes and alter cellular functions that are not critical for survival, but are essential for cell homeostasis. In order to shed more light on these processes, two-dimensional differential in-gel electrophoresis (2D-DIGE) and MALDI-TOF tandem mass spectrometry were used to determine the proteome response of the HeLa cell line to persistent LCMV infection. Quantitative analysis revealed 24 differentially abundant proteins. Functional analysis showed that LCMV-responsive proteins were primarily involved in metabolism, stress, and the defense response. Among identified proteins, we discovered significant changes for peroxiredoxins, a family of antioxidant enzymes. Decreased amount of these antioxidant proteins correlated with elevation of reactive oxygen species (ROS) in infected cells. Increased levels of ROS were accompanied by changes in the pattern of telomere restriction fragments (TRFs) in infected cells and mediated activation of hypoxia-inducible transcription factor-1 (HIF-1) and phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathways. Moreover, treatment with antioxidants resulted in reduced levels of viral nucleoprotein, indicating a connection between ROS-dependent signaling and viral replication.

Neer Award 2017: A rapid method for detecting Propionibacterium acnes in surgical biopsy specimens from the shoulder

Propionibacterium (P) acnes infection of the shoulder after arthroplasty is a common and serious complication. Current detection methods for P acnes involve anaerobic cultures that require prolonged incubation periods (typically 7-14 days). We have developed a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) approach that sensitively and specifically identifies P acnes in tissue specimens within a 24-hour period. Primers were designed to amplify a unique region of the 16S rRNA gene in P acnes that contained a unique HaeIII restriction enzyme site. PCR and RFLP analyses were optimized to detect P acnes DNA in in vitro cultures and in arthroscopic surgical biopsy specimens from patients with P acnes infections. A 564 base-pair PCR amplicon was derived from all of the known P acnes strains. HaeIII digests of the amplicon yielded a restriction fragment pattern that was unique to P acnes. P acnes-specific amplicons were detected in as few as 10 bacterial cells and in clinical biopsy specimens of infected shoulder tissues. This PCR-RFLP assay combines the sensitivity of PCR with the specificity of RFLP mapping to identify P acnes in surgical isolates. The assay is robust and rapid, and a P acnes-positive tissue specimen can be confirmed within 24 hours of sampling, facilitating treatment decision making, targeted antibiotic therapy, and monitoring to minimize implant failure and revision surgery.

Study of the genetic diversity of Iranian honey bee (Apis mellifera meda Skorikow, 1829) populations using the mtDNA COI–COII intergenic region

Determining the genetic diversity amongst the populations of honey bee is one of the essential and important aims in race breeding of this useful insect. In the present study, the genetic diversity of the intergenic region COI–COII of mtDNA of the honey bee populations in the South of Iran has been studied. We used the PCR-RFLP technique, and 60 worker honey bees were collected from 6 provinces (Sistan and Baluchestan, Kerman, Fars, Hormozgan, Bushehr and Khuzestan) of Iran. Their DNA were extracted using a salting out method. To do PCR, 25 microliters of one pair of primers plus mtDNA were used. To ascertain the results of PCR, the PCR products were electrophoresed using 1.5% Agarose Gel. Thereafter, the <i>Dra</i>I restriction enzyme was used for enzymatic digestion of the PCR product. The result of this digestion was to produce 4 diverse pieces (44, 55, 64 and 430 bp) of enzymatic restriction fragment patterns. The results obtained from this study showed that using <i>Dra</i>I restriction enzyme digestion, the honey bee populations in the South of Iran belonged to the C mtDNA lineage (this honey bee race group consists of Central Mediterranean and South East European honey bee populations). Another result obtained from this study indicated the absence of genetic diversity between the samples collected from the South of Iran.

Performance Assessment of the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Method for Rapid Detection of Susceptibility to Ethambutol and Molecular Prediction of Extensively Drug-resistant Tuberculosis in Clinical Isolates of Mycobacterium tuberculosis.

