Receptor For Foot-and-mouth Disease Virus Research Articles

An Improved αvβ6-Receptor-Expressing Suspension Cell Line for Foot-and-Mouth Disease Vaccine Production.

Foot-and-mouth disease (FMD) is endemic in large parts of sub-Saharan Africa, Asia and South America, where outbreaks in cloven-hooved livestock threaten food security and have severe economic impacts. Vaccination in endemic regions remains the most effective control strategy. Current FMD vaccines are produced from chemically inactivated foot-and-mouth disease virus (FMDV) grown in suspension cultures of baby hamster kidney 21 cells (BHK-21). Strain diversity means vaccines produced from one subtype may not fully protect against circulating disparate subtypes, necessitating the development of new vaccine strains that “antigenically match”. However, some viruses have proven difficult to adapt to cell culture, slowing the manufacturing process, reducing vaccine yield and limiting the availability of effective vaccines, as well as potentiating the selection of undesired antigenic changes. To circumvent the need to cell culture adapt FMDV, we have used a systematic approach to develop recombinant suspension BHK-21 that stably express the key FMDV receptor integrin αvβ6. We show that αvβ6 expression is retained at consistently high levels as a mixed cell population and as a clonal cell line. Following exposure to field strains of FMDV, these recombinant BHK-21 facilitated higher virus yields compared to both parental and control BHK-21, whilst demonstrating comparable growth kinetics. The presented data supports the application of these recombinant αvβ6-expressing BHK-21 in future FMD vaccine production.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin β6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin β6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin β6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin β6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin β6.

A Prime-Boost Vaccination Strategy in Cattle to Prevent Foot-and-Mouth Disease Using a "Single-Cycle" Alphavirus Vector and Empty Capsid Particles.

Foot-and-mouth disease (FMD) remains one of the most economically important infectious diseases of production animals globally. Vaccination can successfully control this disease, however, current vaccines are imperfect. They are made using chemically inactivated FMD virus (FMDV) that is produced in large-scale mammalian cell culture under high containment conditions. Here, we have expressed the FMDV capsid protein precursor (P1-2A) of strain O1 Manisa alone or with the FMDV 3C protease (3Cpro) using a “single cycle” packaged alphavirus self-replicating RNA based on Semliki Forest virus (SFV). When the FMDV P1-2A was expressed with 3Cpro then processing of the FMDV capsid precursor protein is observed within cells and the proteins assemble into empty capsid particles. The products interact with anti-FMDV antibodies in an ELISA and bind to the integrin αvβ6 (a cellular receptor for FMDV). In cattle vaccinated with these rSFV-FMDV vectors alone, anti-FMDV antibodies were elicited but the immune response was insufficient to give protection against FMDV challenge. However, the prior vaccination with these vectors resulted in a much stronger immune response against FMDV post-challenge and the viremia observed was decreased in level and duration. In subsequent experiments, cattle were sequentially vaccinated with a rSFV-FMDV followed by recombinant FMDV empty capsid particles, or vice versa, prior to challenge. Animals given a primary vaccination with the rSFV-FMDV vector and then boosted with FMDV empty capsids showed a strong anti-FMDV antibody response prior to challenge, they were protected against disease and no FMDV RNA was detected in their sera post-challenge. Initial inoculation with empty capsids followed by the rSFV-FMDV was much less effective at combating the FMDV challenge and a large post-challenge boost to the level of anti-FMDV antibodies was observed. This prime-boost system, using reagents that can be generated outside of high-containment facilities, offers significant advantages to achieve control of FMD by vaccination.

