Region Of Sequence Research Articles

In Silico Design and Synthesis of Antifungal Peptides Guided by Quantitative Antifungal Activity.

Antifungal peptides (AFPs) are emerging as promising candidates for advanced antifungal therapies because of their broad-spectrum efficacy and reduced resistance development. In silico design of AFPs, however, remains challenging, due to the lack of an efficient and well-validated quantitative assessment of antifungal activity. This study introduced an AFP design approach that leverages an innovative quantitative metric, named the antifungal index (AFI), through a three-step process, i.e., segmentation, single-point mutation, and global multipoint optimization. An exhaustive search of 100 putative AFP sequences indicated that random modifications without guidance only have a 5.97-20.24% chance of enhancing antifungal activity. Analysis of the search results revealed that (1) N-terminus truncation is more effective in enhancing antifungal activity than the modifications at the C-terminus or both ends, (2) introducing the amino acids within the 10-60% sequence region that enhance aromaticity and hydrophobicity are more effective in increasing antifungal efficacy, and (3) incorporating alanine, cysteine, and phenylalanine during multiple point mutations has a synergistic effect on enhancing antifungal activity. Subsequently, 28 designed peptides were synthesized and tested against four typical fungal strains. The success rate for developing promising AFPs, with a minimal inhibitory concentration of ≤5.00 μM, was an impressive 82.14%. The predictive and design tool is accessible at https://antifungipept.chemoinfolab.com.

Molecular Detection and Phylogenetic Analysis of the alkB Gene in Klebsiella oxytoca Strains Isolated from the Gut of Tenebrio molitor.

The challenge in polystyrene disposal has caused researchers to look for urgent innovative and ecofriendly solutions for plastic degradation. Some insects have been reported to use polystyrene as their sole carbon source, and this has been linked to the presence of microbes in their guts that aid in plastic digestion. Thus, this study focuses on the molecular detection and phylogenetic analysis of the alkane-1-monooxygenase (alkB) gene in Klebsiella oxytoca strains isolated from the gut of Tenebrio molitor. The alkB gene encodes for alkane-1-monooxygenase, an enzyme involved in the oxidation of inactivated alkanes. This gene can be used as a marker to assess bacteria's ability to biodegrade polystyrene. Three bacterial strains were isolated from the guts of T. molitor mealworms and were confirmed using polymerase chain reaction (PCR) of the 16S ribosomal RNA gene. The primers used in the amplification of the 16S ribosomal RNA region were designed using NCBI, a bioinformatics tool. To detect the presence of the alkB gene in the isolated bacterial strains, a set of primers used in the amplification of this gene was manually designed from the conserved regions of the alkB nucleotide sequences of eleven bacterial species from GenBank. TCOFFE online tool was used to align the alkB sequences of the bacteria, while Jalview and ConSurf were used to view the alignment. The amplified alkB gene was then sequenced using the Sanger sequencing technique, blasted on NCBI to look for similar sequences, and a phylogenetic tree was constructed. Based on the 16S ribosomal RNA gene sequences, the isolated bacterial strains were confirmed to be Klebsiella oxytoca NBRC 102593, Klebsiella oxytoca JCM 1665, and Klebsiella oxytoca ATCC 13182. The alkB gene sequence identical to fourteen alkB gene sequences derived from Actinobacteria whole genome was detected in Klebsiella oxytoca for the first time to the best of our knowledge. The novel nucleotide sequence was published in the NCBI database under accession number OP959069. This gene sequence was found to be for the enzyme alkane-1-monooxygenase and may be one of the enzymes responsible for polystyrene degradation by the putative Klebsiella oxytoca ATCC 13182 in T. molitor.

Rapid molecular species identification of mammalian scat samples using nanopore adaptive sampling

Rapid molecular species identification of mammalian scat samples using nanopore adaptive sampling

Analysis the molecular similarity of least common amino acid sites in ACE2 receptor to predict the potential susceptible species for SARS-CoV-2.

