Report Of Impatiens Necrotic Spot Virus Research Articles

First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China.

Tulbaghia violaceaHarv. indigenous to southern African countries, is an herbaceous perennial bulbous plant belonging to the familyAmaryllidaceae. It is a popular garden plant in China. This attractive plant is traditionally used as medicine and repellent (Kubec et al. 2002; Moodley et al. 2015). In June 2021,T. violaceaplants showing typical tospovirus-like symptoms of chlorotic rings patterns, were found at the campus of Yunnan University of Chinese Medicine (Fig.S1). Disease incidence was about 11.0% during the field survey. Total RNA was extracted from symptomatic leaves of T. violacea plants using the TRIzol reagent (ambio, Carlsbad, CA). Reverse transcription (RT)-PCR was conducted to identify thevirus using RNA extract as the template. The degenerate primers (dTospo-F2 and dTospo-R2) (Huang et al. 2018) were used to amplify the conserved regions of the orthotospoviral L RNA sequences. No amplification was obtained from extracts of two asymptomatic plants. The amplicons from four symptomatic samples were cloned into the pMD19-T vector (TaKaRa) and sequenced (three clones for each amplicon) by Tsingke (Shanghai, China). The obtained DNA fragments were determined to be 312 bp. The sequences from four symptomatic samples were identical (GenBank acc.no. OK258285) and shared the highest nucleotide identities (98.0%) with a corresponding sequence of segment L of impatiens necrotic spot virus (INSV) isolated (GQ336991) from Phalaenopsis amabilis in Yunnan province, China. To further confirm the INSV infection to T. violacea, the samples were analyzed with the specific primers for the N, NSs and NSm genes of INSV (Table S1), respectively. Amplicons of the expected size, 789 bp, 1344 bp and 912 bp, were produced, respectively. Amplicons were cloned and sequenced. The 789-bp N (ON529554) and 1344-bp NSs (ON529554) gene sequences had 99.1% and 99.3% nucleotide identities with the corresponding region of previously described INSV Phalenopsis isolate (GQ336989), respectively. The 912-bp NSm (ON529553) gene sequence shared 99.5% nucleotide identity with the corresponding region of INSV Phalenopsis isolate (GQ336990). Metavirome and Sanger sequencing were used to complete the genome of INSV from T. violacea. The leaves of the symptomatic sample were used to construct an rRNA-depleted library using Nextera XT reagents (Illumina, San Diego, CA). The library was subjected to RNA-Seq a NovaSeq 6000 platform (Illumina, San Diego, CA). A total of 33,193,233 quality-filtered reads were obtained using BBMAP (https://github.com/BioInfoTools/BBMapBBMap-BushnellB.-sourceforge.net/projects/bbmap/). Among 161052 reads mapped to virus sequences, 151407 reads (read ratios 94.0%) were mapped to INSV. Three complete segments of INSV genome were determined to 8,778 nt (L segment, Acc. No. ON529552), 4,958 nt (M segment, Acc. No. ON529553), and 2,983 nt (S segment, Acc. No. ON529554) in length. These segments were validated by RT-PCR and Sanger sequencing. Three segments share nucleotide sequence identities of 99.6%, 99.3% and 98.9% with the L (GQ336991), M (GQ336990) and S segments (GQ336989) of INSV Phalenopsis isolate, respectively. The results of sequence comparisons showed no evidence of reassortment between INSV and another orthotospovirus.There was a report of tomato spotted wilt virus infecting T. violacea in Florida, USA (Dey et al. 2019). No other virus infecting T. violacea was reported. INSV has been reported to infect several economically important crops including Phalenopsis, pepper etc. in China (Chen et al. 2016). INSV-infected T. violacea not only losses landscaping value but also plays an important intermedia host role in the spread of INSV. Additional surveys and evaluation will be needed to understand the potential medicinal effect of this virus on this plant. To our knowledge, this is first report of INSV in T. violacea.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece

HomePlant DiseaseVol. 104, No. 10First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Impatiens Necrotic Spot Virus Infecting Lettuce in GreeceD. Beris, I. Malandraki, O. Kektsidou, N. Vassilakos, and C. VarveriD. Beris†Corresponding author: D. Beris; E-mail Address: d.mperi@bpi.grhttp://orcid.org/0000-0003-3308-8742Laboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, I. Malandrakihttp://orcid.org/0000-0001-5623-5261Laboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, O. KektsidouLaboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, N. VassilakosLaboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, and C. VarveriLaboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this authorAffiliationsAuthors and Affiliations D. Beris † I. Malandraki O. Kektsidou N. Vassilakos C. Varveri Laboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, Greece Published Online:18 Aug 2020https://doi.org/10.1094/PDIS-11-19-2316-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat During the autumn of 2018 and the winter of 2019, virus-like disease symptoms were observed in four fields of lettuce (Lactuca sativa) in Kalamos, Marathonas, and Leonidio regions of central and south-eastern Greece. In all cases, the disease affected 30 to 40% of the plants. Symptoms consisted of brown ringspots, necrotic lesions, vein necrosis, and leaf distortion resembling those associated with tospovirus infections. Six symptomatic plants (four in 2018 and two in 2019) were collected from four different fields and were tested for the presence of tomato spotted wilt virus (TSWV), tomato chlorotic spot virus (TCSV), impatiens necrotic spot virus (INSV), groundnut ringspot virus (GRSV), and chrysanthemum stem necrosis virus (CSNV) with double antibody sandwich ELISA specific and generic polyclonal antisera, respectively (Loewe Biochemica, Germany). All samples were found negative for TSWV but positive for other Tospovirus infection with the generic ELISA test. Total RNA was purified from all six symptomatic samples and reverse transcription polymerase chain reaction (RT-PCR) was performed with the gM410/gM870c primer pair (Chen et al. 2012) targeting the conserved NSm genomic region of tospoviruses. Direct Sanger sequencing of the 500-bp PCR products obtained from all six samples revealed the presence of INSV Tospovirus, and showed 97.5 to 98.7% identity at nucleotide level with the respective region of the Chinese isolate HDL (GU112503). To further characterize our INSV isolate, total RNA isolated with NucleoZOL reagent (Macherey-Nagel, Germany) from one symptomatic lettuce was subjected to high-throughput sequencing (HTS) on a Next Seq platform (Illumina, U.S.A.) by using the TruSeq Stranded mRNA Library Prep kit (Illumina) for the construction of the poly-A selected HTS library. The analysis generated approximately 14,000,000 single-end reads of 75-bp length that were analyzed with Geneious bioinformatics software (Biomatters, New Zealand). After the de novo assembly of the unique reads (7,448,124 reads), contigs (in total 108,234 contigs ranging in size from 150 to 12,000 bp) were annotated with BLAST, and the presence of INSV was confirmed. Assembled nucleotide sequences of S (MN553562) and M (MN553561) segments exhibited 88 to 98% coverage and 99% identity at nucleotide level with an Italian isolate (DQ425096 and DQ425095, respectively). Nucleotide sequence of the L segment also showed 64% coverage with 88% identity with the Italian isolate (DQ425094). Furthermore, HTS analysis revealed the presence of lettuce big-vein associated virus (LBVaV, Rhabdoviridae, Varicosavirus genus). To isolate INSV, Nicotiana tabacum, an insusceptible host of LBVaV, was used. Infected N. tabacum tissues were used to reproduce symptoms in virus-tested-negative lettuce plants after mechanical inoculation. In the latter plants, INSV presence was confirmed with RT-PCR assays targeting specific regions of the three INSV segments by respective primer pairs designed based on the HTS analysis. Sequences of the three PCR products were 100% identical with the HTS-assembled INSV segments of the respective regions and confirmed the presence of all virus segments. INSV was first described in Impatiens spp. plants (Law and Moyer 1990) and is an important pathogen for several crops including ornamental plants, tomato, and lettuce (Kuo et al. 2014). The relatively high incidence of the virus in different regions of Greece suggests that INSV is an emerging pest for lettuce cultivation in Greece. To the best of our knowledge, this is the first report of INSV in Greece.The author(s) declare no conflict of interest.

First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea

In 2016, less than 30% of virus-like symptoms such as chlorosis, necrosis and ringspots were observed in Hoya carnosa from commercial greenhouse in Eumseong, Korea. A total of 6 samples from Hoya carnosa were collected both symptomatic and asymptomatic plants and tested for virus infection by RT-PCR of 3 viruses known to infect Hoya spp. including Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV) and Tomato chlorotic spot virus (TCSV). Three symptomatic samples were positives for INSV. Also, it was not the virus detected in three asymptomatic samples. To further confirm the presence of INSV, complete nucleocapsid (N) gene of the virus were amplified and sequenced from two samples. BLAST analysis of the consensus sequence showed that two isolates (INSV-Hy1 and -Hy2) shared nucleotide sequence identities of 99% with each other and 97-99% with other INSV isolates available in the GenbBank. Phylogenetic analysis showed that these isolates closely related to the INSV isolates from ornamental from China. This is the first report of INSV on Hoya carnosa from Korea.