The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was employed for rapid detection of ethambutol (EMB) resistant clinical isolates of Mycobacterium tuberculosis. From 182 clinical isolates of M tuberculosis collected from different regions, 103 strains were entered in the investigation. DNA was extracted by Chelex 100 method and PCR was performed using specific primers for embB gene. Polymerase chain reaction products were digested with HaeIII and NlaII restriction endonucleases and the patterns of restriction fragments were analysed. Some randomly selected samples were sequenced. Out of 103 studied strains, 52 were resistant to EMB. The cases of secondary tuberculosis were 53 (51.50 ± 1.77%), and primary cases 50 (48.50 ± 1.77%; p > 0.05). From 63 extensively drug-resistant (XDR), pre-XDR and multidrug-resistant (MDR) isolates, 27 (87%), 18 (81.8%) and 7 (70%) strains were resistant to EMB, respectively. Results of PCR-RFLP method showed that from 27R EMB XDR isolates, 13 (sensitivity 48% with CI: 0.307, 0.66 and specificity 100%), from 18R EMB pre-XDR strains, 4 (sensitivity 22% with CI: 0.09, 0.45 and specificity 100%) and of 7R EMB MDR, 2 (sensitivity 28% with CI: 0.082, 0.64 and specificity 100%) had mutation in ATG-Met codon 306. Results of sequencing were concordant with RFLP method. Overall, sensitivity of the molecular method was 36.5% (CI: 0.09, 0.45) and specificity 100%. None of the 40 pansusceptible strains was embB306 mutants. Extensively drug-resistant strains had a higher proportion of embB306 mutants (43%) than pre-XDR and MDR isolates (odds ratio 6.78; p < 0.001). Fast detection of susceptibility to EMB drug is possible by PCR-RFLP. The embB306 locus is a candidate marker for rapid prediction of high resistance consisting of MDR and XDR forms to anti-tuberculosis drugs using this method.

Next-generation sequencing of multiple individuals per barcoded library by deconvolution of sequenced amplicons using endonuclease fragment analysis.

The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72 individuals using only 24 barcoded libraries.

Species specific cpDNA markers useful for studies on the hybridisation between Pinus mugo and P. sylvestris

PCR-RFLP technique has been used to detect species-specific mutations of organelles DNA for closely related dwarf mountain pine (&lt;em&gt;Pinus mugo&lt;/em&gt;) and Scots pine (&lt;em&gt;P. sylvestris&lt;/em&gt;). Restriction fragment patterns have been compared of amplification products for &lt;em&gt;trn&lt;/em&gt;L-&lt;em&gt;trn&lt;/em&gt;F cpDNA and for &lt;em&gt;cox&lt;/em&gt;I and &lt;em&gt;orf&lt;/em&gt;25 genes of mtDNA. The difference has been found in the Dral and Hinfl restriction patterns of the amplification products for &lt;em&gt;trn&lt;/em&gt;L-&lt;em&gt;trn&lt;/em&gt;F region of cpDNA with two haplotypes detected. The haplotype M is characteristic for &lt;em&gt;P. mugo&lt;/em&gt; and the haplotype S for &lt;em&gt;P. sylvestris&lt;/em&gt;. These markers may be useful for the analysis of the natural hybridisation and introgression between these species postulated for some sympatric populations on the basis of morphological analysis. No differences have been disclosed in the studied mtDNA regions.

Protein modeling of cathepsin C mutations found in Papillon–Lefèvre syndrome

BackgroundPapillon–Lefèvre syndrome (PLS) is a rare autosomal recessive disorder characterized by hyperkeratosis involving the palms, soles, elbows, and knees followed by periodontitis, destruction of alveolar bone, and loss of primary and permanent teeth. Mutations of the lysosomal protease cathepsin C gene (CTSC) have been shown to be the genetic cause of PLS. This study analyzed CTSC mutations in five Iranian families with PLS and modeled the protein for mutations found in two of them. MethodsDNA analysis was performed by direct automated sequencing of genomic DNA amplified from exonic regions and associated splice intron site junctions of CTSC. RFLP analyses were performed to investigate the presence of previously unidentified mutation(s) in control groups. Protein homology modeling of the deduced novel mutations (P35 delL and R272P) was performed using the online Swiss-Prot server for automated modeling and analyzed and tested with special bioinformatics tools to better understand the structural effects caused by mutations in cathepsin C protein (CTSC). ResultsSix Iranian patients with PLS experienced premature tooth loss and palm plantar hyperkeratosis. Sequence analysis of CTSC revealed a novel mutation (P35delL) in exon 1 of Patient 1, and four previously reported mutations; R210X in Patient 2, R272P in Patient 3, Q312R in two siblings of family 4 (Patients 4 and 5), and CS043636 in Patient 6. RFLP analyses revealed different restriction fragment patterns between 50 healthy controls and patients for the P35delL mutation. Modeling of the mutations found in CTSC, P35delL in Patient 1 and R272P in Patient 3 revealed structural effects, which caused the functional abnormalities of the mutated proteins. ConclusionsThe presence of this mutation in these patients provides evidence for founder CTSC mutations in PLS. This newly identified P35delL mutation leads to the loss of a leucine residue in the protein. The result of this study indicates that the phenotypes observed in these two patients are likely due to CTSC mutations. Also, structural analyses of the altered proteins identified changes in energy and stereochemistry that likely alter protein function.