SARS-CoV-2 infections in animals have been reported globally. However, the understanding of the complete spectrum of animals susceptible to SARS-CoV-2 remains limited. The virus's dynamic nature and its potential to infect a wide range of animals are crucial considerations for a One Health approach that integrates both human and animal health. This study introduces a bioinformatic approach to predict potential susceptibility to SARS-CoV-2 in both domestic and wild animals. By examining genomic sequencing, we establish phylogenetic relationships between the virus and its potential hosts. We focus on the interaction between the SARS-CoV-2 genome sequence and specific regions of the host species' ACE2 receptor. We analyzed and compared ACE2 receptor sequences from 29 species known to be infected, selecting 10 least common amino acid sites (LCAS) from key binding domains based on similarity patterns. Our analysis included 49 species across primates, carnivores, rodents, and artiodactyls, revealing complete consistency in the LCAS and identifying them as potentially susceptible. We employed the LCAS similarity pattern to predict the likelihood of SARS-CoV-2 infection in unexamined species. This method serves as a valuable screening tool for assessing infection risks in domestic and wild animals, aiding in the prevention of disease outbreaks.

Resequencing of Brazilian locally adapted cattle breeds revealed variants in candidate genes and transcription factors for meat fatty acid profile.

The beef cattle industry has experienced a shift driven by a market demand for healthier meat, cost efficiency and environmental sustainability in recent years. Consequently, there has been a growing focus on the fatty acids content and functions of meat in cattle breeding programmes. Besides, a deeper understanding of the biological mechanisms influencing the expression of different phenotypes related to fatty acid profiles is crucial. In this study, we aimed to identify Single-Nucleotide Variants (SNV) and Insertion/Deletion (InDels) DNA variants in candidate genes related to fatty acid profiles described in genomic, transcriptomic and proteomic studies conducted in beef cattle breeds. Utilizing whole-genome re-sequencing data from Brazilian locally adapted bovine breeds, namely Caracu and Pantaneiro, we identified SNVs and InDels associated with 23,947 genes. From these, we identified 318 candidate genes related to fatty acid profiles that contain variants. Subsequently, we select only genes with SNVs and InDels in their promoter, 5' UTR and coding region. Through the gene-biological process network, approximately 19 genes were highlighted. Furthermore, considering the studied trait and a literature review, we selected the main transcription factors (TF). Functional analysis via gene-TF network allowed us to identify the 30 most likely candidate genes for meat fatty acid profile in cattle. LIPE, MFSD2A and SREBF1 genes were highlighted in networks due to their biological importance. Further dissection of these genes revealed 15 new variants found in promoter regions of Caracu and Pantaneiro sequences. The gene networks facilitated a better functional understanding of genes and TF, enabling the identification of variants potentially related to the expression of candidate genes for meat fatty acid profiles in cattle.

Hypomethylation of ATP1A1 Is Associated with Poor Prognosis and Cancer Progression in Triple-Negative Breast Cancer.

Dysregulated DNA methylation in cancer is critical in the transcription machinery associated with cancer progression. Triple-negative breast cancer (TNBC) is the most aggressive breast cancer subtype, but no treatment targeting TNBC biomarkers has yet been developed. To identify specific DNA methylation patterns in TNBC, methyl-binding domain protein 2 (MBD) sequencing data were compared in TNBC and the three other major breast cancer subtypes. Integrated analysis of DNA methylation and gene expression identified a gene set showing a correlation between DNA methylation and gene expression. ATPase Na+/K+-transporting subunit alpha 1 (ATP1A1) was found to be specifically hypomethylated in the coding sequence (CDS) region and to show increased expression in TNBC. The Cancer Genome Atlas (TCGA) database also showed that hypomethylation and high expression of ATP1A1 were strongly associated with poor survival in patients with TNBC. Furthermore, ATP1A1 knockdown significantly reduced the viability and tumor-sphere formation of TNBC cells. These results suggest that the hypomethylation and overexpression of ATP1A1 could be a prognostic marker in TNBC and that the manipulation of ATP1A1 expression could be a therapeutic target in this disease.

