Epidermodysplasia verruciformis (EV) is a rare, lifelong genetic disorder characterized by disseminated and persistent flat warts or pityriasis versicolor-like lesions due to increased susceptibility of affected patients to human papillomavirus (HPV).1Patel T. Morrison L.K. Rady P. Tyring S. Epidermodysplasia verruciformis and susceptibility to HPV.Dis Markers. 2010; 29: 199-206Crossref PubMed Google Scholar EV is most commonly associated with mutations in the genes encoding the endoplasmic reticulum transmembrane proteins epidermodysplasia verruciformis (EVER)1 and EVER2.2Ramoz N. Rueda L.A. Bouadjar B. Montoya L.S. Orth G. Favre M. Mutations in two adjacent novel genes are associated with epidermodysplasia verruciformis.Nat Genet. 2002; 32: 579-581Crossref PubMed Scopus (337) Google Scholar In addition, defects in genes important for the maintenance of normal T-cell number and function, including ras homolog gene family member H,3Crequer A. Troeger A. Patin E. Ma C.S. Picard C. Pedergnana V. et al.Human RHOH deficiency causes T cell defects and susceptibility to EV-HPV infections.J Clin Invest. 2012; 122: 3239-3247Crossref PubMed Scopus (115) Google Scholar CORO1A,4Stray-Pedersen A. Jouanguy E. Crequer A. Bertuch A.A. Brown B.S. Jhangiani S.N. et al.Compound heterozygous CORO1A mutations in siblings with a mucocutaneous-immunodeficiency syndrome of epidermodysplasia verruciformis-HPV, molluscum contagiosum and granulomatous tuberculoid leprosy.J Clin Immunol. 2014; 34: 871-890Crossref PubMed Scopus (61) Google Scholar and macrophage stimulating 1,5Crequer A. Picard C. Patin E. D'Amico A. Abhyankar A. Munzer M. et al.Inherited MST1 deficiency underlies susceptibility to EV-HPV infections.PLoS One. 2012; 7: e44010Crossref PubMed Scopus (106) Google Scholar have been reported to cause increased susceptibility to EV-HPV. Furthermore, EV-HPV has been observed following bone marrow transplantation in patients with common γc receptor or Janus kinase-3 deficiency.6Laffort C. Le Deist F. Favre M. Caillat-Zucman S. Radford-Weiss I. Debre M. et al.Severe cutaneous papillomavirus disease after haemopoietic stem-cell transplantation in patients with severe combined immune deficiency caused by common gammac cytokine receptor subunit or JAK-3 deficiency.Lancet. 2004; 363: 2051-2054Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar ARTEMIS, encoded by DCLRE1C (DNA crosslink repair 1C), is an essential component of the nonhomologous end-joining pathway, important for T- and B-cell development. Complete loss of ARTEMIS activity leads to severely impaired V(D)J recombination manifesting as T−B− severe combined immunodeficiency (SCID), whereas hypomorphic mutations, which preserve residual protein function, result in a milder immunodeficiency with a wide spectrum of clinical and immunological phenotypes.7Moshous D. Callebaut I. de Chasseval R. Corneo B. Cavazzana-Calvo M. Le Deist F. et al.Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency.Cell. 2001; 105: 177-186Abstract Full Text Full Text PDF PubMed Scopus (717) Google Scholar Here, we describe a young adult with a novel homozygous hypomorphic mutation in DCLRE1C, resulting in TlowB− leaky SCID, recurrent infections, and EV. The patient is a 21-year-old offspring of second-degree consanguineous Algerian parents with no family history of primary immunodeficiency. At age 5 years, he developed recurrent gastrointestinal and respiratory tract infections. At age 11 years, he developed persistent flat warts. Immunologic evaluation at age 18 years revealed decreased numbers of total lymphocytes, CD3+/CD4+ T cells, and CD19+ B cells. Serum IgM concentration was normal, IgG concentration was elevated, and IgA concentration was undetectable (data not shown). At age 19 years, the patient presented with pneumonia, multiple flat warts over the body, approximately 20 elevated warts mostly on the hands, and diffuse hypopigmented macules on the neck, face, trunk, arms, and legs, consistent with EV (Fig 1, A-C). Viral