Catfish Species Identification Using Lab-On-Chip PCR-RFLP

Lab-on-a-chip based Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) technology was developed for the identification of seven catfish species including an Ictalurid hybrid. RFLP profiles of mitochondrial cytochrome b fragments digested by three different restriction endonucleases (DdeI, HaeIII, and NlaIII) were constructed from morphologically verified catfish samples on an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA). High sensitivity and ease of handling through end-point microchip-based capillary electrophoresis increased resolution and accuracy of DNA fragment sizing. RFLP profiles derived from a combination of all three enzymes produced consistent species-specific identification profiles. Observed restriction fragment patterns for Clarias batrachus and Ictalurus punctatus were similar, but both of these species could be consistently differentiated using a single band of the HaeIII restriction site. Assay advantages due to shorter assay times, assay ease, and minimum usage of harmful solvents and chemicals when compared to traditional DNA barcoding were counterbalanced by the need to develop and optimize specific restriction digest profiles for all potential species of interest. With further development, this method may be utilized in testing of catfish products to ensure the enforcement of seafood labeling regulations.

Isolation and characterization of pseudorabies virus from a wolf (Canis lupus) from Belgium

Aujeszky’s disease is an economically important disease in domestic pigs caused by the alphaherpesvirus pseudorabies virus (PRV). However, also wild boars are a natural reservoir for the virus, and this can lead to infection of wildlife carnivore species. Three wolves held in the wildlife park of Han-sur-Lesse in the province of Namur in Belgium were suspected to be infected with PRV based on the nervous symptoms they showed after being fed with wild boar offal. The diagnosis was confirmed for a female wolf by a positive real-time PCR detecting PRV. The virus was isolated from the brain tissue of the wolf and characterized by restriction fragment length polymorphism analysis and phylogenetic analysis. The obtained BamHI restriction fragment pattern of the wolf isolate was similar to that of the reference strain Kaplan, thereby characterizing it as a type Ip isolate. Type I PRV strains, and particularly subtype Ip, are predominant in European wild boar. Phylogenetic analysis based on the sequence of a fragment of glycoprotein C showed that the Belgian isolate belonged to cluster B and that the sequence was identical to that of wild boar isolates from southwestern Germany, eastern France, and Spain. This study is the first report of Aujeszky’s disease in wolves and shows that they are susceptible to PRV by eating infected wild boar offal leading to fatal neurological disease. This illustrates the possible implications of PRV-infected wild boar for the conservation of wolves and other carnivore species.

Characteristics and genetic diversity of bioluminescent Shewanella woodyi strains isolated from the Gulf of Izmir, Turkey

The purpose of this study was to isolate bioluminescent strains and to phenotypically and biochemically identify them based on the 16S rRNA gene sequence. 16S rRNA gene sequence analysis of the 11 isolates revealed that they belonged to Shewanella woodyi. Nevertheless, they were determined to exhibit various growth characteristics, enzymatic activities, assimilation of carbon and nitrogen sources, and different characteristics in antibiotic resistance profiles, and also, it was determined that different growth conditions affect the amount of biofilm. Pulsed-field gel electrophoresis (PFGE) analysis of S. woodyi strains performed with SmaI and NotI restriction enzymes revealed that they exhibited restriction fragment pattern homology ranging from 56 to 89 % and from 82 to 94 %, respectively. As a result, PFGE analysis of the genome S. woodyi (as the first record) revealed that although these strains inhabiting the Gulf of Izmir exhibit common characteristics, they also have high levels of genomic polymorphism.

MORPHOLOGY AND GENETIC DIVERSITY OF MITOCHONDRIAL DNA D-LOOP REGION USING PCR-RFLP ANALYSIS IN MAGELANG DUCK AND OTHER NATIVE DUCK

The aim of this study was to investigate the different of plumage colors on morphological diversityof Magelang duck and genetic diversity using PCR-RFLP mtDNA D-loop region analysis of Magelangduck and four others native duck population (Tegal, Mojosari, Bali and Alabio duck) in Indonesia. Bloodsample was taken from 50 Magelang ducks and 20 of each native ducks. Morphological characteristicsof body measurement, production ability and egg quality of Magelang duck were analyzed usingCompletely Randomized Design with 11 plumage colors as treatments. PCR technique was administeredto amplify fragments in mtDNA D-loop region and PCR products were digested with endonucleaserestriction enzyme AluI and HaeIII. The result showed that morphology diversity of Magelang duck wasstatistically affected by different plumage colors. PCR-RFLP analysis using AluI and HaeIII restrictionenzyme resulted in six combinations of restriction fragment pattern shown in six haplotypes (A, B, C, D,E and F). Haplotype difference showed genetic diversity in the population of Magelang duck and theother native ducks. In conclusion, the different plumage colors affected morphology diversity ofMagelang duck. Genetic diversity of Indonesian native duck population could be identified by usingPCR-RFLP analysis on mtDNA D-loop region.