Pseudaphelenchus taedae n. sp. (Tylenchina: Aphelenchoididae) found in loblolly pine logs from the USA and peat from Lithuania

Summary Pseudaphelenchus taedae n. sp., isolated from loblolly pine logs (Pinus taeda L.) from the USA and peat from Lithuania, is described and figured. It is characterised by the male 355 (305-401) μm and female 427 (318-520) μm body lengths and by the presence of three equal incisures in the lateral field. The slender stylet has small but conspicuous basal knobs. Valve is located at posterior part of metacorpus. The excretory pore is located at the same level as valve plates or anterior. Spicules are paired, thorn-like, separate, condylus broadly rounded, rostrum conical or triangular with a bluntly pointed tip, calomus smoothly tapering together with lamina, thin and strongly arcuate in middle then tapering towards bluntly pointed distal tip, cucullus absent. A narrow bursa surrounds three quarters of tail but is inconspicuous in most cases. The conical male tail is bluntly rounded but mostly with a short pointed or blunt mucron. The female tail is conical in various shapes, smoothly tapering, slightly ventrally bent or curved, with broadly rounded or pointed terminus. Detailed phylogenetic analysis based on the 18S and D2-D3 region of 28S sequences confirmed the status of this nematode as a new species.

Trehalose synthases from the subfamily GH13_16 involved in α-glucan biosynthesis – a focus on their maltokinase domain

The subfamily GH13_16 trehalose synthase (TreS) converts maltose to trehalose and vice versa. Typically, it consists of three domains, but it may contain a C-terminal extension exhibiting clear sequence features of a maltokinase (MaK). The present in silico study was focused on collection of naturally fused TreS-MaKs and their subsequent detailed bioinformatics analysis. Hence a set of total 3354 unique sequences was compared consisting of 1900 single TreSs, 1426 fused TreS-MaKs and 28 single MaKs. Fused TreS-MaKs were divided into five groups, namely with a standard MaK, with mutations in the maltose-binding site, of the catalytic nucleophile, of the general acid/base and of both catalytic residues. Sequence logos bearing the best conserved sequence regions were prepared for both TreSs and MaKs in an effort to find unique sequence features. In addition, linkers connecting the TreS and MaK parts in the fused enzymes were analysed. This analysis revealed that MaKs in fused enzymes have an extended N-terminal regions compared to single MaKs. Finally, the evolutionary relationships were demonstrated by phylogenetic trees of TreS parts from single TreSs and fused TreS-MaKs from the same organism as well as of single TreSs existing in multiple isoforms in the same organism.

The polymorphism analysis for CD36 among platelet donors

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

The quantitative genetics of gene expression in Mimulus guttatus.

Gene expression can be influenced by genetic variants that are closely linked to the expressed gene (cis eQTLs) and variants in other parts of the genome (trans eQTLs). We created a multiparental mapping population by sampling genotypes from a single natural population of Mimulus guttatus and scored gene expression in the leaves of 1,588 plants. We find that nearly every measured gene exhibits cis regulatory variation (91% have FDR < 0.05). cis eQTLs are usually allelic series with three or more functionally distinct alleles. The cis locus explains about two thirds of the standing genetic variance (on average) but varies among genes and tends to be greatest when there is high indel variation in the upstream regulatory region and high nucleotide diversity in the coding sequence. Despite mapping over 10,000 trans eQTL / affected gene pairs, most of the genetic variance generated by trans acting loci remains unexplained. This implies a large reservoir of trans acting genes with subtle or diffuse effects. Mapped trans eQTLs show lower allelic diversity but much higher genetic dominance than cis eQTLs. Several analyses also indicate that trans eQTLs make a substantial contribution to the genetic correlations in expression among different genes. They may thus be essential determinants of "gene expression modules," which has important implications for the evolution of gene expression and how it is studied by geneticists.

Molecular Characteristics of JAK2 and Its Effect on the Milk Fat and Casein Synthesis of Ovine Mammary Epithelial Cells.

