Related Genetic Elements Research Articles

Incidence of potential β-lactam resistance genes and related mobile genetic elements in uropathogenic Escherichia coli from pregnant women from Kolkata

Incidence of potential β-lactam resistance genes and related mobile genetic elements in uropathogenic Escherichia coli from pregnant women from Kolkata

Distribution and Implications of Haloarchaeal Plasmids Disseminated in Self-Encoded Plasmid Vesicles.

Even though viruses and plasmids are both drivers of horizontal gene transfer, they differ fundamentally in their mode of transfer. Virus genomes are enclosed in virus capsids and are not dependent on cell-to-cell contacts for their dissemination. In contrast, the transfer of plasmids most often requires physical contact between cells. However, plasmid pR1SE of Halorubrum lacusprofundi is disseminated between cells, independent of cell-cell contacts, in specialized membrane vesicles that contain plasmid proteins. In this study, we searched for pR1SE-like elements in public databases and a metagenomics dataset from Australian salt lakes and identified 40 additional pR1SE-like elements in hypersaline environments worldwide. Herein, these elements are named apHPVs (archaeal plasmids of haloarchaea potentially transferred in plasmid vesicles). They share two sets of closely related proteins with conserved synteny, strongly indicating an organization into different functional clusters. We find that apHPVs, besides transferring themselves, have the potential to transfer large fragments of DNA between host cells, including virus defense systems. Most interestingly, apHPVs likely play an important role in the evolution of viruses and plasmids in haloarchaea, as they appear to recombine with both of them. This further supports the idea that plasmids and viruses are not distinct but closely related mobile genetic elements.

Global scenario of the RmtE pan-aminoglycoside-resistance mechanism: emergence of the rmtE4 gene in South America associated with a hospital-related IncL plasmid.

Antimicrobial resistance (AMR) mechanisms, especially those conferring resistance to critically important antibiotics, are a great concern for public health. 16S rRNA methyltransferases (16S-RMTases) abolish the effectiveness of most clinically used aminoglycosides, but some of them are considered sporadic, such as RmtE. The main goals of this work were the genomic analysis of bacteria producing 16S-RMTases from a 'One Health' perspective in Venezuela, and the study of the epidemiological and evolutionary scenario of RmtE variants and their related mobile genetic elements (MGEs) worldwide. A total of 21 samples were collected in 2014 from different animal and environmental sources in the Cumaná region (Venezuela). Highly aminoglycoside-resistant Enterobacteriaceae isolates were selected, identified and screened for 16S-RMTase genes. Illumina and Nanopore whole-genome sequencing data were combined to obtain hybrid assemblies and analyse their sequence type, resistome, plasmidome and pan-genome. Genomic collections of rmtE variants and their associated MGEs were generated to perform epidemiological and phylogenetic analyses. A single 16S-RMTase, the novel RmtE4, was identified in five Klebsiella isolates from wastewater samples of Cumaná. This variant possessed three amino acid modifications with respect to RmtE1-3 (Asn152Asp, Val216Ile and Lys267Ile), representing the most genetic distant among all known and novel variants described in this work, and the second most prevalent. rmtE variants were globally spread, and their geographical distribution was determined by the associated MGEs and the carrying bacterial species. Thus, rmtE4 was found to be confined to Klebsiella isolates from South America, where it was closely related to ISVsa3 and an uncommon IncL plasmid related with hospital environments. This work uncovered the global scenario of RmtE and the existence of RmtE4, which could potentially emerge from South America. Surveillance and control measures should be developed based on these findings in order to prevent the dissemination of this AMR mechanism and preserve public health worldwide.

Hyper-stimulation of Pyrococcus furiosus CRISPR DNA uptake by a self-transmissible plasmid.