Role of Jumonji C-domain containing protein 6 (JMJD6) in infectivity of foot-and-mouth disease virus

Foot-and-mouth disease virus (FMDV) utilizes four integrins (αvβ1, αvβ3, αvβ6, and αvβ8) as its primary cell receptor. During cell culture propagation, FMDV frequently adapts to use heparan sulfate (HS), and rarely utilizes an unidentified third receptor. Capsid mutations acquired by a soluble integrin resistant FMDV cause (i) adaptation to CHO-677 cells (ii) increased affinity to membrane-bound Jumonji C-domain containing protein 6 (JMJD6) (iii) induced JMJD6 re-localization from the cell surface and cytoplasm to the nucleus. Interestingly, pre-treatment of cells with N- and C-terminal JMJD6 antibodies or by simultaneous incubation of mutant virus with soluble JMJD6 (but not by treatment with HS or αvβ6) impaired virus infectivity in cultured cells. JMJD6 and mutant virus co-purified by reciprocal co-immunoprecipitation. Molecular docking predictions suggested JMJD6 C-terminus interacts with mutated VP1 capsid protein. We conclude when specific VP1 mutations are displayed, JMJD6 contributes to FMDV infectivity and may be a previously unidentified FMDV receptor.

Assembly and characterization of foot-and-mouth disease virus empty capsid particles expressed within mammalian cells

The foot-and-mouth disease virus (FMDV) structural protein precursor, P1-2A, is cleaved by the virus-encoded 3C protease (3C(pro)) into the capsid proteins VP0, VP1 and VP3 (and 2A). In some systems, it is difficult to produce large amounts of these processed capsid proteins since 3C(pro) can be toxic for cells. The expression level of 3C(pro) activity has now been reduced relative to the P1-2A, and the effect on the yield of processed capsid proteins and their assembly into empty capsid particles within mammalian cells has been determined. Using a vaccinia-virus-based transient expression system, P1-2A (from serotypes O and A) and 3C(pro) were expressed from monocistronic cDNA cassettes as P1-2A-3C, or from dicistronic cassettes with the 3C(pro) expression dependent on a mutant FMDV internal ribosome entry site (IRES) (designated P1-2A-mIRES-3C). The effects of using a mutant 3C(pro) with reduced catalytic activity or using two different mutant IRES elements (the wt GNRA tetraloop sequence GCGA converted, in the cDNA, to GAGA or GTTA) were analysed. For both serotypes, the P1-2A-mIRES-3C construct containing the inefficient GTTA mutant IRES produced the highest amount of processed capsid proteins. These products self-assembled to form FMDV empty capsid particles, which have a related, but distinct, morphology (as determined by electron microscopy and reconstruction) from that determined previously by X-ray crystallography. The assembled empty capsids bind, in a divalent cation-dependent manner, to the RGD-dependent integrin αvβ6, a cellular receptor for FMDV, and are recognized appropriately in serotype-specific antigen ELISAs.

Mechanisms of foot-and-mouth disease virus tropism inferred from differential tissue gene expression.

Foot-and-mouth disease virus (FMDV) targets specific tissues for primary infection, secondary high-titer replication (e.g. foot and mouth where it causes typical vesicular lesions) and long-term persistence at some primary replication sites. Although integrin αVβ6 receptor has been identified as primary FMDV receptors in animals, their tissue distribution alone fails to explain these highly selective tropism-driven events. Thus, other molecular mechanisms must play roles in determining this tissue specificity. We hypothesized that differences in certain biological activities due to differential gene expression determine FMDV tropism and applied whole genome gene expression profiling to identify genes differentially expressed between FMDV-targeted and non-targeted tissues in terms of supporting primary infection, secondary replication including vesicular lesions, and persistence. Using statistical and bioinformatic tools to analyze the differential gene expression, we identified mechanisms that could explain FMDV tissue tropism based on its association with differential expression of integrin αVβ6 heterodimeric receptor (FMDV receptor), fibronectin (ligand of the receptor), IL-1 cytokines, death receptors and the ligands, and multiple genes in the biological pathways involved in extracellular matrix turnover and interferon signaling found in this study. Our results together with reported findings indicate that differences in (1) FMDV receptor availability and accessibility, (2) type I interferon-inducible immune response, and (3) ability to clear virus infected cells via death receptor signaling play roles in determining FMDV tissue tropism and the additional increase of high extracellular matrix turnover induced by FMDV infection, likely via triggering the signaling of highly expressed IL-1 cytokines, play a key role in the pathogenesis of vesicular lesions.