In addition to its association with milk protein synthesis via the Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway, JAK2 also affects milk fat synthesis. However, to date, there have been no reports on the effect of JAK2 on ovine mammary epithelial cells (OMECs), which directly determine milk yield and milk contents. In this study, the coding sequence (CDS) region of ovine JAK2 was cloned and identified and its tissue expression and localization in ovine mammary glands, as well as its effects on the viability, proliferation, and milk fat and casein levels of OMECs, were also investigated. The CDS region of ovine JAK2, 3399 bp in length, was cloned and its authenticity was validated by analyzing its sequence similarity with JAK2 sequences from other animal species using a phylogenetic tree. JAK2 was found to be expressed in six ovine tissues, with the highest expression being in the mammary gland. Over-expressed JAK2 and three groups of JAK2 interference sequences were successfully transfected into OMECs identified by immunofluorescence staining. When compared with the negative control (NC) group, the viability of OMECs was increased by 90.1% in the pcDNA3.1-JAK2 group. The over-expression of JAK2 also increased the number and ratio of EdU-labeled positive OMECs, as well as the expression levels of three cell proliferation marker genes. These findings show that JAK2 promotes the viability and proliferation of OMECs. Meanwhile, the triglyceride content in the over-expressed JAK2 group was 2.9-fold higher than the controls and the expression levels of four milk fat synthesis marker genes were also increased. These results indicate that JAK2 promotes milk fat synthesis. Over-expressed JAK2 significantly up-regulated the expression levels of casein alpha s2 (CSN1S2), casein beta (CSN2), and casein kappa (CSN3) but down-regulated casein alpha s1 (CSN1S1) expression. In contrast, small interfered JAK2 had the opposite effect to JAK2 over-expression on the viability, proliferation, and milk fat and milk protein synthesis of OMECs. In summary, these results demonstrate that JAK2 promotes the viability, proliferation, and milk fat synthesis of OMECs in addition to regulating casein expression in these cells. This study contributes to a better comprehension of the role of JAK2 in the lactation performance of sheep.

YBX1 Promotes Esophageal Squamous Cell Carcinoma Progression via m5C‐Dependent SMOX mRNA Stabilization

The modification and recognition of 5-methylcytosine (m5C) are involved in the initiation and progression of various tumor types. However, the precise role and potential mechanism of Y-box-binding protein 1 (YBX1) in esophageal squamous cell carcinoma (ESCC) remains unclear. Here, it is found that YBX1 is frequently upregulated in ESCC compared with matched nontumor tissues. Gain- and loss-of-function assays show that YBX1 promoted the proliferation and metastasis of ESCC cells both in vitro and in vivo. Functional studies revealed that NOP2/Sun RNA methyltransferase family member 2 (NSUN2) is a critical RNA methyltransferase that facilitates YBX1-mediated ESCC progression. Mechanistically, integrated analysis based on RNA immunoprecipitation sequencing (RIP-seq) and m5C methylated RNA immunoprecipitation and sequencing (MeRIP-seq) assays identified spermine oxidase (SMOX) as a target gene containing an m5C site in its coding sequence (CDS) region, which coincided well with the binding site of YBX1. Overexpression of SMOX-WT but not SMOX-Mut partially restored the proliferation and invasion ability of ESCC cells curbed by YBX1 knockdown. Moreover, YBX1 activated the mTORC1 signaling pathway by stabilizing SMOX mRNA. The study reveals that YBX1 promotes ESCC development by stabilizing SMOX mRNA in an m5C-dependent manner, thus providing a valuable therapeutic target for ESCC.

