Real-time Polymerase Chain Reaction Instrument Research Articles

Real-time digital polymerase chain reaction (PCR) as a novel technology improves limit of detection for rare allele assays.

BackgroundTumor heterogeneity may lead to false negative test results for tissue biopsy-based companion diagnostic tests. Real-time polymerase chain reaction (PCR) and digital PCR assays are used to detect rare alleles in cell-free circulating DNA for liquid biopsies; however, those tests lack strong sensitivity at low allele frequencies. We show here a novel real-time digital PCR instrument that utilizes cycle-based amplification curves to further improve the sensitivity and quantification accuracy of digital PCR.MethodsThe novel real-time digital PCR instrument was compared to an endpoint digital PCR system to determine the sensitivity and quantification accuracy of both instruments. Samples were all thermal cycled on the real-time digital PCR instrument but were analyzed on both endpoint and real-time digital PCR instruments to compare the performance without introducing other variables. Contrived samples for epidermal growth factor receptor (EGFR) exon 19 deletion, T790M, and L858R point mutations as well as human epidermal growth factor receptor 2 (HER2) amplification were tested. Different mutant allele frequencies and wildtype to mutant gene copy number ratios were tested for EGFR and HER2, respectively.ResultsBy removing false positive datapoints using real-time amplification curves, real-time digital PCR improved sensitivity by lowering the baseline for wildtype samples. For EGFR 19del assay, samples with 2 or more fluorescein amidite (FAM) labeled positive wells are determined positive by real-time digital PCR, while a minimum of 5 FAM positive datapoints is needed by endpoint digital PCR. Improved limit of detection for EGFR 19del mutation was also observed. Real-time digital PCR also had better quantification accuracy and sensitivity, resulting in the mutant allele frequencies being closer to the expected values for all EGFR mutations, especially at very low allele frequencies. However, at high allele frequencies or for gene amplification assays, real-time digital PCR is comparable with endpoint digital PCR.ConclusionsThis novel technology with improved sensitivity is important and needed because it addresses current issues with liquid biopsy tests. Due to limited amounts of circulating tumor DNA (ctDNA) obtained for liquid biopsy tests, few copies of mutant alleles are expected. With the lower baseline of real-time digital PCR, false negative test results from tissue biopsy would be more effectively reduced, leading to more patients receiving the targeted therapy they need for better survival.

Retrospective Analysis of Minimal Residual Disease Testing By High Throughput Immunosequencing Versus High Sensitivity Flow Cytometry and qPCR in B-Lymphoblastic Leukemia