Pyrococcus furiosus is a hyperthermophilic archaeon with three effector CRISPR complexes (types I-A, I-B, and III-B) that each employ crRNAs derived from seven CRISPR arrays. Here, we investigate the CRISPR adaptation response to a newly discovered and self-transmissible plasmid, pT33.3. Transconjugant strains of Pyrococcus furiosus exhibited dramatically elevated levels of new spacer integration at CRISPR loci relative to the strain harboring a commonly employed, laboratory-constructed plasmid. High-throughput sequence analysis demonstrated that the vast majority of the newly acquired spacers were preferentially selected from DNA surrounding a particular region of the pT33.3 plasmid and exhibited a bi-directional pattern of strand bias that is a hallmark of primed adaptation by type I systems. We observed that one of the CRISPR arrays of our Pyrococcus furiosus laboratory strain encodes a spacer that closely matches the region of the conjugative plasmid that is targeted for adaptation. The hyper-adaptation phenotype was found to strictly depend both on the presence of this single matching spacer as well as the I-B effector complex, known to mediate primed adaptation. Our results indicate that Pyrococcus furiosus naturally encountered this conjugative plasmid or a related mobile genetic element in the past and responds to reinfection with robust primed adaptation.

Microalgae simultaneously promote antibiotic removal and antibiotic resistance genes/bacteria attenuation in algal-bacterial granular sludge system

This study investigated the effects of microalgae growth on antibiotic removal and the attenuation of antibiotic resistance genes (ARGs)/ARGs host bacteria in algal-bacterial granular sludge (ABGS) system. In the presence of tetracycline (TC) and sulfadiazine (SDZ) mixture (2–4 mg/L), microalgae could grow on bacterial granular sludge (BGS) to form ABGS, with a chlorophyll-a content of 7.68–8.13 mg/g-VSS being achieved. The removal efficiencies of TC and SDZ by ABGS were as high as 79.0 % and 94.0 %, which were 4.3–5.0 % higher than those by BGS. Metagenomic analysis indicated that the relative abundances of TC/SDZ- related ARGs and mobile genetic elements (MGEs) in BGS were 56.1 % and 22.1 % higher than those in ABGS. A total of 26 ARGs were detected from the granules, and they were identified to associate with 46 host bacteria. 13 out of 26 ARGs and 13 out of 46 hosts were shared ARGs and hosts, respectively. The total relative abundance of host bacteria in BGS was 30.8 % higher than that in ABGS. Scenedesmus and Chlorella were the dominant microalgae that may reduce the diversity of ARGs hosts. Overall, ABGS is a promising biotechnology for antibiotic-containing wastewater treatment.

Whole-genome sequencing and gene sharing network analysis powered by machine learning identifies antibiotic resistance sharing between animals, humans and environment in livestock farming.

Anthropogenic environments such as those created by intensive farming of livestock, have been proposed to provide ideal selection pressure for the emergence of antimicrobial-resistant Escherichia coli bacteria and antimicrobial resistance genes (ARGs) and spread to humans. Here, we performed a longitudinal study in a large-scale commercial poultry farm in China, collecting E. coli isolates from both farm and slaughterhouse; targeting animals, carcasses, workers and their households and environment. By using whole-genome phylogenetic analysis and network analysis based on single nucleotide polymorphisms (SNPs), we found highly interrelated non-pathogenic and pathogenic E. coli strains with phylogenetic intermixing, and a high prevalence of shared multidrug resistance profiles amongst livestock, human and environment. Through an original data processing pipeline which combines omics, machine learning, gene sharing network and mobile genetic elements analysis, we investigated the resistance to 26 different antimicrobials and identified 361 genes associated to antimicrobial resistance (AMR) phenotypes; 58 of these were known AMR-associated genes and 35 were associated to multidrug resistance. We uncovered an extensive network of genes, correlated to AMR phenotypes, shared among livestock, humans, farm and slaughterhouse environments. We also found several human, livestock and environmental isolates sharing closely related mobile genetic elements carrying ARGs across host species and environments. In a scenario where no consensus exists on how antibiotic use in the livestock may affect antibiotic resistance in the human population, our findings provide novel insights into the broader epidemiology of antimicrobial resistance in livestock farming. Moreover, our original data analysis method has the potential to uncover AMR transmission pathways when applied to the study of other pathogens active in other anthropogenic environments characterised by complex interconnections between host species.

Chromosomal Integration of Huge and Complex blaNDM-Carrying Genetic Elements in Enterobacteriaceae.