Low levels of foot-and-mouth disease virus 3C protease expression are required to achieve optimal capsid protein expression and processing in mammalian cells

The foot-and-mouth disease virus (FMDV) capsid protein precursor (P1-2A) is processed by the virus-encoded 3C protease (3C(pro)) to produce VP0, VP3, VP1 and 2A. Within the virus-encoded polyprotein, the P1-2A and 3C(pro) can be expected to be produced at equivalent concentrations. However, using transient-expression assays, within mammalian cells, it is possible to modify the relative amounts of the substrate and protease. It has now been shown that optimal production of the processed capsid proteins from P1-2A is achieved with reduced levels of 3C(pro) expression, relative to the P1-2A, compared with that achieved with a single P1-2A-3C polyprotein. Expression of the FMDV 3C(pro) is poorly tolerated by mammalian cells and higher levels of the 3C(pro) greatly inhibit protein expression. In addition, it is demonstrated that both the intact P1-2A precursor and the processed capsid proteins can be efficiently detected by FMDV antigen detection assays. Furthermore, the P1-2A and the processed forms each bind to the integrin αvβ6, the major FMDV receptor. These results contribute to the development of systems which efficiently express the components of empty capsid particles and may represent the basis for safer production of diagnostic reagents and improved vaccines against foot-and-mouth disease.

Lentviral-mediated RNAi to inhibit target gene expression of the porcine integrin αv subunit, the FMDV receptor, and against FMDV infection in PK-15 cells

BackgroundshRNA targeting the integrin αv subunit, which is the foot-and-mouth disease virus (FMDV) receptor, plays a key role in virus attachment to susceptible cells. We constructed a RNAi lentiviral vector, iαv pLenti6/BLOCK -iT™, which expressed siRNA targeting the FMDV receptor, the porcine integrin αv subunit, on PK-15 cells. We also produced a lentiviral stock, established an iαv-PK-15 cell line, evaluated the gene silencing efficiency of mRNA using real-time qRT-PCR, integrand αv expression by indirect immunofluorescence assay (IIF) and cell enzyme linked immunosorbent assays (cell ELISA), and investigated the in vivo inhibitory effect of shRNA on FMDV replication in PK-15 cells.ResultsOur results indicated successful establishment of the iαv U6 RNAi entry vector and the iαv pLenti6/BLOCK -iT expression vector. The functional titer of obtained virus was 1.0 × 106 TU/mL. To compare with the control and mock group, the iαv-PK-15 group αv mRNA expression rate in group was reduced by 89.5%, whilst IIF and cell ELISA clearly indicated suppression in the experimental group. Thus, iαv-PK-15 cells could reduce virus growth by more than three-fold and there was a > 99% reduction in virus titer when cells were challenged with 102 TCID50 of FMDV.ConclusionsIαv-PK-15 cells were demonstrated as a cell model for anti-FMDV potency testing, and this study suggests that shRNA could be a viable therapeutic approach for controlling the severity of FMD infection and spread.

The capsid protein of foot-and-mouth disease virus interacts with host toll-like receptor 2 to induce innate immunity (154.14)

Abstract The mechanism of interaction between foot-and-mouth disease virus (FMDV) with the host immune system is not clear. In this study, we investigated the interaction between FMDV and Toll-like receptor 2 (TLR2), an important pattern recognition receptor that regulates host immune function. We found that binary ethylenimine-inactivated FMDV (I-FMDV) activated NF-κB only upon expression of TLR2 but not other TLRs in HEK293T cells. I-FMDV induced IL-6 production in macrophages from wild-type but not TLR2 knockout mice. Coexpression of TLR6 or CD14 with TLR2 markedly enhanced NF-κB activation induced by I-FMDV. Further study indicated that VP1 and VP3 but not VP42, all of which are the capsid proteins of FMDV, are the ligands of TLR2. Co-immunoprecipitation assay also demonstrated that VP1 and VP3 interacted with TLR2 as well as CD14, but not TLR6. These results suggest that TLR6 and CD14 may serve as coreceptors of TLR2 which interacts with VP1 and VP3 of FMDV to induce pro-inflammatory cytokines production and immune responses.