Introduction: Detection of minimal residual disease (MRD) is one of the most powerful predictors of prognosis in patients with B-Lymphoblastic Leukemia (ALL). Standard methods to detect MRD in ALL include high-resolution flow cytometry (FC) (sensitivity 10 -4 to 10 -5) and qPCR for Ph+ ALL (sensitivity 10 -5 to -6). More recently, high-throughput sequencing (NGS) has been leveraged to detect MRD (sensitivity 10 -6). Retrospective, non-clinical trial based real-world data comparing between these methodologies in the literature is limited to absent. We report our experience at a high-volume cancer center comparing NGS, qPCR, and FC.Methods: All cases of ALL with NGS MRD data at the Moffitt Cancer Center were identified. Corresponding FC, qPCR (p190 and p210) and clinical data were collected electronically and via chart review.10-color flow cytometry was performed on a Gallios System and analyzed on Kaluza (Beckman Coulter, IN). 750,000 events were collected on all cells. Validated lower limit of detection was at least 0.01%. Antibodies included CD15, CD130, CD10, CD58, CD22, CD33, CD13, CD123, CD19, CD20, CD45, CD38, CD34, CD81, CD200 (BD, Biolegend, Beckman Coulter).Quantidex™ BCR-ABL IS Kit (RT qPCR) was used to quantify BCR-ABL (p190 and p210) and ABL transcripts in total RNA in patients with ALL on Applied Biosystems 7500 Fast Dx Real-Time PCR instrument. The results were expressed by normalized BCR-ABL to ABL (control) ratio.clonoSEQ ® (Adaptive Biotechnologies, Seattle, WA) testing was performed which uses multiplex polymerase chain reaction (PCR) and NGS to identify, characterize, and monitor clonotypes of immunoglobulin (Ig) IgH (V-J), IgH (D-J), IgK, and IgL receptor gene sequences, and translocated BCL1/IgH (J) and BCL2/IgH (J) sequences.Statistical analysis was performed by Spearman correlation coefficient and Kaplan-Meier analysis.Results: 95 samples from 54 unique patients were identified that had both NGS and FC data. A subset of patients had qPCR data (n=31 samples). FC+ values ranged from 0.00004 to 0.75. NGS+ values ranged from 8.25E-08 to 0.49. Spearman correlation coefficient showed moderate concordance between NGS and FC at r=0.62 (p<0.001). Spearman correlation coefficient for qPCR vs Flow was r= 0.08 (p=0.68). Three samples were positive by FC (mean tumor burden (MTB= 0.002) but missed by NGS; whereas 31 samples were detected by NGS (MTB= 0.0016) that were missed by flow cytometry. By FC, 9 samples were equivocal of which 7 were definitively designated as MRD+ by NGS. There were 7 qPCR+/NGS- samples (MTB= 2.5 x 10 -5) and 6 qPCR-/NGS+ cases (MTB= 0.012). Overall survival was worse for MRD+ (by NGS, qPCR, or FC) vs MRD(-) (Figure 1).Conclusion:Our study confirms the importance of MRD detection in ALL and shows the robust utility of NGS for MRD detection in routine hematopathology practice. While qPCR, FC and NGS are complementary given that each can potentially detect MRD missed by another method, the data supports the increased sensitivity of NGS over FC. [Display omitted] DisclosuresShah: Servier Genetics: Other; Jazz Pharmaceuticals: Research Funding; Incyte: Research Funding; BeiGene: Consultancy, Honoraria; Acrotech/Spectrum: Honoraria; Pharmacyclics/Janssen: Honoraria, Other: Expenses; Kite, a Gilead Company: Consultancy, Honoraria, Other: Expenses, Research Funding; Precision Biosciences: Consultancy; Amgen: Consultancy; Pfizer: Consultancy, Other: Expenses; Novartis: Consultancy, Other: Expenses; Bristol-Myers Squibb/Celgene: Consultancy, Other: Expenses; Adaptive Biotechnologies: Consultancy. Hussaini: Stemeline Therapeutics: Honoraria.

Low level SARS-CoV-2 RNA detected in plasma samples from a cohort of Nigerians: Implications for blood transfusion.

The present global pandemic triggered by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has lingered for over a year in its devastating effects. Diagnosis of coronavirus disease 2019 (COVID-19) is currently established with a polymerase chain reaction (PCR) test by means of oropharyngeal-, nasopharyngeal-, anal-swabs, sputum and blood plasma. However, oral and nasal swabs are more commonly used. This study, therefore, assessed sensitivity and specificity of plasma as a diagnostic in comparison with a combination of oral and nasal swab samples, and the implications for blood transfusion. Oropharyngeal (OP) and nasopharyngeal (NP) swab samples were obtained from 125 individuals suspected to have COVID-19 and stored in viral transport medium (VTM) tubes. Ten millilitres of blood samples in EDTA were also obtained by venepuncture and spun to obtain plasma. Viral RNA was obtained from both swabs and plasma by manual extraction with Qiagen QIAamp viral RNA Mini Kit. Detection was done using a real time fluorescent RT-qPCR BGI kit, on a QuantStudio 3 real-time PCR instrument. Average age of study participants was 41 years, with 74 (59.2%) being male. Out of the 125 individuals tested for COVID-19, 75 (60%) were positive by OP/NP swab. However, only 6 (4.8%) had a positive plasma result for COVID-19 with median Ct value of 32.4. Sensitivity and specificity of RT-PCR SARS-CoV-2 test using plasma was 8% and 100% respectively. There was no false positive recorded, but 69 (55.2%) false negatives were obtained by plasma. SARS-CoV-2 viral RNA was detected, albeit low (4.8%) in plasma. Plasma is likely not a suitable biological sample to diagnose acute SARS-CoV-2 infection. The implication of transfusing blood in this era of COVID-19 needs further investigations.

