Report Of Bacterial Blight Research Articles

First Report of Bacterial Blight on arugula (Eruca vesicaria subsp. sativa) caused by Pseudomonas cannabina pv. alisalensis in New York.

Bacterial blight of arugula (Eruca vesicaria subsp. sativa cv. Standard) was observed in a commercial crop being grown in a high tunnel under overhead irrigation in Argyle, NY in January 2021. Approximately 80-100% of the plants were affected. Symptoms started as small, angular, water-soaked lesions visible on both sides of the leaves, then expanded, coalesced and later dried and turned tan. Fluorescent pseudomonads from five different plants were isolated on King's medium B agar amended with boric acid, chloramphenicol, and cycloheximide (Schaad et al. 2001) from surface disinfested symptomatic leaf tissues macerated in phosphate buffer (10mM, pH 7.0). Five representative isolates from each of the five plants produced levan and were negative for arginine dihydrolase and oxidase. They did not rot potatoes but were able to induce a hypersensitive reaction on tobacco (Nicotiana tabacum L. cv Glurk) within 24 h, thus demonstrating that the isolates belonged to LOPAT group 1 (Lelliott et al. 1966). DNA fragment banding patterns of these isolates generated by repetitive extragenic palindromic sequence PCR (repPCR) with BOXA1R primers were compared to the pathotype strains of Pseudomonas cannabina pv. alisalensis and Pseudomonas syringae pv. maculicola, known fluorescent pathogens of the Brassicaceae. The repPCR banding pattern of all isolates matched the pattern of Pseudomonas cannabina pv. alisalensis. Bacterial inoculum for pathogenicity experiments was prepared from 48 h KBBC agar cultures suspended in phosphate buffer (10mM, pH 7.0) and adjusted to 0.6 optical density at 600nm yielding approximately 108 CFU/ml. Five-week-old arugula plants were sprayed until run-off with one of the three isolates from arugula, a negative control (sterile buffer), or a positive control (P. cannabina pv. alisalensis) that is pathogenic to crucifers and also reported to cause disease on arugula in California (Bull et al. 2004). Experiments consisted of three replications of each treatment and two independent experiments were conducted. Small water-soaked spots resembling the original symptoms developed on all plants inoculated with the three representative isolates and P. cannabina pv. alisalensis. Moreover, reisolates from the symptomatic tissues were fluorescent on KBBC and had identical repPCR banding pattern as inoculated strains, demonstrating Koch's postulates. To our knowledge, this is the first report of bacterial blight on arugula caused by Pseudomonas cannabina pv. alisalensis in the Northeastern US. It was previously reported in California, Nevada, and Minnesota (Bull and du Toit 2009; Bull et al. 2004). This report may have significance for all brassica leafy green growers in the Northeast as P. cannabina pv. alisalensis has a broad host range including members of the Brassicaceae and oats which are commonly used as cover crops in mixed vegetable production.

Bacterial blight on Dracaena sanderiana caused by Burkholderia cepacia

In 2018, severe bacterial blight was observed on Dracaena sanderiana plants imported and cultivated by a commercial nursery in Jinju, South Korea. This indoor plant is popularly grown for indoor air purification to prevent sick building syndrome (SBS). The diseased plants had severe blight symptoms, with leaf chlorosis and crumpling of stem and leaves. To identify the causal agent, we performed bacterial isolation, pathogenicity tests, physiological analysis, sequencing of the 16S rRNA region and recA gene, and phylogenetic analysis; the bacterial pathogen was identified as Burkholderia cepacia. This is the first report of bacterial blight on D. sanderiana caused by B. cepacia. Although there is no clear epidemiological information on the inoculum source, the recent occurrence of the disease indicates that B. cepacia is a potential threat to the production of indoor dracaena plants, which are increasingly used for air purification in SBS. Because D. sanderiana is grown in indoor living spaces, B. cepacia infection could threaten human health as well.

First Report of Bacterial Blight of Peony Caused by Xanthomonas hortorum in Ohio

First Report of Bacterial Blight of Peony Caused by <i>Xanthomonas hortorum</i> in Ohio

Bacterial Blight of Lentil (Lens culinaris) Caused by Pseudomonas syringae pv. syringae

In June 2017, plants were observed in a commercial lentil (Lens culinaris Medikus) field in Central South Dakota with brown, circular lesions on the foliage leaves that had dried, torn centers resembling “shot holes.” The pathogen was confirmed to be Pseudomonas syringae pv. syringae. This is the first known report of bacterial blight caused by P. syringae pv. syringae on lentil anywhere lentils are grown.