In this study, a detailed genetic dissection of the huge and complex bla NDM-carrying genetic elements and their related mobile genetic elements was performed in Enterobacteriaceae. An extensive comparison was applied to 12 chromosomal genetic elements, including six sequenced in this study and the other six from GenBank. These 12 genetic elements were divided into five groups: a novel IME Tn6588; two related IMEs Tn6523 (SGI1) and Tn6589; four related ICEs Tn6512 (R391), Tn6575 (ICEPvuChnBC22), Tn6576, and Tn6577; Tn7 and its derivatives Tn6726 and 40.7-kb Tn7-related element; and two related IMEs Tn6591 (GIsul2) and Tn6590. At least 51 resistance genes, involved in resistance to 18 different categories of antibiotics and heavy metals, were found in these 12 genetic elements. Notably, Tn6576 carried another ICE Tn6582. In particular, the six bla NDM-carrying genetic elements Tn6588, Tn6589, Tn6575, Tn6576, Tn6726, and 40.7-kb Tn7-related element contained large accessory multidrug resistance (MDR) regions, each of which had a very complex mosaic structure that comprised intact or residual mobile genetic elements including insertion sequences, unit or composite transposons, integrons, and putative resistance units. Core bla NDM genetic environments manifested as four different Tn125 derivatives and, notably, two or more copies of relevant Tn125 derivatives were found in each of Tn6576, Tn6588, Tn6589, and 40.7-kb Tn7-related element. The huge and complex bla NDM-carrying genetic elements were assembled from complex transposition and homolog recombination. Firstly identified were eight novel mobile elements, including three ICEs Tn6576, Tn6577, and Tn6582, two IMEs, Tn6588 and Tn6589, two composite transposons Tn6580a and Tn6580b, and one integron In1718.

Recent Vibrio cholerae O1 Epidemic Strains Are Unable To Replicate CTXΦ Prophage Genome.

ABSTRACTCholera, an acute diarrheal disease, is caused by pathogenic strains of Vibrio cholerae generated by the lysogenization of the filamentous cholera toxin phage CTXΦ. Although CTXΦ phage in the classical biotype are usually integrated solitarily or with a truncated copy, those in El Tor biotypes are generally found in tandem and/or with related genetic elements. Due to this structural difference in the CTXΦ prophage array, the prophage in the classical biotype strains does not yield extrachromosomal CTXΦ DNA and does not produce virions, whereas the El Tor biotype strains can replicate the CTXΦ genome and secrete infectious CTXΦ phage particles. However, information on the CTXΦ prophage array structure of pathogenic V. cholerae is limited. Therefore, we investigated the complete genomic sequences of five clinical V. cholerae isolates obtained in Kolkata (India) during 2007 to 2011. The analysis revealed that recent isolates possessed an altered CTXΦ prophage array of the prototype El Tor strain. These strains were defective in replicating the CTXΦ genome. All recent isolates possessed identical rstA and intergenic sequence 1 (Ig-1) sequences and comparable rstA expression in the prototype El Tor strain, suggesting that the altered CTXΦ array was responsible for the defective replication of the prophage. Therefore, CTXΦ structures available in the database and literatures can be classified as replicative and nonreplicative. Furthermore, V. cholerae epidemic strains became capable of producing CTXΦ phage particles since the 1970s. However, V. cholerae epidemic strains again lost the capacity for CTXΦ production around the year 2010, suggesting that a significant change in the dissemination pattern of the current cholera pandemic occurred.IMPORTANCE Cholera is an acute diarrheal disease caused by pathogenic strains of V. cholerae generated by lysogenization of the filamentous cholera toxin phage CTXΦ. The analysis revealed that recent isolates possessed altered CTXΦ prophage array of prototype El Tor strain and were defective in replicating the CTXΦ genome. Classification of CTXΦ structures in isolated years suggested that V. cholerae epidemic strains became capable of producing CTXΦ phage particles since the 1970s. However, V. cholerae epidemic strains again lost the capacity for CTXΦ production around the year 2010, suggesting that a critical change had occurred in the dissemination pattern of the current cholera pandemic.

Antibiotic resistance genes and mobile genetic elements in a rural river in Southeast China: Occurrence, seasonal variation and association with the antibiotics.