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants.

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops.

First Report of Impatiens necrotic spot virus on Begonia in Bosnia and Herzegovina.

Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) are the most serious viral pathogens in the production of ornamental plants in Europe and North America (1). During a survey for the presence of tospoviruses in July 2012, potted begonia hybrids (Begonia × tuberhybrida Voss) exhibiting foliar chlorotic rings and zonal spots accompanied by leaf necrosis and distortion, were observed in a greenhouse in the vicinity of Banja Luka (Bosnia and Herzegovina). Leaf samples collected from 12 symptomatic plants were analyzed for the presence of INSV and TSWV by commercial double-antibody sandwich (DAS)-ELISA kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy begonia leaves were included in each ELISA. INSV was detected serologically in all 12 begonia samples and all tested samples were negative for TSWV. Five healthy plants of each Petunia × hybrida and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (157-12) using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulphite. Local necrotic lesions on P. × hybrida and systemic chlorotic mottling on N. benthamiana were observed on all inoculated plants 4 and 10 days post-inoculation, respectively. For further confirmation of INSV infection, total RNAs were extracted from all ELISA-positive begonia plants as well as mechanically inoculated N. benthamiana plants with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used as template in reverse transcription (RT)-PCR. RT-PCR was performed with the OneStep RT-PCR Kit (Qiagen) using primer pair INSV-589 and TOS-R15 (3), specific to the partial INSV nucleocapsid (N) gene. Total RNA obtained from Serbian INSV isolate from a begonia (GenBank Accession No. HQ724289) and RNA extracts from healthy begonia plants were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (589 bp), while no amplification products were obtained from the healthy controls. The RT-PCR product derived from the isolate 157-12 was sequenced directly after purification with QIAquick PCR Purification Kit (Qiagen) and submitted to GenBank (KC494869). Pairwise comparison of the 157-12 isolate N sequence with other homologous sequences available in GenBank, conducted using MEGA5 software (2), revealed that begonia isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with the Chinese INSV isolate (FN400772) originating from Oncidium sp. To our knowledge, this is the first report of INSV on begonia in Bosnia and Herzegovina. Begonias are very popular and widely grown ornamentals in Bosnia and Herzegovina and the presence of a new and devastating pathogen could represent a serious threat for its production. Since begonia is commonly grown together with numerous ornamental plants susceptible to INSV, further investigations are needed in order to prevent spread of this potentially harmful pathogen to new hosts in Bosnia and Herzegovina.

Occurrence of Impatiens necrotic spot virus and Tomato spotted wilt virus on Potatoes in Iran

There have been an increasing number of records of the natural infection of various crops and ornamentals in Iran with Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus (TSWV), and Tomato yellow fruit ring virus (TYFRV), a recently proposed species in the genus Topovirus (3). TYFRV, originally believed to be TSWV and named as such, has been previously reported to occur in Iranian potato fields (2). During the growing seasons of 2004 to 2006, surveys were conducted in potato fields in different potato-producing (Solanum tuberosum) provinces of Iran (Ardabil, Azarbayejan-e-sharqi, Chaharmahal-va-bakhtiyari, Esfahan, Hamedan, Kerman, Khorasan, Khuzestan, Lorestan, Tehran, Qazvin, and Zanjan) to detect the presence of Tospovirus spp. infecting this crop, including Groundnut ringspot virus (GRSV), INSV, Iris yellow spot virus (IYSV), Tomato chlorotic spot virus (TCSV), TSWV, TYFRV, and Watermelon silver mottle virus (WSMoV). Overall, 186 fields were surveyed, and 2,823 potato leaf samples from plants showing tospovirus-like symptoms of chlorotic or necrotic spots, chlorosis, and necrosis were collected before or through the flowering stage, approximately 50 to 90 days after planting. Each leaf sample was tested by double-antibody sandwich (DAS)-ELISA using specific antisera (Bioreba, Reinach, Switzerland; Loewe, Sauerlach, Germany; DSMZ, Braunschweig, Germany) for the presence of the aforementioned tospoviruses. TYFRV, TSWV, and INSV were found in 24.0, 4.1, and 0.4% of the samples collected from 133, 51, and 7 fields surveyed, respectively. None of the samples had a positive reaction in ELISA to GRSV, IYSV, TCSV, and WSMoV. To confirm this testing, a number of the leaf samples that were found to be positive for INSV, TSWV, and TYFRV in ELISA tests were mechanically inoculated on Petunia × hybrid and Nicotiana benthamiana; the inoculated plants showed typical necrotic local lesions of tospoviruses and chlorotic or necrotic spots followed by systemic infection, respectively; their infection was subsequently confirmed by ELISA. The samples also were tested by reverse transcription-PCR technique using previously described specific primers (1,4). The PCR reaction resulted in the specific amplification of a 0.59-, 0.71-, and 0.67-kb (or 1.2-kb) fragment of INSV, TSWV, and TYFRV RNAs, respectively. This study showed that tospoviruses, especially TYFRV, are widespread in Iranian potato fields. It is hoped that the results may help us to improve a seed potato certification program in the future. To our knowledge, this is the first report of INSV and TSWV from potatoes in Iran.