All‐in‐One DNA Extraction Tube for Facilitated Real‐Time Detection of Infectious Pathogens

An "all-in-one tube" platform is developed, where the genetic analysis involving DNA extraction, amplification, and detection can be performed in a single tube. The all-in-one tube consists of a polymerase chain reaction (PCR) tube in which the inner surface is conformally modified with a tertiary-amine-containing polymer to generate a strong electrostatic interaction with DNA. The all-in-one tube provides high DNA capture efficiency exceeding 80% from Escherichia coli O157: H7 pathogen at a wide range of DNA amount from 0.003 to 3ng. Indeed, the use of the surface-functionalized PCR tube enables direct amplification and detection of the surface-captured DNA without the modification of standard real-time PCR instrument. Besides, this platform has sensitivity, selectivity, and reliability enough for accurate detection at the minimal infective dose of both gram-positive and negative pathogens. The all-in-one tube enables the direct molecular diagnosis, substantially reducing the labor-intensive pathogen detection steps while providing high compatibility with the currently established real-time PCR instruments, and illustrates its on-site applicability with convenience expandable to various genetic analyses including food safety testing, forensic analysis, and clinical diagnosis.

Application of comparative genomics in the development of DNA probes to detect Bacillus cereus and Bacillus subtilis

Primer-probe sets to detect Bacillus cereus and/or B. subtilis in food products were developed based on panX (a pan-genome analysis tool). Data for 60 B. cereus strains and 131 B. subtilis strains retrieved from the NCBI RefSeq database were analyzed by panX. Primer-probe sets for B. cereus (ccpA) and B. subtilis (cotQ) were developed by comparing the core genomes of the two bacteria. The developed primer-probe sets’ sensitivity and selectivity were identified using 45 strains, including ten B. cereus, five B. subtilis, 13 non-B. cereus and non-B. subtilis strains, and 17 non-Bacillus strains using real-time polymerase chain reaction (PCR). The developed primer-probe sets displayed high sensitivity and selectivity for B. cereus and B. subtilis, validated with two different real-time PCR instruments. PCR analysis using the developed primer-probe showed high efficiency in buffer and milk samples. These results indicate that the primer-probe sets developed based on the panX analysis can be used effectively for detecting B. cereus and/or B. subtilis in food products.

Determining the feasibility of constructing a real-time polymerase chain reaction instrument locally: The cost of intellectual property rights and research and development

BACKGROUND: Real-time polymerase chain reaction (PCR) machines have advanced the field of microbiology by introducing a robust method for high-throughput detection of nucleic acid targets. Unfortunately, these instruments are quite expensive to purchase and maintain, despite containing hardware parts that are relatively inexpensive. AIMS AND OBJECTIVES: We believe that it may be possible to mitigate costs in low- and middleincome countries (LMICs) by building such a PCR instrument from assembled parts. However, the major hindrance is the cost of intellectual property rights (IPRs), associated with research and development (R and D). The aim of this project was to understand the hardware costs, IPR royalties, profit margins, and the cost of R and D associated with PCR instrument manufacturing. MATERIALS AND METHODS: We conducted a review of two PCR machines to examine the differences in their technical and hardware specifications and quantify the cost of assembled parts alone. We also ran a parallel assay using the two machines to understand how the differences in technologies affected assay results. RESULTS AND CONCLUSION: Based on our analysis, we found that assembling a PCR machine using assembled parts can make these instruments more affordable in LMICs. There is a need to have collaboration and agreement between machine licensing, patent, and copyright holders to facilitate this process in LMICs.

Multiplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assays for Diagnostic Testing of Severe Acute Respiratory Syndrome Coronavirus 2 and Seasonal Influenza Viruses: A Challenge of the Phase 3 Pandemic Setting.

BackgroundPandemic coronavirus disease 2019 (COVID-19) disease represents a challenge for healthcare structures. The molecular confirmation of samples from infected individuals is crucial and therefore guides public health decision making. Clusters and possibly increased diffuse transmission could occur in the context of the next influenza season. For this reason, a diagnostic test able to discriminate severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) from influenza viruses is urgently needed.MethodsA multiplex real-time reverse-transcription polymerase chain reaction (PCR) assay was assessed using 1 laboratory protocol with different real-time PCR instruments. Overall, 1000 clinical samples (600 from samples SARS-CoV-2–infected patients, 200 samples from influenza-infected patients, and 200 negative samples) were analyzed.ResultsThe assay developed was able to detect and discriminate each virus target and to intercept coinfections. The limit of quantification of each assay ranged between 5 and 10 genomic copy numbers, with a cutoff value of 37.7 and 37.8 for influenza and SARS-CoV-2 viruses, respectively. Only 2 influenza coinfections were detected in COVID-19 samples.ConclusionsThis study suggests that multiplex assay is a rapid, valid, and accurate method for the detection of SARS-CoV-2 and influenza viruses in clinical samples. The test may be an important diagnostic tool for both diagnostic and surveillance purposes during the seasonal influenza activity period.

Determination of NRF2 and GSTM1 Expression and Biomarkers of Oxidative Stress on Smoking and Nonsmoking Sperm: A Pilot study

Background and Aims: Smoking has an influence on different semen parameters. It is regarded as a risk factor for infertility. This study aims to evaluate the effect of smoking cigarettes on the expression of nuclear factor erythroid 2-related factor 2 (NRF2) and glutathione S-transferase Mu 1 (GSTM1) genes and biomarkers of oxidative stress in sperm. Materials and Methods: A case-control study was conducted on 15 men smoker (case) and 15 men nonsmokers (control) who had referred to infertility clinics in Isfahan, Iran. After sampling and analysis of semen quality parameters, gene expression of NRF2 and GSTM1 was determined using a Real time-polymerase chain reaction instrument. The lipid peroxidation and total antioxidant capacity (TAC) were evaluated by colorimetric methods. Results: Sperm concentration and their progressive motility in smokers were significantly lower than the nonsmoker population (p&lt;0.001). In addition, the lipid peroxidation level increased and TAC level (p&lt;0.01) as well as gene expression of NRF2 (p&lt;0.05) and GSTM1 (p&lt;0.01) decreased compared to control groups. Conclusions: Our data demonstrated that the NRF2 and GSMT1 expressions are significantly lower in human males with low sperm motility and correlated with specific sperm quality parameters.

Microfluidic Array Chip for Parallel Detection of Waterborne Bacteria.

The polymerase chain reaction (PCR) is a robust technique used to make multiple copies of a segment of DNA. However, the available PCR platforms require elaborate and time-consuming operations or costly instruments, hindering their application. Herein, we introduce a sandwiched glass–polydimethylsiloxane (PDMS)–glass microchip containing an array of reactors for the real-time PCR-based detection of multiple waterborne bacteria. The PCR solution was loaded into the array of reactors in a single step utilising capillary filling, eliminating the need for pumps, valves, and liquid handling instruments. Issues of generating and trapping bubbles during the loading chip step were addressed by creating smooth internal reactor surfaces. Triton X-100 was used to enhance PCR compatibility in the chip by minimising the nonspecific adsorption of enzymes. A custom-made real-time PCR instrument was also fabricated to provide thermal cycling to the array chip. The microfluidic device was successfully demonstrated for microbial faecal source tracking (MST) in water.

Polymerization retardation isothermal amplification (PRIA): a strategy enables sensitively quantify genome-wide 5-methylcytosine oxides rapidly on handy instruments with nanoscale sample input.