Four Late-type Galaxies with Double Radio Lobes and Properties of Such Galaxies

The triggering mechanism for radio lobes from late-type galaxies is not fully understood. More samples are desired for a thorough investigation and statistics. By utilizing the optical data from the newly released Dark Energy Spectroscopic Instrument imaging surveys and the radio sources from the NRAO VLA Sky Survey and the Faint Images of the Radio Sky at Twenty-centimeter, we identify four Late-type Galaxies with double Radio Lobes (LaGRLs): J0217−3645, J0947+6220, J1412+3723 and J1736+5108. Including previously known LaGRLs, we confirm the correlation between radio power P 1.4 GHz and stellar mass M * of host galaxies. Most (25/35) LaGRLs belong to the blue cloud galaxies, while the newly identified cases in this work are located within the region of the red sequence. We find a clear correlation between the differential radio power, i.e., the offset from the P 1.4 GHz − M * relation, and the galaxy color, indicating that bluer galaxies at a fixed M * tend to host more powerful radio lobes. Furthermore, the majority (31/36) of LaGRLs are either located in a galaxy group or displaying a disturbed morphology. We suggest that all of the galaxy mass, color and surrounding environment could play important roles in triggering radio lobes in late-type galaxies.

DEGAP: Dynamic elongation of a genome assembly path.

Genome assembly remains to be a major task in genomic research. Despite the development over the past decades of different assembly software programs and algorithms, it is still a great challenge to assemble a complete genome without any gaps. With the latest DNA circular consensus sequencing (CCS) technology, several assembly programs can now build a genome from raw sequencing data to contigs; however, some complex sequence regions remain as unresolved gaps. Here, we present a novel gap-filling software, DEGAP (Dynamic Elongation of a Genome Assembly Path), that resolves gap regions by utilizing the dual advantages of accuracy and length of high-fidelity (HiFi) reads. DEGAP identifies differences between reads and provides 'GapFiller' or 'CtgLinker' modes to eliminate or shorten gaps in genomes. DEGAP adopts an iterative elongation strategy that automatically and dynamically adjusts parameters according to three complexity factors affecting the genome to determine the optimal extension path. DEGAP has already been successfully applied to decipher complex genomic regions in several projects and may be widely employed to generate more gap-free genomes.

CLLU1 as an emerging biomarker in chronic lymphoid leukemia.

CLLU1, a disease-specific gene associated with chronic lymphoid leukemia (CLL), is located on chromosome 12q22. Previous studies considered CLLU1 to be a non-coding RNA; however, recent research has discovered that its coding sequence region possesses the potential to encode a short peptide similar to interleukin-4. Remarkably, abnormally elevated expression of CLLU1 has only been detected in chronic lymphoid leukemia among all hematological cancers. High CLLU1 expression often indicates more malignant pathological features and an unfavorable prognosis for patients. Importantly, the expression level of CLLU1 remains unaffected by the passage of time or therapeutic interventions, thus rendering it a novel prognostic marker. This article provides a comprehensive summary of relevant research findings on CLLU1 in the context of CLL prognosis and clinical applications, aiming to guide subsequent theoretical and clinical investigations in this field.

Contrasting PRRSV temporal lineage patterns at the individual farm, production system, and regional levels in Ohio and neighboring states from 2017 to 2021