Human activities in rural areas, such as livestock farming, aquaculture, and rural domestic sewage discharge, may result in antibiotic resistance genes (ARGs) pollution in rural rivers. A systematic monitoring in different seasons was conducted in a typical agriculture-polluted river with Real-Time Quantitative PCR. A total of 11 ARGs and 2 related mobile genetic elements (MGEs) were detected at all sites with relative abundances of 6.9×10-10-0.2 copies/16S rRNA copies. Among them, sul1, sul2 and int1 were the dominant target genes in water samples. tetW, ermB, and floR were more abundant in November (the dry season), while other ARGs, MGEs and 16s rRNA were at a higher absolute abundance in warm seasons. There was less spatial variation of ARGs in the dry season than in the other two seasons. Furthermore, the relative abundance of ARGs was higher at sampling sites adjoining pollution sources. In addition, cluster analysis implied that ARGs in upstream sediments may be released into surface water and migrate downstream in the direction of river flow. There was no significant correlation between ARGs and their corresponding antibiotics. However, the total concentration of tetracycline was significantly correlated with the non-paired ARGs, including sul3, floR, and ermB. At the same time, heavy metals (Zn, Pb, Cd, Cr6+, As) and other environmental parameters (permanganate index, pH, DO) may apply selective pressure on the spread of ARGs, according to redundancy and Pearson's correlation analysis.

Molecular epidemiology and genetic characterisation of carbapenem-resistant Acinetobacter baumannii isolates from Guangdong Province, South China.

Carbapenem-resistant Acinetobacter baumannii (CRAB) has become a worldwide issue. This study aimed to characterise the epidemiology and genetic relationships of A. baumannii isolates in Guangdong Province, China. CRAB isolates were collected from five municipal hospitals from June-December 2017. The 16S-23S rRNA intergenic spacer region was used for confirmation of strain identity. Antimicrobial susceptibility testing and the CarbAcineto NP test were performed to analyse the resistance spectrum and carbapenemase production of the isolates. PCR-based assays were used to detect β-lactamase genes and related mobile genetic elements. Genetic diversity among the isolates was analysed by enterobacterial repetitive intergenic consensus (ERIC)-PCR, multilocus sequence typing (MLST) and multiplex PCR. A total of 122 isolates were confirmed as A. baumannii; all were resistant to the tested antibiotics except for tigecycline and colistin. The CarbAcineto NP test showed that 93.4% of the isolates produced a carbapenemase. blaOXA-23-like and extended-spectrum β-lactamase-encoding genes were found by PCR in 94.3% and 91.8% of the isolates, respectively. Furthermore, the genetic environment of blaOXA-23-like was mainly associated with transposons Tn2008 (46.1%), Tn2006 (27.0%) and Tn2009 (20.9%). MLST identified six existing sequence types (STs) and three novel STs, of which ST195 (35.7%) and ST208 (32.1%) were the most common, belonging to clonal group 92 and European clone II. This study suggests that co-production of β-lactamases was the major resistance mechanism of CRAB isolates. Dissemination of blaOXA-23-like may be facilitated by transposable elements. ST195 and ST208 were the predominant epidemic types of A. baumannii in Guangdong Province.

Characterization of Three Novel SXT/R391 Integrating Conjugative Elements ICEMfuInd1a and ICEMfuInd1b, and ICEMprChn1 Identified in the Genomes of Marinomonas fungiae JCM 18476T and Marinomonas profundimaris Strain D104.

The genus Marinomonas comprises Gram negative bacteria which are widespread in the marine environment and there is no report on the genomic analysis of SXT/R391 ICEs derived from this group of bacteria. This study describes the genomic features of three new SXT/R391 integrating conjugating elements (ICEs) identified in the genome of Marinomonas fungiae JCM 18476T (ICEMfuInd1a and ICEMfuInd1b) and in Marinomonas profundimaris strain D104 (ICEMprChn1). Structural organizations of the three ICEs were similar to the typical SXT/R391 family of ICEs and showed high degree of conservation in the core genes. Sequence analysis revealed ICEMfuInd1b and ICEMprChn1 were inserted into the genome at 5′-end of an typical host prfC gene, while ICEMfuInd1a was inserted at 5′-end of an atypical hipA-like gene. Despite their coexistence, the ICEMfuInd1a and ICEMfuInd1b were not present in a tandem fashion in the genome of M. fungiae. Phylogenetic analyses revealed the three ICEs either evolved independently or high degrees of recombination events had masked their evolution from a common SXT ancestor. Further, we found that the typical entry exclusion mechanism mediated by the TraG/EeX protein pair was likely defective in preventing the conjugative transfer of a second copy of the same S (SXT) group ICE into the M. fungiae genome due to mutations. Our analysis showed the presence of 16, 25, and 27 variable genes in the hotspots of ICEMfuInd1a, ICEMfuInd1b, and ICEMprChn1, respectively, many of which were not reported earlier for SXT/R391 ICEs. Sequence analysis predicted these hotspot regions were shaped by acquisition of genes through homologous recombination between the SXT and R391 related ICEs or mobile genetic elements present in disparate marine bacteria. Multidrug resistance genes which are hallmark feature of SXT/R391 ICEs were not present in either of the two ICEs from M. fungiae but were present within a transposon cassette in the HS-1 of the ICEMprChn1 from M. profundimaris. Finally, our data provided information on the genetic diversity and predicted functions encoded by variable genes present in the hotspot regions of these new ICEs.