The current methods for quantifying genome-wide 5-methylcytosine (5mC) oxides are still scarce, mostly restricted with two limitations: assay sensitivity is seriously compromised with cost, assay time and sample input; epigenetic information is irreproducible during polymerase chain reaction (PCR) amplification without bisulfite pretreatment. Here, we propose a novel Polymerization Retardation Isothermal Amplification (PRIA) strategy to directly amplify the minute differences between epigenetic bases and others by arranging DNA polymerase to repetitively pass large electron-withdrawing groups tagged 5mC-oxides. We demonstrate that low abundant 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxycytosine (5caC) in genomic DNA can be accurately quantified within 10 h with 100 ng sample input on a laboratory real-time quantitative PCR instrument, and even multiple samples can be analyzed simultaneously in microplates. The global levels of 5hmC and 5fC in mouse and human brain tissues, rat hippocampal neuronal tissue, mouse kidney tissue and mouse embryonic stem cells were quantified and the observations not only confirm the widespread presence of 5hmC and 5fC but also indicate their significant variation in different tissues and cells. The strategy is easily performed in almost all research and medical laboratories, and would provide the potential capability to other candidate modifications in nucleotides.

Copy number alternations of the 17q23-rs6504950 locus are associated with advanced breast cancers in Taiwanese women.

Objective:Breast cancer is one of the most common malignancies and a leading cause of cancer-related death in women worldwide. Both hormone-related factors and genetic aberrations could cause breast cancer. We investigated copy number alternations (CNAs) on four breast cancer-susceptible loci, namely 2q35-rs13387042, 3p24-rs4973768, 17q23-rs6504950, and fibroblast growth factor receptor 2 (FGFR2)-rs2981578, in Taiwanese women.Patients and Methods:Breast cancer tissues and blood samples from 66 patients and their clinical data were collected from a human biobank. The copy numbers of the germline samples (from blood) and cancer tissues from each patient on the susceptible loci – 2q35, 3p24, 17q23, and FGFR2 – were obtained using TaqMan probes in the Applied Biosystems Inc., (ABI) StepOnePlus Real-Time Polymerase Chain Reaction instrument and CopyCaller® Software v1.0 (ABI, CA, USA).Results:The mean copy numbers output by CopyCaller® Software v1.0 of the cancer tissues on these susceptible loci (2q35, 3p24, 17q23, and FGFR2) from the 66 patients were higher than those of the blood samples (2.0 vs. 1.9); however, significantly higher copy numbers for cancer tissues compared with germline samples were discovered only on 2q35-rs13387042 (P = 0.035). In addition, patients with advanced breast cancers had relatively many CNAs between their cancer tissues and germline samples on 17q23-rs6504950 (P = 0.008). Multivariate analysis revealed that the risk factor for patients with advanced breast cancers was CNAs between cancer tissues and germline samples on 17q23-rs6504950 (odds ratio = 13.337, 95% confidence interval: 1.525–122.468).Conclusions:CNAs on 17q23-rs6504950 between cancer tissues and germline samples could affect cancer progression in Taiwanese women with breast cancer. Further investigations regarding the role of CNAs on 17q23-rs6504950 in cancer progression are necessary to elucidate the pathogenesis of breast cancer.

Implementation and evaluation of the Presto combined qualitative real-time assay for Chlamydia trachomatis and Neisseria gonorrhoeae in Rwanda.