Porcine reproductive and respiratory virus (PRRSV), one of the most significant viruses in the swine industry, has been challenging to control due to its high mutation and recombination rates and complexity. This retrospective study aimed to describe and compare the distribution of PRRSV lineages obtained at the individual farm, production system, and regional levels. PRRSV-2 (type 2) sequences (n = 482) identified between 2017 – 2021 were provided by a regional state laboratory (Ohio Department of Agriculture, Animal Disease Diagnostic Center (ODA-ADDL)) collected from swine farms in Ohio and neighboring states, including Indiana, Michigan, Pennsylvania, and West Virginia. Additional sequences (n = 138) were provided by one collaborating swine production system. The MUSCLE algorithm on Geneious Prime® was used to align the ORF5 region of PRRSV-2 sequences along with PRRSV live attenuated vaccine strains (n = 6) and lineage anchors (n = 169). Sequenced PRRSV-2 were assigned to the most identical lineage anchors/vaccine strains. Among all sequences (n = 620), 29.8% (185/620) were ≥ 98.0% identity with the vaccine strains, where 93.5% (173/185) and 6.5% (12/185) were identical with the L5 Ingelvac PRRS® MLV and L8 Fostera® PRRS vaccine strains, respectively, and excluded from the analysis. At the regional level across five years, the top five most identified lineages included L1A, L5, L1H, L1C, and L8. Among non-vaccine sequences with production system known, L1A sequences were mostly identified (64.3% – 100.0%) in five systems, followed by L1H (0.0% - 28.6%), L1C (0.0% – 10.5%), L5 (0.0% – 14.4%), L8 (0.0% – 1.3%), and L1F (0.0% – 0.5%). Furthermore, among non-vaccine sequences with the premise identification available (n = 262), the majority of sequences from five individual farms were either classified into L1A or L5. L1A and L5 sequences coexisted in three farms, while samples submitted by one farm contained L1A, L1H, and L5 sequences. Additionally, the lineage classification results of non-vaccine sequences were associated with their restriction fragment length polymorphism (RFLP) patterns (Fisher’s exact test, p < 0.05). Overall, our results show that individual farm and production system-level PRRSV-2 lineage patterns do not necessarily correspond to regional-level patterns, highlighting the influence of individual farms and systems in shaping PRRSV occurrence within those levels, and highlighting the crucial goal of within-farm and system monitoring and early detection for accurate knowledge on PRRSV-2 lineage occurrence and emergence.

Robust Narrowest Significance Pursuit: Inference for Multiple Change-Points in the Median

We propose Robust Narrowest Significance Pursuit (RNSP), a methodology for detecting localized regions in data sequences which each must contain a change-point in the median, at a prescribed global significance level. RNSP works by fitting the postulated constant model over many regions of the data using a new sign-multiresolution sup-norm-type loss, and greedily identifying the shortest intervals on which the constancy is significantly violated. By working with the signs of the data around fitted model candidates, RNSP fulfils its coverage promises under minimal assumptions, requiring only sign-symmetry and serial independence of the signs of the true residuals. In particular, it permits their heterogeneity and arbitrarily heavy tails. The intervals of significance returned by RNSP have a finite-sample character, are unconditional in nature and do not rely on any assumptions on the true signal. Code implementing RNSP is available at https://github.com/pfryz/nsp.

Complete chloroplast genome and comparison of herbicides toxicity on Aeschynomene indica (Leguminosae) in upland direct-seeding paddy field

BackgroundIndian jointvetch (Aeschynomene indica) is a common and pernicious weed found in the upland direct-seeding rice fields in the lower reaches of the Yangtze River in China. However, there are few reports on the degree of harm, genetic characteristics, and management methods of this weed. The purpose of this study is to clarify the harm of Indian jointvetch to upland direct-seeding rice, analyze the genetic characteristics of this weed based on chloroplast genomics and identify its related species, and screen herbicides that are effective in managing this weed in upland direct-seeding rice fields.ResultsIn a field investigation in upland direct-seeding rice paddies in Shanghai and Jiangsu, we determined that the plant height and maximum lateral distance of Indian jointvetch reached approximately 134.2 cm and 57.9 cm, respectively. With Indian jointvetch present at a density of 4/m2 and 8/m2, the yield of rice decreased by approximately 50% and 70%, respectively. We further obtained the first assembly of the complete chloroplast (cp.) genome sequence of Indian jointvetch (163,613 bp). There were 161 simple sequence repeats, 166 long repeats, and 83 protein-encoding genes. The phylogenetic tree and inverted repeat region expansion and contraction analysis based on cp. genomes demonstrated that species with closer affinity to A. indica included Glycine soja, Glycine max, and Sesbania cannabina. Moreover, a total of 3281, 3840, and 3838 single nucleotide polymorphisms were detected in the coding sequence regions of the cp. genomes of S. cannabina voucher IBSC, G. soja, and G. max compared with the A. indica sequence, respectively. A greenhouse pot experiment indicated that two pre-emergence herbicides, saflufenacil and oxyfluorfen, and two post-emergence herbicides, florpyrauxifen-benzyl and penoxsulam, can more effectively manage Indian jointvetch than other common herbicides in paddy fields. The combination of these two types of herbicides is recommended for managing Indian jointvetch throughout the entire growth period of upland direct-seeding rice.ConclusionsThis study provides molecular resources for future research focusing on the identification of the infrageneric taxa, phylogenetic resolution, and biodiversity of Leguminosae plants, along with recommendations for reliable management methods to control Indian jointvetch.