Foot-and-Mouth Disease Virus Assembly: Processing of Recombinant Capsid Precursor by Exogenous Protease Induces Self-Assembly of Pentamers In Vitro in a Myristoylation-Dependent Manner

The assembly of foot-and-mouth disease virus (FMDV) particles is poorly understood. In addition, there are important differences in the antigenic and receptor binding properties of virus assembly and dissociation intermediates, and these also remain unexplained. We have established an experimental model in which the antigenicity, receptor binding characteristics, and in vitro assembly of capsid precursor can be studied entirely from purified components. Recombinant capsid precursor protein (P1 region) was expressed in Escherichia coli as myristoylated or unmyristoylated protein. The protein sedimented in sucrose gradients at 5S and reacted with monoclonal antibodies which recognize conformational or linear antigen determinants on the virion surface. In addition, it bound the integrin alpha(v)beta(6), a cellular receptor for FMDV, indicating that unprocessed recombinant capsid precursor is both structurally and antigenically similar to native virus capsid. These characteristics were not dependent on the presence of 2A at the C terminus but were altered by N-terminal myristoylation and in mutant precursors which lacked VP4. Proteolytic processing of myristoylated precursor by recombinant FMDV 3C(pro) in vitro induced a shift in sedimentation from 5S to 12S, indicating assembly into pentameric capsid subunits. Nonmyristoylated precursor still assembled into higher-order structures after processing with 3C(pro), but these particles sedimented in sucrose gradients at approximately 17S. In contrast, mutant precursors lacking VP4 were antigenically distinct, were unable to form pentamers, and had reduced capacity for binding integrin receptor. These studies demonstrate the utility of recombinant capsid precursor protein for investigating the initial stages of assembly of FMDV and other picornaviruses.

Analysis of Foot-and-Mouth Disease Virus Integrin Receptor Expression in Tissues from Naïve and Infected Cattle

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals principally affecting cattle, pigs and sheep. FMD virus (FMDV) uses the alpha(V)beta(1), alpha(V)beta(3), alpha(V)beta(6), and alpha(V)beta(8) integrins as receptors in vitro via a highly conserved arginine-glycine-aspartic acid amino acid sequence motif located within the betaG-betaH loop of VP1. Immunofluorescence and confocal microscopy were used to study the expression of two major FMDV receptors, alpha(V)beta(3) and alpha(V)beta(6), within epithelial tissues from FMDV-infected and uninfected cattle in order to understand the role of these receptors in tissue tropism. Integrin alpha(V)beta(6) was expressed by epithelial cells in tissues that are important sites for FMDV replication (i.e. tongue and coronary band). Integrin alpha(V)beta(3) was detected in epithelium of all tissues examined except tongue. In addition, alpha(V)beta(3) expression was associated with blood vessels in all tissues examined. In infected tissues, alpha(V)beta(6) integrin was distributed on the surface of those epithelial cells also expressing FMDV antigen. Although integrin alpha(V)beta(3) has been shown to be a receptor for FMDV, no expression of alpha(V)beta(3) was associated with FMDV-positive keratinocytes in the tongue. In contrast, podal epithelial cells containing FMDV antigen also expressed alpha(V)beta(3) integrin. Thus, at the cellular level the expression of these two integrins correlates with susceptibility to infection and may contribute substantially to viral tropism in FMD pathogenesis.

Role of the cytoplasmic domain of the beta-subunit of integrin alpha(v)beta6 in infection by foot-and-mouth disease virus.

Field isolates of foot-and-mouth disease virus (FMDV) are believed to use RGD-dependent integrins as cellular receptors in vivo. Using SW480 cell transfectants, we have recently established that one such integrin, alpha(v)beta6, functions as a receptor for FMDV. This integrin was shown to function as a receptor for virus attachment. However, it was not known if the alpha(v)beta6 receptor itself participated in the events that follow virus binding to the host cell. In the present study, we investigated the effects of various deletion mutations in the beta6 cytoplasmic domain on infection. Our results show that although loss of the beta6 cytoplasmic domain has little effect on virus binding, this domain is essential for infection, indicating a critical role in postattachment events. The importance of endosomal acidification in alpha(v)beta6-mediated infection was confirmed by experiments showing that infection could be blocked by concanamycin A, a specific inhibitor of the vacuolar ATPase.