BackgroundThe Presto combined qualitative real-time assay for Chlamydia trachomatis and Neisseria gonorrhoeae (Presto CT/NG PCR assay) is appealing for developing countries, because it can be used with multiple DNA extraction methods and polymerase chain reaction (PCR) platforms.ObjectivesThe objective of the study was to implement and evaluate the Presto CT/NG PCR assay at the National Reference Laboratory (NRL) in Kigali, Rwanda, where no real-time PCR assays for the detection of C. trachomatis or N. gonorrhoeae were available.MethodsThe Presto CT/NG PCR assay was first evaluated at the Institute of Tropical Medicine (ITM) in Antwerp, Belgium. Next, NRL laboratory technicians were trained to use the assay on their ABI PRISM 7500 real-time PCR instrument and their competencies were assessed prior to trial initiation. During the trial, endocervical swabs were tested at the NRL, with bi-monthly external quality control testing monitored by the ITM. The final NRL results were evaluated against extended gold standard testing at the ITM, consisting of the Abbott m2000 RealTime System with confirmation of positive results by an in-house real-time PCR assay for C. trachomatis or N. gonorrhoeae.ResultsOf the 192 samples analysed using the Presto assay at the NRL, 16 samples tested positive for C. trachomatis and 17 tested positive for N. gonorrhoeae; four of these were infected with both. The sensitivity and specificity of the Presto assay were 93.3% (95% confidence interval [CI]: 68.1% – 99.8%) and 99.4% (95% CI: 96.8% – 100%) for C. trachomatis and 100% (95% CI: 76.8% – 100%) and 98.8% (95% CI: 95.8% – 99.9%) for N. gonorrhoeae.ConclusionC. trachomatis and N. gonorrhoeae testing with the Presto assay was feasible in Kigali, Rwanda, and good performance was achieved.KeywordsqPCR; Chlamydia trachomatis; Neisseria gonorrhoeae.

Determination of dopamine receptor D2 gene rs1800497 polymorphism using real-time polymerase chain reaction

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.

Systematic evaluation of the early access applied biosystems precision ID Globalfiler mixture ID and Globalfiler NGS STR panels for the ion S5 system

Systematic evaluation of the early access applied biosystems precision ID Globalfiler mixture ID and Globalfiler NGS STR panels for the ion S5 system

Pharmacogenetic testing revisited: 5' nuclease real-time polymerase chain reaction test panels for genotyping CYP2D6 and CYP2C19.

Due to their involvement in the metabolization of commonly prescribed psychopharmaceutical drugs, the cytochrome oxidase genes CYP2D6 and CYP2C19 are extensive targets for pharmacogenetic testing. The existence of common allelic variants allows the prediction of a metabolic phenotype based on a genotype result, hereby supplying a clinical tool for optimizing prescription and minimizing adverse effects. In this study, we present the development of two 5′ nuclease real-time polymerase chain reaction (PCR) test panels, capable of detecting eight of the most clinically relevant alleles of the CYP2D6 gene (*2, *3, *4, *6, *9, *10, 17, *41) and the three most common nonfunctional alleles of CYP2C19 (*2, *3, *4). The assays have been thoroughly validated using a large collection of reference samples, by parallel testing and by DNA sequencing. The reanalysis of reference samples provided the calculation of the frequency of the CYP2D6*4K allele in a population, not previously reported. Furthermore, original test results from CYP2D6*41, generated based on the presence of the 2850T and the lack of the −1584G single-nucleotide polymorphism (SNP), were compared with genotyping based on the current acknowledged founder SNP 2988G of this allele. These results indicate that up to 17.7% of the patients originally tested as carriers of the CYP2D6*41 allele may have had an incorrect phenotypic result assigned. The two 5′ nuclease real-time PCR test panels have subsequently been optimized for use in the clinical laboratory, using a standard real-time PCR instrument and software.

Comparison of a new commercial real-time PCR assay (RealCycler PJIR kit, Progenie Molecular) to an in-house real-time PCR assay for the diagnosis of Pneumocystis jirovecii infections