First Report of Impatiens necrotic spot virus on Spiderlily in China.

Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) is a devastating disease in the production of ornamental flowers (1). From 2007 to 2009, a survey of 10 major parks and recreation areas in Kunming, the capital of Yunnan Province, China, indicated that approximately 60 to 70% of Spiderlily (Hymenocallis littoralis Salisb.) plants from eight parks had symptoms of concentric ring spots and necrotic spots. Symptomatic plants were tested for INSV and Tomato spotted wilt virus (TSWV) with an immunostrip (Agdia Inc. Elkhart, IN). Results indicated that only the samples designated HDL were positive for INSV and all other samples were negative for both INSV and TSWV. Mechanically inoculated Emilia sonchifolia, Nicotiana glutinosa, Impatiens balsamina, and N. rustica showed chlorotic lesions, concentric rings, and severe necrosis, symptoms typical for INSV in these hosts. Electron microscope inspection found tospovirus-like spheroidal, enveloped particles that were 90 nm in diameter. Primer 5 software (Premier, Canada) was used to design 14 primers from GenBank Accession No. NC_003625 to amplify the L RNA, nine from NC_003616 to amplify the M RNA, and six from NC_003624 to amplify the S RNA. With total RNA extracted from infected plant tissue as templates in reverse transcription (RT)-PCR, these primers generated 29 target fragments of 250 to 900 bp. These fragments were cloned with the vector pMD19 simple-T vector (Takara Bio Inc., Dalian, China) and sequenced. The sequences of the clones were aligned with the software DNAman (version 2.5; Lynnon Biosoft, Quebec, Canada), showing that RNAs L, M, and S are 8,776 bp (GenBank Accession No. GU112505), 4,948 bp (GenBank Accession No. GU112503), and 2,875 bp (GenBank Accession No. GU112504), respectively. BLAST analysis of these Spiderlily INSV sequences against the NCBI sequence database indicated that the RdRp protein (L RNA) was 99.6% identical with the RdRp protein from an Italian isolate (No. DQ425094), the Nsm protein (M RNA) has 99.0% identity with the Nsm protein from an isolate from Italy (No. DQ425095) and one from the United States (No. NC_003616), the G1G2 polyprotein (M RNA) has 99.9% identity with the analogous protein from an Italian isolate (No. DQ425095), the N protein (S RNA) has 99.6% identity with the N protein from an Italian isolate (No. DQ425096), and the NSs protein (S RNA) has 98.7% identity with the NSs protein from an isolate from Japan (No. AB109100). To our knowledge, this is the first report of INSV on Spiderlily in China. Reference: (1) A. E. Whitfield et al. Annu. Rev. Phytopathol. 43:459, 2005.

インパチエンスネクロティックスポットウイルスによるシネラリアえそ斑紋病

In February 1999, cineraria (Senecio×hybridus) plants with necrotic ring spot were found in Okayama Prefecture, Japan. A spherical virus with a diameter of ca. 85∼120nm was isolated. The virus infected seven plant species of four families after mechanical inoculation. In serological tests, the virus was closely related to Impatiens necrotic spot virus (INSV). In RT-PCR with INSV-specific primers, a fragment of about 900bp was amplified. The fragment had a high degree of nucleotide sequence homology with the S RNA of INSV. Based on these results, the virus isolated from cineraria was identified as INSV. This is the first report of INSV on cineraria in Japan.