The epithelial integrin alphavbeta6 is a receptor for foot-and-mouth disease virus.

Field isolates of foot-and-mouth disease virus (FMDV) have been shown to use the RGD-dependent integrin alphavbeta3 as a cellular receptor on cultured cells. However, several other RGD-dependent integrins may have the potential to act as receptors for FMDV in vivo. Of these, alphavbeta6 is a likely candidate for use as a receptor by FMDV as it is expressed on epithelial cells, which correlates with the tissue tropism of the virus. In this report, we show that human colon carcinoma cells (SW480) that are normally nonpermissive for FMDV become susceptible to infection as a result of transfection with the integrin beta6 subunit and expression of alphavbeta6 at the cell surface. Integrin alphavbeta6 is the major site for virus attachment on the beta6-transfected cells, and binding to alphavbeta6 serves to increase the rate of virus entry into these cells. In addition, we show that virus binding and infection of the beta6-transfected cells is mediated through an RGD-dependent interaction that is specifically inhibited by a monoclonal antibody (10D5) that recognizes alphavbeta6. These studies establish a role for alphavbeta6 as a cellular receptor for FMDV.

Foot-and-mouth disease virus is a ligand for the high-affinity binding conformation of integrin alpha5beta1: influence of the leucine residue within the RGDL motif on selectivity of integrin binding.

Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors for internalization, whereas strains that are adapted for growth in cultured cell lines appear to be able to use alternative receptors like heparan sulphate proteoglycans (HSPG). The ligand-binding potential of integrins is regulated by changes in the conformation of their ectodomains and the ligand-binding state would be expected to be an important determinant of tropism for viruses that use integrins as cellular receptors. Currently, alphavbeta3 is the only integrin that has been shown to act as a receptor for FMDV. In this study, a solid-phase receptor-binding assay has been used to characterize the binding of FMDV to purified preparations of the human integrin alpha5beta1, in the absence of HSPG and other RGD-binding integrins. In this assay, binding of FMDV resembled authentic ligand binding to alpha5beta1 in its dependence on divalent cations and specific inhibition by RGD peptides. Most importantly, binding was found to be critically dependent on the conformation of the integrin, as virus bound only after induction of the high-affinity ligand-binding state. In addition, the identity of the amino acid residue immediately following the RGD motif is shown to influence differentially the ability of FMDV to bind integrins alpha5beta1 and alphavbeta3 and evidence is provided that alpha5beta1 might be an important FMDV receptor in vivo.

Specific Interactions between Human Integrin αvβ3and Chimeric Hepatitis B Virus Core Particles Bearing the Receptor-Binding Epitope of Foot-and-Mouth Disease Virus

Purified integrin αvβ3was used in solid-phase binding studies with chimeric hepatitis B cores which carry the RGD-containing loop of VP1 protein of the foot-and-mouth disease virus (FMDV). High levels of specific binding between the integrin and the particles were detected by enzyme-linked immunosorbent assays. The binding was Mn2+cation dependent and could be competed with fibronectin, vitronectin, and the peptide GRGDSPK. Particles in which the RGD motif had been mutated to RGE failed to bind, indicating that the chimeric cores bound specifically to the ligand binding site of integrin αvβ3. Electron micrographs showed several individual αvβ3molecules bound to the surface of each chimeric particle. Collectively, these data constitute firm evidence that the RGD-containing loop of FMDV is critical for binding to αvβ3and provide support for identification of αvβ3as a potential cellular receptor for FMDV.

Propagation of an attenuated virus by design: engineering a novel receptor for a noninfectious foot-and-mouth disease virus.