First Report of Bacterial Blight of Pomegranate Caused by Xanthomonas axonopodis pv. punicae in Turkey.

Pomegranate (Punica granatum L.) is an increasingly important fruit crop that is widely cultivated in Turkey. Typical bacterial blight symptoms were observed since spring of 2011 in pomegranate orchards located in Antalya Province. Symptoms were characterized by dark brown, angular to irregularly shaped spots on leaves and fruit; cankers on stems, branches, and trunks; and split trunks. The pathogen was isolated from leaf spots on naturally infected plants showing typical symptoms onto yeast dextrose chalk agar. Bright yellow bacterial colonies were consistently isolated. Bacterial strains were characterized as gram negative, oxidase negative, catalase positive, tobacco hypersensitivity positive, and able to produce acid from L-arabinose, D-galactose, D-glucose, and D-mannitol but not from D-xylose. Pathogenicity of the representative bacterial strain Serik-4 was performed on 2-year-old pomegranate plants cv. Hicaz. Leaves were sprayed until runoff with bacterial cell suspensions containing 107 CFU/ml. Inoculated plants were covered with transparent plastic bags to maintain moisture for 48 h. Negative control plants were inoculated with sterile distilled water. Plants were then incubated in a greenhouse at 30°C for 14 days. Symptoms on leaves included dark brown, angular to irregularly shaped water soaked lesions along the veins of the inoculated plants 10 days after inoculation. No lesions developed on the control plants. The symptoms on inoculated plants were similar to those on naturally infected plants. Yellow bacterial colonies were re-isolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis, thus fulfilling Koch's postulates. Fatty acid methyl ester profiling of the representative strain Serik-4 using GC-MIDI (Microbial Identification Inc, Newark, DE) identified the genus of the bacterium as Xanthomonas. The identity of Serik-4 was further confirmed by amplifying the 16S rRNA gene with the universal primers 27F and 1492R (3) and sequence analysis (GenBank Accession No. KM007073). The 16S rRNA gene sequences of Serik-4 was 99% identical to the corresponding gene sequences of the Xanthomonas axonopodis pv. punicae strain present in the NCBI database (JQ067629.1). High incidence of bacterial blight caused by X. axonopodis pv. punicae on pomegranate has been previously reported in India (2), Pakistan (1), and South Africa (4). To our knowledge, this is the first report of bacterial blight on pomegranate caused by X. axonopodis pv. punicae in Turkey.

First Report of Bacterial Blight Caused by Pseudomonas syringae pv. pisi on Pea in Turkey.

In April of 2009, leaf blight symptoms were observed on field peas (Pisum sativum L.) grown in Söke, Torbali, and Ödemis counties in the Aegean Region of Turkey. Field inspections revealed disease incidence as high as 45% and the disease was found in 13 commercial fields. Initial symptoms consisted of small, dark green, water-soaked lesions on leaves, stipules, and stems near ground level. Lesions often enlarged and coalesced and turned chocolate brown with a water-soaked margin. Stem infections usually coalesced and girdled the stem spreading upward to stipules and leaflets forming a fan-like lesion on the stipule. A fluorescent, gram-negative bacterium was consistently isolated from diseased tissues onto King's B medium. Twelve strains (five from cv. Early Sweet, three from cv. Geneva, two from cv. Bolero, and two from cv. Carina) from thirteen pea fields were obtained. All strains metabolized glucose oxidatively, and their reactions in LOPAT tests were +, -, -, -, +, and thus classified as belonging to Pseudomonas syringae LOPAT group Ia (1). The 12 strains utilized homoserine, inositol, sorbitol, sucrose, mannitol, and mannose but did not utilize erythritol, trehalose, and L-tartarate. All showed ice nucleation activity but variable results were obtained for gelatin liquefaction and esculin hydrolysis. Identification of P. syringae pv. pisi was confirmed by sequencing the 16S rDNA with primers Univ-1390R (3) and 27F (2). Sequences of the three local strains (Bz2, Bz4, and Bz8) were 100% identical to a type culture strain. The nucleotide sequence of strain Bz4 was submitted to GenBank (Accession No. GU332546). Pathogenicity tests were performed on greenhouse-grown 2-week-old pea plants cv. Geneva as three replicates in 12-cm pots containing a steamed sand/peat/soil mixture. Plants were stab inoculated by puncturing the main stem at its junction with the stipules at the second node from the apical end with a 26-gauge needle through a 5-μl drop of 108 CFU/ml bacterial suspensions. Control plants were inoculated with sterile water. After 10 days of incubation in a growth chamber at 24 ± 1°C with a 14-h photoperiod, stems inoculated with pea isolates resulted in water-soaked tissue spreading from the site of inoculation along the veins on stipules and leaflets that were identical to symptoms seen in the field. Control plants remained symptomless. Isolates recovered from the symptomatic stems showed the same morphological and biochemical features of the original isolates. All physiological and biochemical tests as well as the pathogenicity assay were performed at least twice and the type strain of P. syringae pv. pisi (NCPPB 2585) was used as reference. On the basis of the physiological, biochemical, genetic, and pathological characteristics, all strains were identified as P. syringae pv. pisi. To our knowledge, this is the first report of P. syringae pv. pisi causing bacterial blight on pea in Turkey. Turkey currently produces approximately 93.000 t of peas annually and three-quarters of that is produced in Western Anatolia. The new disease may represent a limiting factor for future production.