serologies were negative for HIV and positive for IgG antibodies against cytomegalovirus and EBV (anti–viral capsid antigen and anti–early antigen). Chest computerized tomography revealed diffuse bronchiectasis and mediastinal lymphadenopathy. Histologic examination of hematoxylin-eosin–stained sections of the patient's skin lesions revealed hyperkeratosis with mild epidermal acanthosis. The granular layer was irregular and exhibited granules containing large blue-gray cells, considered a specific feature of EV-HPV (Fig 1, D), as well as the presence of koilocytes, that is, epithelial cells with nuclei displaced by large perinuclear haloes8Lawson J.S. Glenn W.K. Heng B. Ye Y. Tran B. Lutze-Mann L. et al.Koilocytes indicate a role for human papilloma virus in breast cancer.Br J Cancer. 2009; 101: 1351-1356Crossref PubMed Scopus (60) Google Scholar (Fig 1, E). Immunohistochemical staining revealed the expression of the tumor suppressor protein p16INK4a (Fig 1, F). The presence of koilocytes, and the expression of p16INK4a are histologic features associated with HPV infection. There was insufficient tissue to perform PCR for HPV subtypes, and the patient refused additional skin biopsies. Physical examination at age 21 years revealed a height of 5′5″ and a weight of 110 lb. Immunologic evaluations at age 19 and 21 years revealed elevated concentrations of serum IgG, normal IgM, undetectable IgA, lymphopenia, nearly absent B cells, markedly decreased CD4+ T cells, and normal CD8+ T and natural killer cell counts (Table I9Jolliff C.R. Cost K.M. Stivrins P.C. Grossman P.P. Nolte C.R. Franco S.M. et al.Reference intervals for serum IgG, IgA, IgM, C3, and C4 as determined by rate nephelometry.Clin Chem. 1982; 28: 126-128Crossref PubMed Scopus (140) Google Scholar, 10Morbach H. Eichhorn E.M. Liese J.G. Girschick H.J. Reference values for B cell subpopulations from infancy to adulthood.Clin Exp Immunol. 2010; 162: 271-279Crossref PubMed Scopus (255) Google Scholar, 11Piatosa B. Wolska-Kusnierz B. Pac M. Siewiera K. Galkowska E. Bernatowska E. B cell subsets in healthy children: reference values for evaluation of B cell maturation process in peripheral blood.Cyto Part B Clin Cyto. 2010; 78: 372-381Crossref PubMed Scopus (109) Google Scholar, 12Shearer W.T. Rosenblatt H.M. Gelman R.S. Oyomopito R. Plaeger S. Stiehm E.R. et al.Lymphocyte subsets in healthy children from birth through 18 years of age: the Pediatric AIDS Clinical Trials Group P1009 study.J Allergy Clin Immunol. 2003; 112: 973-980Abstract Full Text Full Text PDF PubMed Scopus (634) Google Scholar). Analysis at age 21 years revealed nearly absent CD4+CD31+CD45RA+ recent thymic emigrants, very low CD4+CD45RA+ and CD8+CCR7+CD45RA+ naive T cells, increased percentages of CD4+CD45RO+ memory and CD8+CCR7−CD45RA− effector memory, and exhausted CD8+CCR7−CD45RA+ effector memory CD8+ T cells (TEMRA). The patient had polyclonal TCR Vβ repertoires. The percentages of 24 Vβ subsets examined were comparable to those in healthy controls, with the exception of Vβ7.2, which was absent in CD4+ cells (see Fig E1 in this article's Online Repository at www.jacionline.org). T-cell proliferation following stimulation with phytohemagglutinin, anti-CD3, and phorbol 12-myristate 13-acetate/ionomycin was markedly impaired (Table I). Sanger sequencing of the recombination-activating genes RAG1 and RAG2 was normal (data not shown). Whole-exome sequencing detected a homozygous missense mutation in DCLRE1C (c.T368C; p.L123S), which encodes ARTEMIS. The mutation was confirmed by Sanger sequencing (Fig 1, G) and predicted to be damaging by PolyPhen (0.999) and SIFT (0). Both parents were heterozygous for the mutation. The patient also had a heterozygous polymorphism in EVER1 (c.T373C; p.W125R, rs2748427) and a homozygous polymorphism in EVER2 (c.A917T; p.N306I, rs7208422), both unlikely to be pathogenic because they have minor allele frequencies exceeding 30% in the 1000 Genomes database and Exome Variant Server, and are