The Double-Stranded DNA Virosphere as a Modular Hierarchical Network of Gene Sharing

ABSTRACTVirus genomes are prone to extensive gene loss, gain, and exchange and share no universal genes. Therefore, in a broad-scale study of virus evolution, gene and genome network analyses can complement traditional phylogenetics. We performed an exhaustive comparative analysis of the genomes of double-stranded DNA (dsDNA) viruses by using the bipartite network approach and found a robust hierarchical modularity in the dsDNA virosphere. Bipartite networks consist of two classes of nodes, with nodes in one class, in this case genomes, being connected via nodes of the second class, in this case genes. Such a network can be partitioned into modules that combine nodes from both classes. The bipartite network of dsDNA viruses includes 19 modules that form 5 major and 3 minor supermodules. Of these modules, 11 include tailed bacteriophages, reflecting the diversity of this largest group of viruses. The module analysis quantitatively validates and refines previously proposed nontrivial evolutionary relationships. An expansive supermodule combines the large and giant viruses of the putative order “Megavirales” with diverse moderate-sized viruses and related mobile elements. All viruses in this supermodule share a distinct morphogenetic tool kit with a double jelly roll major capsid protein. Herpesviruses and tailed bacteriophages comprise another supermodule, held together by a distinct set of morphogenetic proteins centered on the HK97-like major capsid protein. Together, these two supermodules cover the great majority of currently known dsDNA viruses. We formally identify a set of 14 viral hallmark genes that comprise the hubs of the network and account for most of the intermodule connections.

Antibiotic Resistance Patterns and Related Mobile Genetic Elements of Pneumococci and β-Hemolytic Streptococci in Thai Healthy Children.

Transmission of antibiotic resistance genes among Streptococcus pneumoniae and beta-hemolytic streptococcus (BHS) was generally associated with transmissible genetic elements. The objectives of this study were to investigate carriage rate, antibiotic resistance and related mobile genetic elements of pneumococci and BHS from school-children. The pneumococci and BHS were recovered from 220 Thai school-children, and then tested for antibiotic susceptibility pattern by disc diffusion. Antibiotic resistance genes and related genetic elements were detected by PCR with specific primers. A total of 77 pneumococcal isolates were resistant to erythromycin (42%), tetracycline (44%), clindamycin (8%), or penicillin (3%). Fifty-four BHS isolates were resistant to erythromycin (28%), tetracycline (52%), or clindamycin (13%). All isolates tested were 100% sensitive to penicillin and levofloxacin. Among erythromycin-resistant streptococcal isolates showed different phenotypes of clindamycin resistance. It was found that isolated pneumococci showed constitutive clindamycin resistance (19%), and inducible clindamycin resistance (12%). The BHS isolates exhibited constitutive clindamycin resistance (40%), and inducible resistance (20%) phenotypes. The predominant erythromycin resistance genes in pneumococci and BHS were mefE and ermB, while the most common tetracycline resistance gene in this population was tetM. Furthermore, almost all erythromycin- and tetracycline-resistant streptococci (97%) mainly contained various genetic elements, including mega elements and six different transposon types (Tn2009, Tn2017, Tn917, Tn3872, Tn6002 and Tn916). Therefore, carriages of pneumococci and BHS with multidrug resistance in children might be important reservoirs of antibiotic-resistance genes carried by transposons. Tn916-like elements could lead to dissemination of the antibiotic resistance genes among genus streptococcus in human oral cavity and nasopharynx.

The replication machinery encoded by SCCmec and related mobile genetic elements

The replication machinery encoded by SCCmec and related mobile genetic elements

Molecular functions of human endogenous retroviruses in health and disease.