Detection ofXanthomonas axonopodispv.punicaecausing bacterial blight on pomegranate in South Africa

In 2007, an outbreak of disease occurred in South African pomegranate orchards. The symptoms included leaf and fruit spots, and cankers on stems, branches and trunks. Based on biochemical and molecular analyses and pathogenicity tests, the bacterium Xanthomonas axonopodis pv. punicae was identified as the causal agent. This is the first report of bacterial blight on pomegranate in South Africa.

First Report of Bacterial Blight Caused by Pseudomonas viridiflava on Pea in Spain.

Because production of dry peas (Pisum sativum L.) is increasing in Spain, disease surveys were carried out from 2004 to 2006 in Castilla y Leon, the largest pea-producing region. In May of 2004, a leaf and stem blight caused an estimated 25% loss in yield in pea (cv. Messire) fields in El Cerrato (Palencia). Bacteria were isolated on King's B medium from 10 symptomatic plants from different fields (3). Thirty gram-negative isolates produced fluorescent, yellowish mucoid colonies. All isolates showed oxidative glucose metabolism on Hugh-Leifson medium and were levan and oxidase negative, potato soft rot positive, arginine dihydrolase negative, and tobacco hypersensitive positive. They also hydrolyzed esculine and gelatine. These results were different than those expected by Pseudomonas syringae pv. pisi and P. syringae pv. syringae (3). API 50 CH tests (bioMerieux, Marcy l'Etoile, France) revealed that all the isolates used the following carbon sources: glycerol, erythritol, l-arabinose, ribose, d-xylose, galactose, d-glucose, d-fructose, d-manose, inositol, manitol, sorbitol, d-raffinose, d-fucose, and d-arabitol. This nutritional profile is identical with that of P. viridiflava strain CFBP 6730, originally from pea plants in France. Therefore, these isolates were tentatively identified as P. viridiflava (2). Since a preliminary test demonstrated that 9 of the 30 isolates were pathogenic on pea plants, pathogenic isolates P44, P45, and P46 were selected arbitrarily for further tests. These three isolates plus strains HRI-W 1704 (P. syringae pv. pisi type race 6) and CFBP 1769 (P. syringae pv. syringae) were inoculated onto 10 pea seedlings (cv. Messire) each in two identical trials, following a described protocol (1). Seedlings inoculated with sterile distilled water were used as controls. After 10 days of incubation in a growth chamber at 22°C and 80% relative humidity, severe rotting and collapse similar to symptoms observed in fields appeared on pea seedlings inoculated with isolates P44, P45, and P46, while water-soaked leaf spots and necrotic symptoms were caused by P. syringae pv. pisi and P. pv. syringae. No symptoms were observed on plants inoculated with sterile water. Isolates recovered from symptomatic stems showed the same morphological and biochemical features of the original isolates. Sequences of 1,399 bp long from the three isolates (GenBank Accession Nos. GQ398128, GQ398129, and GQ398130) were 100% identical to P. viridiflava 16S rDNA database reference sequences. To our knowledge, this is the first report of P. viridiflava causing a disease of pea in Spain. The disease has been reported in New Zealand (4) and France (2).

First Report of Bacterial Blight Caused by Pseudomonas syringae pv. syringae on Common Vetch in Spain.