tolerated by SIFT (1) and benign by PolyPhen (0). There were no other homozygous or heterozygous mutations consistent with the patient's phenotype (see Table E1 in this article's Online Repository at www.jacionline.org).Table IImmunologic profile of the patientAge (y)1921Immunoglobulins (mg/dL) IgG2568 (639-1349)2750 (639-1349) IgM185 (56-352)190 (56-352) IgAUnd. (70-312)Und. (70-312)Lymphocyte subsets Lymphocytes (cells/μL)896 (1400-3300)882 (1400-3300) CD3+654 (700-2100)662 (700-2100)CD3+CD4+224 (300-1400)185 (300-1400)CD3+CD8+412 (200-900)357 (200-900) CD4+ T-cell subsets (% of CD4)CD4+CD45RA+32.5CD4+CD45RO+9798CD4+CD31+CD45RA+21.5 CD8+ T-cell subsets (% of CD8)CD8+CCR7+CD45RA+ND0.4CD8+CCR7+CD45RA−ND2CD8+CCR7−CD45RA−ND29.6CD8+CCR7−CD45RA+ND68 B cellsCD19+ (cells/μL)15 (100-500)9 (100-500) NK cells (cells/μL)CD3−CD16+56+170 (90-600)203 (90-600)T-cell proliferation (cpm × 10−3) PhytohemagglutininND5.05 (93.07) Anti-CD3 mAbND8.13 (44.61) PMA + ionomycinND2.98 (26.06)The age-matched normal ranges (shown in parentheses) for immunoglobulin concentrations and lymphocyte numbers have been previously described in the literature.9Jolliff C.R. Cost K.M. Stivrins P.C. Grossman P.P. Nolte C.R. Franco S.M. et al.Reference intervals for serum IgG, IgA, IgM, C3, and C4 as determined by rate nephelometry.Clin Chem. 1982; 28: 126-128Crossref PubMed Scopus (140) Google Scholar, 10Morbach H. Eichhorn E.M. Liese J.G. Girschick H.J. Reference values for B cell subpopulations from infancy to adulthood.Clin Exp Immunol. 2010; 162: 271-279Crossref PubMed Scopus (255) Google Scholar, 11Piatosa B. Wolska-Kusnierz B. Pac M. Siewiera K. Galkowska E. Bernatowska E. B cell subsets in healthy children: reference values for evaluation of B cell maturation process in peripheral blood.Cyto Part B Clin Cyto. 2010; 78: 372-381Crossref PubMed Scopus (109) Google Scholar, 12Shearer W.T. Rosenblatt H.M. Gelman R.S. Oyomopito R. Plaeger S. Stiehm E.R. et al.Lymphocyte subsets in healthy children from birth through 18 years of age: the Pediatric AIDS Clinical Trials Group P1009 study.J Allergy Clin Immunol. 2003; 112: 973-980Abstract Full Text Full Text PDF PubMed Scopus (634) Google Scholar The serum immunoglobulin concentrations shown were obtained when the patient was off immunoglobulin replacement therapy. Patient lymphoproliferative responses, expressed as radioactive counts per minute (cpm), were measured by 3H-thymidine DNA incorporation comparing responses from a normal healthy individual studied on the same day as the patient (results shown in parentheses) as a methodological control.PMA, Phorbol 12-myristate 13-acetate; ND, not determined; NK, natural killer; Und., undetectable. Open table in a new tab The age-matched normal ranges (shown in parentheses) for immunoglobulin concentrations and lymphocyte numbers have been previously described in the literature.9Jolliff C.R. Cost K.M. Stivrins P.C. Grossman P.P. Nolte C.R. Franco S.M. et al.Reference intervals for serum IgG, IgA, IgM, C3, and C4 as determined by rate nephelometry.Clin Chem. 1982; 28: 126-128Crossref PubMed Scopus (140) Google Scholar, 10Morbach H. Eichhorn E.M. Liese J.G. Girschick H.J. Reference values for B cell subpopulations from infancy to adulthood.Clin Exp Immunol. 2010; 162: 271-279Crossref PubMed Scopus (255) Google Scholar, 11Piatosa B. Wolska-Kusnierz B. Pac M. Siewiera K. Galkowska E. Bernatowska E. B cell subsets in healthy children: reference values for evaluation of B cell maturation process in peripheral blood.Cyto Part B Clin Cyto. 2010; 78: 372-381Crossref PubMed Scopus (109) Google Scholar, 12Shearer W.T. Rosenblatt H.M. Gelman R.S. Oyomopito R. Plaeger S. Stiehm E.R. et al.Lymphocyte subsets in healthy children from birth through 18 years of age: the Pediatric AIDS Clinical Trials Group P1009 study.J Allergy Clin Immunol. 