Human endogenous retroviruses (HERVs) and related genetic elements form 504 distinct families and occupy ~8% of human genome. Recent success of high-throughput experimental technologies facilitated understanding functional impact of HERVs for molecular machinery of human cells. HERVs encode active retroviral proteins, which may exert important physiological functions in the body, but also may be involved in the progression of cancer and numerous human autoimmune, neurological and infectious diseases. The spectrum of related malignancies includes, but not limits to, multiple sclerosis, psoriasis, lupus, schizophrenia, multiple cancer types and HIV. In addition, HERVs regulate expression of the neighboring host genes and modify genomic regulatory landscape, e.g., by providing regulatory modules like transcription factor binding sites (TFBS). Indeed, recent bioinformatic profiling identified ~110,000 regulatory active HERV elements, which formed at least ~320,000 human TFBS. These and other peculiarities of HERVs might have played an important role in human evolution and speciation. In this paper, we focus on the current progress in understanding of normal and pathological molecular niches of HERVs, on their implications in human evolution, normal physiology and disease. We also review the available databases dealing with various aspects of HERV genetics.

Virophages, polintons, and transpovirons: a complex evolutionary network of diverse selfish genetic elements with different reproduction strategies

BackgroundRecent advances of genomics and metagenomics reveal remarkable diversity of viruses and other selfish genetic elements. In particular, giant viruses have been shown to possess their own mobilomes that include virophages, small viruses that parasitize on giant viruses of the Mimiviridae family, and transpovirons, distinct linear plasmids. One of the virophages known as the Mavirus, a parasite of the giant Cafeteria roenbergensis virus, shares several genes with large eukaryotic self-replicating transposon of the Polinton (Maverick) family, and it has been proposed that the polintons evolved from a Mavirus-like ancestor.ResultsWe performed a comprehensive phylogenomic analysis of the available genomes of virophages and traced the evolutionary connections between the virophages and other selfish genetic elements. The comparison of the gene composition and genome organization of the virophages reveals 6 conserved, core genes that are organized in partially conserved arrays. Phylogenetic analysis of those core virophage genes, for which a sufficient diversity of homologs outside the virophages was detected, including the maturation protease and the packaging ATPase, supports the monophyly of the virophages. The results of this analysis appear incompatible with the origin of polintons from a Mavirus-like agent but rather suggest that Mavirus evolved through recombination between a polinton and an unknownvirus. Altogether, virophages, polintons, a distinct Tetrahymena transposable element Tlr1, transpovirons, adenoviruses, and some bacteriophages form a network of evolutionary relationships that is held together by overlapping sets of shared genes and appears to represent a distinct module in the vast total network of viruses and mobile elements.ConclusionsThe results of the phylogenomic analysis of the virophages and related genetic elements are compatible with the concept of network-like evolution of the virus world and emphasize multiple evolutionary connections between bona fide viruses and other classes of capsid-less mobile elements.

Evolution of microbes and viruses: a paradigm shift in evolutionary biology?

When Charles Darwin formulated the central principles of evolutionary biology in the Origin of Species in 1859 and the architects of the Modern Synthesis integrated these principles with population genetics almost a century later, the principal if not the sole objects of evolutionary biology were multicellular eukaryotes, primarily animals and plants. Before the advent of efficient gene sequencing, all attempts to extend evolutionary studies to bacteria have been futile. Sequencing of the rRNA genes in thousands of microbes allowed the construction of the three- domain “ribosomal Tree of Life” that was widely thought to have resolved the evolutionary relationships between the cellular life forms. However, subsequent massive sequencing of numerous, complete microbial genomes revealed novel evolutionary phenomena, the most fundamental of these being: (1) pervasive horizontal gene transfer (HGT), in large part mediated by viruses and plasmids, that shapes the genomes of archaea and bacteria and call for a radical revision (if not abandonment) of the Tree of Life concept, (2) Lamarckian-type inheritance that appears to be critical for antivirus defense and other forms of adaptation in prokaryotes, and (3) evolution of evolvability, i.e., dedicated mechanisms for evolution such as vehicles for HGT and stress-induced mutagenesis systems. In the non-cellular part of the microbial world, phylogenomics and metagenomics of viruses and related selfish genetic elements revealed enormous genetic and molecular diversity and extremely high abundance of viruses that come across as the dominant biological entities on earth. Furthermore, the perennial arms race between viruses and their hosts is one of the defining factors of evolution. Thus, microbial phylogenomics adds new dimensions to the fundamental picture of evolution even as the principle of descent with modification discovered by Darwin and the laws of population genetics remain at the core of evolutionary biology.