Integrating Optical Genome Mapping and Whole Genome Sequencing in Somatic Structural Variant Detection.

Structural variants drive tumorigenesis by disrupting normal gene function through insertions, inversions, translocations, and copy number changes, including deletions and duplications. Detecting structural variants is crucial for revealing their roles in tumor development, clinical outcomes, and personalized therapy. Presently, most studies rely on short-read data from next-generation sequencing that aligns back to a reference genome to determine if and, if so, where a structural variant occurs. However, structural variant discovery by short-read sequencing is challenging, primarily because of the difficulty in mapping regions of repetitive sequences. Optical genome mapping (OGM) is a recent technology used for imaging and assembling long DNA strands to detect structural variations. To capture the structural variant landscape more thoroughly in the human genome, we developed an integrated pipeline that combines Bionano OGM and Illumina whole-genome sequencing and applied it to samples from 29 pediatric B-ALL patients. The addition of OGM allowed us to identify 511 deletions, 506 insertions, 93 duplications/gains, and 145 translocations that were otherwise missed in the short-read data. Moreover, we identified several novel gene fusions, the expression of which was confirmed by RNA sequencing. Our results highlight the benefit of integrating OGM and short-read detection methods to obtain a comprehensive analysis of genetic variation that can aid in clinical diagnosis, provide new therapeutic targets, and improve personalized medicine in cancers driven by structural variation.

Identification and Analysis of the MIR399 Gene Family in Grapevine Reveal Their Potential Functions in Abiotic Stress.

MiR399 plays an important role in plant growth and development. The objective of the present study was to elucidate the evolutionary characteristics of the MIR399 gene family in grapevine and investigate its role in stress response. To comprehensively investigate the functions of miR399 in grapevine, nine members of the Vvi-MIR399 family were identified based on the genome, using a miRBase database search, located on four chromosomes (Chr 2, Chr 10, Chr 15, and Chr 16). The lengths of the Vvi-miR399 precursor sequences ranged from 82 to 122 nt and they formed stable stem-loop structures, indicating that they could produce microRNAs (miRNAs). Furthermore, our results suggested that the 2 to 20 nt region of miR399 mature sequences were relatively conserved among family members. Phylogenetic analysis revealed that the Vvi-MIR399 members of dicots (Arabidopsis, tomato, and sweet orange) and monocots (rice and grapevine) could be divided into three clades, and most of the Vvi-MIR399s were closely related to sweet orange in dicots. Promoter analysis of Vvi-MIR399s showed that the majority of the predicted cis-elements were related to stress response. A total of 66.7% (6/9) of the Vvi-MIR399 promoters harbored drought, GA, and SA response elements, and 44.4% (4/9) of the Vvi-MIRR399 promoters also presented elements involved in ABA and MeJA response. The expression trend of Vvi-MIR399s was consistent in different tissues, with the lowest expression level in mature and young fruits and the highest expression level in stems and young leaves. However, nine Vvi-MIR399s and four target genes showed different expression patterns when exposed to low light, high light, heat, cold, drought, and salt stress. Interestingly, a putative target of Vvi-MIR399 targeted multiple genes; for example, seven Vvi-MIR399s simultaneously targeted VIT_213s0067g03280.1. Furthermore, overexpression of Vvi_MIR399e and Vvi_MIR399f in Arabidopsis enhanced tolerance to drought compared with wild-type (WT). In contrast, the survival rate of Vvi_MIR399d-overexpressed plants were zero after drought stress. In conclusion, Vvi-MIR399e and Vvi-MIR399f, which are related to drought tolerance in grapevine, provide candidate genes for future drought resistance breeding.