Characterization and genotyping by pulsed-field gel electrophoresis (PFGE) of the first bioluminescent Vibrio gigantis strains

The genus Vibrio, which included 20 species in 1981, increased up to 63 in 2004 and in the last 10 years, 15 new species including Vibrio gigantis have been added. In this study, 20 bioluminescent bacteria were isolated and identified. The identification of the species whose various physiological and biochemical characteristics were identified was based on 16S rRNA gene region and it was determined that it belongs to the V. gigantis species. It was concluded that from the range of temperature and sodium chloride (NaCl) concentration needed, the phenotypic characteristics of the species of this genus used to distinguish them might vary. It was determined that their reproductive ability varied significantly especially in the media containing 0.5 and 9% of NaCl and at incubation temperatures of 4 and 30°C. These differences appeared in various enzymatic activities too. As a result of pulsed-field gel electrophoresis (PFGE) analysis, it was concluded that the genomes of the bioluminescence V. gigantis strains were not completely identical, and had genome homology ranging from 70 to 94% of restriction fragment patterns homology. Therefore, this study is the first one indicating that V. gigantis strains have a bioluminescence feature and high rate of genomic polymorphism. Key words: Vibrio gigantis, bioluminescent bacteria, 16S rRNA, pulsed-field gel electrophoresis (PFGE).

DNA Polymorphism of Insulin-like Growth Factor-binding Protein-3 Gene and Its Association with Cashmere Traits in Cashmere Goats.

Insulin-like growth factor binding protein-3 (IGFBP-3) gene is important for regulation of growth and development in mammals. The present investigation was carried out to study DNA polymorphism by PCR-RFLP of IGFBP-3 gene and its effect on fibre traits of Chinese Inner Mongolian cashmere goats. The fibre traits data investigated were cashmere fibre diameter, combed cashmere weight, cashmere fibre length and guard hair length. Four hundred and forty-four animals were used to detect polymorphisms in the hircine IGFBP-3 gene. A 316-bp fragment of the IGFBP-3 gene in exon 2 was amplified and digested with HaeIII restriction enzyme. Three patterns of restriction fragments were observed in the populations. The frequency of AA, AB and BB genotypes was 0.58, 0.33 and 0.09 respectively. The allelic frequency of the A and B allele was 0.75 and 0.25 respectively. Nucleotide sequencing revealed a C>G transition in the exon 2 region of the IGFBP-3 gene resulting in R158G change which caused the polymorphism. Least squares analysis revealed a significant effect of genotypes on cashmere weight (p<0.0001), cashmere fibre length (p<0.001) and hair length (p<0.05) of the animals. The effect of genotypes on cashmere fibre diameter was not statistically significant (p>0.05). The animals of AB and BB genotypes showed higher cashmere weight, cashmere fibre length and hair length than the animals possessing AA genotype. These results suggested that polymorphisms in the hircine IGFBP-3 gene might be a potential molecular marker for cashmere weight in cashmere goats.

First Report of Beet mild curly top virus in Dry Bean in Zacatecas, Mexico.

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico.

Güneydoğu Anadolu Bölgesi tahıl alanlarında tahıl kist nematodu, Heterodera avenae group türlerinin belirlenmesi

Summary The Heterodere avenae group includes 12 species that affect roots of cereals and three species [H. avenae (Wollenweber, 1924), H. filipjevi [(Madzhidov, 1981) Stelter 1984)], H. latipons (Franklin 1969)] are among the most economically important cyst nematodes pest to cultivated cereals in different part of Turkey. In this study, morphological and molecular characterization of 14 cereal cyst populations collected in cereal fields of Southeast Anatolia (Gaziantep, Hatay, Kahramanmaras, Kilis and Mardin) of Turkey were identified. Morphological characters and morphometric measurements of the cysts and second stage juveniles of the isolated populations were studied. Molecular characterization of cereal cyst nematode species showed distinct restriction fragment patterns of the ITSrDNA following PCR amplification and RFLP digestion with two endonucleases (Alu I, Pst I). Our results revealed that Hatay populations were identified as H. avenae type A, Gaziantep and Kilis populations as H. latipons, Kahramanmaras populations as H. filipjevi and Mardin populations as H. avenae type A, H. avenae type B and H. latipons.