2003; 112: 973-980Abstract Full Text Full Text PDF PubMed Scopus (634) Google Scholar The serum immunoglobulin concentrations shown were obtained when the patient was off immunoglobulin replacement therapy. Patient lymphoproliferative responses, expressed as radioactive counts per minute (cpm), were measured by 3H-thymidine DNA incorporation comparing responses from a normal healthy individual studied on the same day as the patient (results shown in parentheses) as a methodological control. PMA, Phorbol 12-myristate 13-acetate; ND, not determined; NK, natural killer; Und., undetectable. The patient's mutation in ARTEMIS is in the β-lactamase domain, located in the N-terminal region that also contains the central β-CASP domain. Both domains have critical catalytic functions required for resolution of hairpin coding ends during V(D)J recombination, and processing overhangs that occur in a small fraction of DNA double-strand breaks.13Felgentreff K. Lee Y.N. Frugoni F. Du L. van der Burg M. Giliani S. et al.Functional analysis of naturally occurring DCLRE1C mutations and correlation with the clinical phenotype of ARTEMIS deficiency.J Allergy Clin Immunol. 2015; 136: 140-150.e7Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar Hypomorphic mutations in ARTEMIS, which include missense mutations in the β-lactamase domain, may preserve residual protein function and result in TlowB–/low leaky SCID or Omenn syndrome.13Felgentreff K. Lee Y.N. Frugoni F. Du L. van der Burg M. Giliani S. et al.Functional analysis of naturally occurring DCLRE1C mutations and correlation with the clinical phenotype of ARTEMIS deficiency.J Allergy Clin Immunol. 2015; 136: 140-150.e7Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar The β-lactamase domain mutation in our patient (L123S) was associated with the presence of T cells, albeit in decreased numbers, a normal polyclonal Vβ repertoire, and normal or elevated concentrations of IgM and IgG, but absent IgA. Nonhomologous end-joining is the principle mechanism involved in double-strand break repair during class switch recombination. When the function of ARTEMIS is impaired, varying modes of class switch recombination junction resolution may be used for different isotype switch regions. This may explain the severe impairment of IgA production in our patient.14Du L. van der Burg M. Popov S.W. Kotnis A. van Dongen J.J. Gennery A.R. et al.Involvement of Artemis in nonhomologous end-joining during immunoglobulin class switch recombination.J Exp Med. 2008; 205: 3031-3040Crossref PubMed Scopus (36) Google Scholar Residual ARTEMIS endonuclease activity may have accounted for the relatively mild clinical presentation of our patient and his survival into adulthood. Clinical manifestations of patients with hypomorphic ARTEMIS deficiency include recurrent respiratory tract infections, candidiasis, immune dysregulation, inflammatory bowel disease, and malignancies.15Volk T. Pannicke U. Reisli I. Bulashevska A. Ritter J. Bjorkman A. et al.DCLRE1C (ARTEMIS) mutations causing phenotypes ranging from atypical severe combined immunodeficiency to mere antibody deficiency.Hum Mol Genet. 2015; 24: 7361-7372Crossref PubMed Scopus (50) Google Scholar None of the reported patients survived into adulthood without hematopoietic stem cell transplantation, except for one who continued to have severe infections and developed carcinoma in situ of the nipple.16Woodbine L. Grigoriadou S. Goodarzi A.A. Riballo E. Tape C. Oliver A.W. et al.An Artemis polymorphic variant reduces Artemis activity and confers cellular radiosensitivity.DNA Repair (Amst). 