Common vetch (Vicia sativa L.) is an important legume crop used for livestock feed in the Mediterranean Area. This crop has an important role for sustainable agriculture in dryland rotations in Spain, where the Castilla y León Region is the major production area. During the springs of 2007 and 2008, necrotic lesions on stems, leaves, and flowers were observed in five different common vetch plots around Medina de Rioseco (Castilla y León). Four of the plots were sown with cv. Buza. No information was available about the cultivar in the fifth plot. In many cases, lesions had expanded into the stems causing complete wilting. Disease incidence was estimated at approximately 20%. Two symptomatic plants per plot were sampled. One section per plant was individually surface disinfested in 0.5% NaOCl for 1 min, followed by three washes in sterile water. Macerates were plated in King's B medium (KB) agar (24°C for 48 h) (2). Colonies from all isolations on KB agar were pale yellow and blue-green fluorescent under UV light, as typical of fluorescent Pseudomonas spp. (2). Ten isolates (one per section) were characterized. These were identified as Pseudomonas syringae by the LOPAT scheme (2) and Hugh-Leifson reaction and all utilized erythritol, l-lactate, and dl-homoserine, but not l(+)-tartrate, as carbon sources. They were positive for aesculin and gelatine hydrolysis. The 10 isolates caused severe necrotic lesions when they were puncture inoculated (108 CFU/ml suspension, 50 μl per wound, and two replicates) on immature lemon fruits (Citrus × limon, cv. Primofioro), bean pods (Phaseolus vulgaris L., cv. Ancha Lisa), and pea pods (Pisum sativum L., cv. Ucero). PCR amplification of a 752-bp syrB fragment (3) was positive for all isolates. On the basis of these tests, the 10 isolates were identified as P. syringae pv. syringae (2). Subsequently, each isolate was inoculated into two sets of 10 plants of V. sativa cv. Buza by injecting 200 μl of a bacterial suspension (108 CFU/ml) into the stem (2); 10 plants were injected with sterile water as controls. Ten days after inoculation, necrotic symptoms were observed on all plants, and 1 week later, all plants were completely wilted and dead. These symptoms were similar to those observed in the field. Control plants remained symptomless. Isolations were made from two inoculated plants per each original isolate, and all reisolates were identical to the original isolates in the above biochemical tests and PCR of the syrB gene. P. syringae pv. syringae reference strains, CFBP1768 and CFBP1769 (Collection Française de Bactéries Phytopathogènes), gave the same results in all biochemical, pathogenicity, and PCR tests. To our knowledge, this is the first report of bacterial blight caused by this pathogen on vetch in Spain. This pathogen had been previously identified in this crop in France (4) and in V. villosa (a closely related species) in the United States (1). Therefore, to prevent the spread of this pathogen, research on efficient preventive and control measures is needed.

First Report of Bacterial Blight on Conventionally and Organically Grown Arugula in Nevada Caused by Pseudomonas syringae pv. alisalensis