To gain entry into cells, viruses utilize a variety of different cell-surface molecules. Foot-and-mouth disease virus (FMDV) binds to cell-surface integrin molecules via an arginine-glycine-aspartic acid (RGD) sequence in capsid protein VP1. Binding to this particular cell-surface molecule influences FMDV tropism, and virus/receptor interactions appear to be responsible, in part, for selection of antigenic variants. To study early events of virus-cell interaction, we engineered an alternative and novel receptor for FMDV. Specifically, we generated a new receptor by fusing a virus-binding, single-chain antibody (scAb) to intracellular adhesion molecule 1 (ICAM1). Cells that are normally not susceptible to FMDV infection became susceptible after being transfected with DNA encoding the scAb/ICAM1 protein. An escape mutant (B2PD.3), derived with the mAb used to generate the genetically engineered receptor, was restricted for growth on the scAb/ICAM1 cells, but a variant of B2PD.3 selected by propagation on scAb/ICAM1 cells grew well on these cells. This variant partially regained wild-type sequence in the epitope recognized by the mAb and also regained the ability to be neutralize by the mAb. Moreover, RGD-deleted virions that are noninfectious in animals and other cell types grew to high titers and were able to form plaques on scAb/ ICAM1 cells. These studies demonstrate the first production of a totally synthetic cell-surface receptor for a virus. This novel approach will be useful for studying virus reception and for the development of safer vaccines against viral pathogens of animals and humans.

Antibodies to the vitronectin receptor (integrin alpha V beta 3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells

The amino acid sequence Arg-Gly-Asp (RGD) is highly conserved on the VP1 proteins of different serotypes and subtypes of foot-and-mouth disease virus (FMDV) and is essential for cell attachment. This sequence is also found in certain extracellular matrix proteins that bind to a family of cell surface receptors called integrins. Within the Picornaviridae family, enterovirus coxsackievirus A9 also has an RGD motif on its VP1 capsid protein and has recently been shown to utilize the vitronectin receptor integrin alpha V beta 3 as a receptor on monkey kidney cells. Competition binding experiments between type A12 FMDV and coxsackievirus A9 using BHK-21 and LLC-MK2 cells revealed shared receptor specificity between these two viruses. Polyclonal anti-serum to the vitronectin receptor and a monoclonal antibody to the alpha V subunit inhibited both FMDV binding and plaque formation, while a monoclonal antibody to the beta 3 subunit inhibited virus binding. In contrast, antibodies to the fibronectin receptor (alpha 5 beta 1) or to the integrin (alpha V beta 5) had no effect on either binding or plaque formation. These data demonstrate that the alpha V beta 3 vitronectin receptor can function as a receptor for FMDV.

Immunogenicity of foot-and-mouth disease virus grown in BHK-21 suspension cells. Correlation with cell ploidy alterations and abnormal expression of the alpha 5 beta 1 integrin.

BHK-21 suspension cells were characterized with regard to genetic and phenotypic features which might adversely affect the immunogenic properties of foot-and-mouth disease virus (FMDV) grown therein. A positive correlation was found between number of passages in suspension culture and both prevalence of polyploid cells and reduced cell growth on surfaces. Suspension cells also revealed differences in the expression of RGD-specific integrins and, in particular, of alpha 5 beta 1, which was shown to work as an FMDV receptor structure. These features, along with the notable instability of a few non-structural FMDV A5 proteins in infected cells, outline a new scenario, in which the reduced immunogenicity of FMDV might be accounted for by defined negative influences of the cell environment on viral replication.

Antibody-Complexed Foot-and-Mouth Disease Virus, but Not Poliovirus, Can Infect Normally Insusceptible Cells via the Fc Receptor

Poliovirus and foot-and-mouth disease virus (FMDV) initiate infection by binding to specific cell surface receptors, which is followed by a poorly understood disassembly process. To probe these early steps of infection, the ability of poliovirus and FMDV to infect cells following binding through an alternative receptor was examined. For these studies, a Chinese hamster ovary (CHO) cell line expressing the B2 isoform of the murine Fc receptor (FcR) was used. Both viruses were able to bind to this cell line in an antibody-dependent manner, but only FMDV was able to productively infect these cells following binding through the FcR. These results suggest that the natural poliovirus receptor has dual functions in binding and destabilizing the virus particle, whereas the putative FMDV receptor may only be necessary for virion binding. These findings are consistent with differences in virion architecture which predict a mere intimate virion-receptor association for poliovirus than for FMDV.