2010; 9: 1003-1010Crossref PubMed Scopus (30) Google Scholar Our patient's clinical presentation was notable for his survival into adulthood, and for EV-HPV, likely due to his severely impaired T-cell function. Our observation broadens the scope of genetic defects leading to EV, and highlights the role of T cells in host defense against HPV. Recognition of EV as a potential manifestation of a T-cell defect is important for the diagnosis of primary immunodeficiency. Peripheral blood was obtained from patients and healthy controls after securing informed consent forms approved by the Institutional Review Board of the Children's Hospital, Boston, and according to the Declaration of Helsinki. PBMCs were isolated on a Ficoll-Paque PLUS gradient (GE Healthcare, Marlborough, Mass). Lymphocyte subset analysis was determined by surface staining flow cytometry using standard methods. Antibodies for flow cytometry were purchased from Biolegend (San Diego, Calif). The patient's CD4 and CD8 TCR Vβ repertoires were analyzed by flow cytometry using the IOTest Beta Mark kit (Beckman Coulter, Danvers, Mass) that detects 24 different Vβ TCRs, according to the manufacturer's instructions. Samples were collected with an LSRFortessa cell analyzer (BD Biosciences, San Jose, Calif) and analyzed with FlowJo software (Tree Star Inc, Ashland, Ore). PBMCs (1.0 × 106 per mL) were cultured with medium, or stimulated with 5 μg/mL phytohemagglutinin (Sigma Aldrich, St Louis, Mo), 100 ng/mL anti-CD3 mAb (OKT3, eBioscience, San Diego, Calif), or 20 ng/mL phorbol myristate acetate plus 0.5 μM ionomycin (Sigma Aldrich). Proliferation was assayed 4 days later by measuring 3H-thymidine incorporation added for the last 16 hours of culture, using a Trilux 1450 MicroBeta counter (PerkinElmer, Waltham, Mass).Table E1Homozygous mutations in the patient identified by WES and not found in the dbSNP 135 databaseChrStartEndReferencePatientGenechr013807734938077349—ARSPO1chr014761433947614339GACYP4A22chr028892675288926754AGC—EIF2AK3chr02220379729220379729CTACCN4chr035030675750306757—CSEMA3Bchr035332482953324834CACTGG—DCP1Achr03126224802126224802CTUROC1chr03126352875126352875TGTXNRD3chr03195594929195594929CGTNK2chr04155244425155244428GTTT—DCHS2chr057402185374021858ACTCAA—GFM2chr059819216798192169GAG—CHD1chr05135276205135276207GTT—FBXL21chr06161519381161519383CTG—MAP3K4chr0715866611586661—CGCTMEM184Achr071572582415725826GTG—MEOX2chr077366867273668672CARFC2chr07102575006102575008GAA—LRRC17chr07141736679141736679CAMGAMchr082247794822477948—TTBIN3chr08144511981144511983TGG—MAFAchr0920398172039817—GCASMARCA2chr093590660735906607GCHRCT1chr097931837879318392GACAGCCTGCAACGT—PRUNE2chr098559730985597318CTTTTCTTTT—RASEFchr099523706695237068ATC—ASPNchr099552708395527113AGCCGCCGCCGCTGCCGCCGCCGCCGCCGCCAGCCGCCGCCGCCGCTGCCGCCGCCGCCGCCGCCBICD2chr099643900696439006—TGCCTCCACCACACCPHF2chr101137461211374647CCAGTCTTCCTCTTCGGCATGCCCTGGAAGCTTCTT—CELF2chr101497755814977558AGDCLRE1Cchr102180546621805497CCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCC10orf140chr107678192776781929GAA—KAT6Bchr10102770293102770326TGCTGCGGCTGCGGCTGCGGCTACGGCTGCGGCTTGCTGCGGCTGCGGCTGCGGCTGCGGCTACGGCTGCGGCTPDZD7chr12419000419000CTKDM5Achr1219402691940269AGLRTM2chr1267771116777113CTG—ZNF384chr121472057414720576CAG—PLBD1chr125306923553069255GTAGCTGCTACCTCCGGAGCC—KRT1chr127209131272091312TCTMEM19chr128279288382792883TAC12orf26chr128541131185411311TCTSPAN19chr12124887095124887095—CTGNCOR2chr137244068472440689CCGCCG—DACH1chr15102029688102029688—CGPCSK6chr163061470030614701TT—ZNF689chr166787685167876853CAG—THAP11chr1777502167750216—ACCKDM6Bchr173925433639254336—TKRTAP4-8chr1983898988389900CTC—KANK3chr194995646849956487ACCCCATTCCCATTAGCCCC—ALDH16A1chr20238439238444TCTTGG—DEFB132chr203266486532664865—AGCRALYchr204400415944004161ATT—TP53TG5chr214605762546057660TGTCTGCTGTGTGCCCGTCTGCTGCGTGCCCGTCTGTGTCTGCTGCGTGCCCGTCTGKRTAP10-10chr222078003020780030—CSCARF2chr223790633837906343TCTCCT—CARD10chrX98631269863126CASHROOM2chrX3032732730327327CTNR0B1chrX3814518038145191CTCCCCTTCCAC—RPGRchrX5035075050350750—CCTSHROOM4chrX134991806134991806GASAGE1chrX152106692152106692AGZNF185chrX152864480152864480—CFAM58AchrX153069577153069577GCPDZD4Per conventional WES nomenclature, the nucleotides shown are on the positive strand. The patient's mutation in DCLRE1C is given in boldface.Chr, Chromosome; WES, whole-exome sequencing. Open table in a new tab Per conventional WES nomenclature, the nucleotides shown are on the positive strand. The patient's mutation in DCLRE1C is given in boldface. Chr, Chromosome; WES, whole-exome sequencing.