In 2007, leaf spots were observed on arugula (Eruca vesicaria subsp. sativa cv. My Way) grown under sprinkler irrigation for fresh market in conventional and organic production fields located above 1,200 m (4,000 feet) in Nevada (NV). Approximately 30% of each planting was affected. Initially, symptoms consisted of small (<2 mm in diameter), angular, water-soaked spots visible from both sides of the leaf, some of which developed a shot-hole appearance. The spots enlarged and coalesced, remaining angular. Lesions ranged from black to tan, occasionally developing a chlorotic or purple margin. Some lesions resembled symptoms of downy mildew on arugula, but microscopic examination revealed no sporangiophores associated with the lesions. Bacterial ooze was observed when sections of symptomatic leaves were examined microscopically. Blue-green fluorescent pseudomonads were isolated from lesions on King's medium B agar from three arugula plantings. Twelve strains (at least three from each planting) were evaluated along with known strains of Pseudomonas syringae pv. alisalensis and P. syringae pv. maculicola in all assays. Bacterial strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction on tobacco (Nicotiana tabacum L. cv. Sansun) indicating that the bacteria belonged to Lelliot's LOPAT group 1 (2). This was confirmed by analysis of fatty acid methyl esters (MIS-TSBA version 4.10; MIDI, Inc., Newark, DE), which indicated that the strains were highly similar (similarity >0.80) to P. syringae. Amplification of DNA between repetitive bacterial sequences (rep-PCR) using the BOXA1R primer resulted in identical banding patterns for the NV arugula strains and P. syringae pv. alisalensis from arugula in California (1). Koch's postulates were completed by confirming pathogenicity of the isolated strains on the arugula cvs. Italian and Astro. Strains were grown on nutrient agar for 48 h at 27°C, adjusted to 108 CFU/ml in sterile 0.01 M phosphate buffer (pH 7.0), and spray inoculated until runoff onto 2- to 3-week-old plants. Control plants were similarly sprayed with sterile phosphate buffer. Plants were held for 2 days in a mist chamber and 7 days on a greenhouse bench (24 to 26°C). Angular lesions similar to symptoms observed on the original plants developed on leaves of all inoculated arugula plants. In addition, some plants developed blackening of the smaller veins accompanied by chlorosis of the surrounding interveinal tissue in 10- to 20-mm diameter areas of the leaves. Small black lesions (as much as 10 mm long) were also observed on the petioles. Bacterial strains reisolated from the symptomatic tissue were identical to P. syringae pv. alisalensis by rep-PCR. Control plants remained symptomless. Similar inoculation and incubation methods confirmed that the host range of the NV arugula isolates was identical to that of known strains of P. syringae pv. alisalensis. The arugula and P. syringae pv. alisalensis isolates caused leaf spots on broccoli raab (Brassica rapa subsp. rapa cv. Sorento) and oats (Avena sativa cv. Montezuma). Pathogenicity tests were repeated. This confirms that the leaf spot observed on conventionally and organically grown arugula in NV was caused by P. syringae pv. alisalensis. To our knowledge, this is the first report of this disease on arugula in NV.

First Report of Aglaonema Bacterial Blight Caused by Erwinia chrysanthemi in Taiwan.

Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5' GCGGTTGTTCACCAGGTGTTTT 3') and 5B (5' ATGCACGCTACCTGGAAGTAT 3') specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 108 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3).

First report of bacterial blight caused by Acidovorax avenae ssp. avenae associated with finger millet seeds from Uganda

Finger millet (Eleusine coracana) is an important food crop for Uganda. Information on bacterial diseases of this crop in Uganda is limited. Adipala (1980) reported bacterial blight caused by Xanthomonas axonopodis pv. coracanae. Seedlings of finger millet grown in soil under controlled conditions (30°C, 12 h light/dark cycles) showed severe blight and necrotic stripe symptoms similar to those incited by Acidovorax avenae ssp. avenae. Seeds were further tested for this bacterium by a seedling symptom test (Shakya & Chung, 1983). Nine out of 10 seed samples collected from eastern, central, and western regions of Uganda showed 25–35% of seeds to be infected. Bacterial ooze was observed with a compound microscope from sections of leaves showing blight and stripe symptoms. A bacterium was isolated when leaf macerate was streaked on to nutrient agar or King’s medium B agar plates and incubated at 28 ± 2°C. Translucent, whitish-grey bacterial colonies measuring 2–3 mm and having fringed margins appeared after 24 h. The strains were identified by ELISA using antiserum raised against rice strain (DGISP 183 Nepal). Bacterial suspensions (108 CFU mL−1) of 17 different strains in sterile phosphate buffered saline from 24-h-old-cultures infiltrated into leaves of 2-month-old tobacco plants induced hypersensitive reaction after 24 h. Inoculated finger millet plants (21-day-old) showed blight and stripe symptoms after four to seven days. Acidovorax avenae ssp. avenae was re-isolated from such affected plants. The strains were Gram-negative, nonfluorescent on King’s medium B, arginine dihydrolase negative, nitrate-positive and starch-negative. Metabolic profiling of the strains using the Biolog GN MicroPlates and the associated MicroLog profiling matching software (Biolog Inc., Hayward, CA, USA) identified strains as Acidovorax avenae ssp. avenae (similarity 0·760–0·836). Strains are deposited at the DGISP culture collection, Copenhagen, Denmark. This is the first report of Acidovorax avenae ssp. avenae in finger millet from Uganda.

First report of bacterial blight in fenugreek (Trigonella foenum-graecum) caused by Pseudomonas syringae pv. syringae.

There was a high incidence of foliar disease in fenugreek crops in the Wimmera region of Victoria in 1998. Pseudomonas syringae pv. syringae was consistently isolated from diseased plants and shown to be the causal agent by Koch’s postulates. This is the first record of P syringae pv. syringae on fenugreek in Australia.