Occurrence and diversity of naphthalene dioxygenase genes in soil microbial communities from the Maritime Antarctic

The diversity of naphthalene dioxygenase genes (ndo) in soil environments from the Maritime Antarctic was assessed, dissecting as well the influence of the two vascular plants that grow in the Antarctic: Deschampsia antarctica and Colobanthus quitensis. Total community DNA was extracted from bulk and rhizosphere soil samples from Jubany station and Potter Peninsula, South Shetland Islands. ndo genes were amplified by a nested PCR and analysed by denaturant gradient gel electrophoresis approach (PCR-DGGE) and cloning and sequencing. The ndo-DGGE fingerprints of oil-contaminated soil samples showed even and reproducible patterns, composed of four dominant bands. The presence of vascular plants did not change the relative abundance of ndo genotypes compared with bulk soil. For non-contaminated sites, amplicons were not obtained for all replicates and the variability among the fingerprints was comparatively higher, likely reflecting a lower abundance of ndo genes. The phylogenetic analyses showed that all sequences were affiliated to the nahAc genes closely related to those described for Pseudomonas species and related mobile genetic elements. This study revealed that a microdiversity of nahAc-like genes exists in microbial communities of Antarctic soils and quantitative PCR indicated that their relative abundance was increased in response to anthropogenic sources of pollution.

SmaI Typeability and Tetracycline Susceptibility and Resistance in Streptococcus pyogenes Isolates with Efflux-Mediated Erythromycin Resistance

In Streptococcus pyogenes, efflux-mediated macrolide resistance is encoded by the mef(A) gene and is associated with a particular resistance pattern (M phenotype) characterized by resistance, usually at a low level, only to 14- and 15-membered macrolides (10). The mef(A) gene is carried by different genetic elements, depending on whether the isolates are susceptible or resistant to tetracycline (2). In the tetracycline-susceptible isolates, mef(A) is contained in a Tn1207.1 transposon, identical to the one originally described in S. pneumoniae (9), inserted into larger genetic elements of phage origin such as Tn1207.3 (8) or Φ10394.4, a related 58.8-kb chimeric element (1). In the tetracycline-resistant isolates, mef(A) is linked to the tet(O) gene in a tet(O)-mef(A) chimeric element which, unlike the Tn1207.3-Φ10394.4 family, may contain different, defective variants of the Tn1207.1 transposon and is not integrated into the chromosome within the comEC gene (2). The most common method used to type macrolide-resistant streptococci involves restriction of genomic DNA with the SmaI endonuclease, followed by pulsed-field gel electrophoresis analysis. However, several studies have reported that some isolates with the M phenotype are nontypeable because their DNA is refractory to SmaI digestion. Since early studies, nontypeability was seen to be a characteristic of tetracycline-susceptible M-phenotype isolates (7, 11), typically carrying Tn1207.3 or Φ10394.4 (2, 6), whereas tetracycline-resistant M-phenotype isolates, typically carrying the tet(O)-mef(A) element (2), were usually restricted by SmaI (6). Subsequently, a DNA-modifying methyltransferase encoded by the Tn1207.3-Φ10394.4 family was described, which acts on the SmaI recognition sequence and renders DNA refractory to cleavage by SmaI (4). Further insights were recently gained by Euler et al. (3), who identified a type II restriction-modification (R-M) cassette on Φ10394.4—located just downstream of Tn1207.1 in the conserved region of phage origin—formed by three open reading frames (ORFs): two encoding two subunits of a restriction endonuclease and one (spyIM) encoding the methyltransferase responsible for DNA resistance to SmaI digestion. Three different strains from our collection of M-phenotype S. pyogenes strains were investigated: m46 [SmaI typeable, tetracycline resistant, carrying the tet(O)-mef(A) element] (2, 5, 6, 7), and Spy-1 and Spy-2 (both SmaI nontypeable and tetracycline susceptible, carrying Tn1207.3 and Φ10394.4, respectively) (6, 7). PCR analysis revealed the R-M cassette in strains Spy-1 and Spy-2 but not in strain m46 (nor in other tetracycline-resistant isolates containing different defective variants of the Tn1207.1 transposon [6; data not shown]). The entire region was explored by pairing primers ORF8-for (ACCGATTTGCCTCACTGCAC) and dsPOL-rev (ACCATTAGAGATGACATTCG), targeting umuC-mucB (the last ORF of Tn1207.1) and the intergenic region immediately downstream of the phage DNA polymerase gene, respectively. Whereas an amplicon of the size (10,756 bp) expected on the basis of the published sequences of Tn1207.3 (GenBank accession no. {type:entrez-nucleotide,attrs:{text:AY657002,term_id:50261575}}AY657002) and Φ10394.4 (GenBank accession no. {type:entrez-nucleotide,attrs:{text:AY445042,term_id:40218525}}AY445042) was obtained from strains Spy-1 and Spy-2, a smaller amplicon (7,380 bp) was obtained from strain m46 (Fig. ​(Fig.1).1). The 7,380-bp amplicon was sequenced (EMBL accession no. {type:entrez-nucleotide,attrs:{text:AM492531,term_id:153581897}}AM492531); sequence analysis showed that the entire R-M cassette and the adjacent ORF of Tn1207.3-Φ10394.4 were replaced by three new ORFs encoding three hypothetical proteins. Two areas of homology with Tn1207.3-Φ10394.4 were detected, upstream (93% homology, including umuC-mucB) and downstream (94% homology, including the phage DNA polymerase gene) of the three new ORFs (Fig. ​(Fig.11). FIG. 1. ORF map of a sequenced portion of the tet(O)-mef(A) element from S. pyogenes strain m46 (EMBL accession no. {type:entrez-nucleotide,attrs:{text:AM492531,term_id:153581897}}AM492531) compared with the ORF map of the corresponding sequence ... These findings contribute to conclusively clarifying why, among S. pyogenes isolates with the M phenotype, the tetracycline-resistant ones are, as a rule, SmaI typeable, while the tetracycline-susceptible ones are not. Previous studies have shown that, while the two related genetic elements (Tn1207.3 and Φ10394.4) typical of tetracycline-susceptible isolates are inserted into the same prophage, the tet(O)-mef(A) element typical of tetracycline-resistant isolates is inserted into a different prophage (6). The present results show that the R-M cassette encoding, in Tn1207.3-Φ10394.4, the methyltransferase responsible for DNA resistance to cleavage by SmaI is absent in the tet(O)-mef(A) element where, together with an adjacent ORF, it is replaced by three new ORFs flanked, both upstream and downstream, by homologous regions.

Being Pathogenic, Plastic, and Sexual while Living with a Nearly Minimal Bacterial Genome

Mycoplasmas are commonly described as the simplest self-replicating organisms, whose evolution was mainly characterized by genome downsizing with a proposed evolutionary scenario similar to that of obligate intracellular bacteria such as insect endosymbionts. Thus far, analysis of mycoplasma genomes indicates a low level of horizontal gene transfer (HGT) implying that DNA acquisition is strongly limited in these minimal bacteria. In this study, the genome of the ruminant pathogen Mycoplasma agalactiae was sequenced. Comparative genomic data and phylogenetic tree reconstruction revealed that ∼18% of its small genome (877,438 bp) has undergone HGT with the phylogenetically distinct mycoides cluster, which is composed of significant ruminant pathogens. HGT involves genes often found as clusters, several of which encode lipoproteins that usually play an important role in mycoplasma–host interaction. A decayed form of a conjugative element also described in a member of the mycoides cluster was found in the M. agalactiae genome, suggesting that HGT may have occurred by mobilizing a related genetic element. The possibility of HGT events among other mycoplasmas was evaluated with the available sequenced genomes. Our data indicate marginal levels of HGT among Mycoplasma species except for those described above and, to a lesser extent, for those observed in between the two bird pathogens, M. gallisepticum and M. synoviae. This first description of large-scale HGT among mycoplasmas sharing the same ecological niche challenges the generally accepted evolutionary scenario in which gene loss is the main driving force of mycoplasma evolution. The latter clearly differs from that of other bacteria with small genomes, particularly obligate intracellular bacteria that are isolated within host cells. Consequently, mycoplasmas are not only able to subvert complex hosts but presumably have retained sexual competence, a trait that may prevent them from genome stasis and contribute to adaptation to new hosts.