The atypical fungus Pneumocystis jirovecii ( P. jirovecii ) is the causative agent of a life threatening pneumonia [ Pneumocystis pneumonia (PCP)] in immunosuppressed patients. PCP diagnosis is essentially based on the detection of the fungus in pulmonary specimens using microscopic examination and polymerase chain reaction (PCR). For the past 20 years, the use of PCR assays has improved the sensitivity of P. jirovecii detection. The main objective of the present study was to compare the efficiency of the RealCycler PJIR kit (Progenie Molecular; pmPCR), to an in-house PCR assay (ihPCR), both assays targeting the mitochondrial large subunit ribosomal rRNA gene. Thirty-four patients were retrospectively enrolled in the study. Fourteen patients were initially diagnosed with PCP, 15 were considered to be pulmonary colonized by the fungus, and five were negative for P. jirovecii detection (negative control group). Archival DNA specimens (extracted from the patient's pulmonary specimens) were examined with ihPCR and pmPCR on the same day using the same real-time PCR instrument (Applied Biosystems 7500 Real-Time PCR system). The ihPCR assay was performed as described elsewhere by Meliani et al. and Totet et al. [1,2] . The pmPCR assay was performed according to the manufacturer's recommendations. Concordant results were obtained with the two PCR assays for all DNA specimens but one (33/34). Thus, the concordance rate between the two methods was evaluated at 97% (Cohen's kappa, 0.905). The discrepant result concerned one specimen from a colonized patient previously known to have a cycle threshold (Ct) value ≥ 35 using ihPCR. This specimen was confirmed to be positive with ihPCR and was negative with pmPCR. Taking into account Ct values for positive samples, the correlation factor between the two PCR methods has been evaluated at 0.97 ( R 2 = 0.9481). Taking into account the Cohen's kappa > 0.8, the RealCycler PJIR kit (Progenie Molecular) appears to be an efficient technique to detect P. jirovecii in patients with PCP and in patients colonized by P. jirovecii .

The iron chelator deferasirox affects redox signalling in haematopoietic stem/progenitor cells.

The iron chelator deferasirox (DFX) prevents complications related to transfusional iron overload in several haematological disorders characterized by marrow failure. It is also able to induce haematological responses in a percentage of treated patients, particularly in those affected by myelodysplastic syndromes. The underlying mechanisms responsible for this feature, however, are still poorly understood. In this study, we investigated the effect of DFX-treatment in human haematopoietic/progenitor stem cells, focussing on its impact on the redox balance, which proved to control the interplay between stemness maintenance, self-renewal and differentiation priming. Here we show, for the first time, that DFX treatment induces a significant diphenyleneiodonium-sensitive reactive oxygen species (ROS) production that leads to the activation of POU5F1 (OCT4), SOX2 and SOX17 gene expression, relevant in reprogramming processes, and the reduction of the haematopoietic regulatory proteins CTNNB1 (β-Catenin) and BMI1. These DFX-mediated events were accompanied by decreased CD34 expression, increased mitochondrial mass and up-regulation of the erythropoietic marker CD71 (TFRC) and were compound-specific, dissimilar to deferoxamine. Our findings would suggest a novel mechanism by which DFX, probably independently on its iron-chelating property but through ROS signalling activation, may influence key factors involved in self-renewal/differentiation of haematopoietic stem cells.

Overrepresentation of the COL3A1 AA genotype in Polish skiers with anterior cruciate ligament injury.

Although various intrinsic and extrinsic risk factors for anterior cruciate ligament (ACL) rupture have been identified, the exact aetiology of the injury is not yet fully understood. Type III collagen is an important factor in the repair of connective tissue, and certain gene polymorphisms may impair the tensile strength. The aim of this study was to examine the association of the COL3A1 rs1800255 polymorphism with ACL rupture in Polish male recreational skiers. A total of 321 male Polish recreational skiers were recruited for this study; 138 had surgically diagnosed primary ACL ruptures (ACL-injured group) and 183 were apparently healthy male skiers (control group – CON) who had no self-reported history of ligament or tendon injury. Both groups had a comparable level of exposure to ACL injury. Genomic DNA was extracted from the oral epithelial cells. All samples were genotyped on a real-time polymerase chain reaction instrument. The genotype distribution in the ACL-injured group was significantly different than in CON (respectively: AA=10.1 vs 2.2%, AG=22.5 vs 36.1, GG=67.4 vs 61.8%; p=0.0087). The AA vs AG+GG genotype of COL3A1 (odds ratio (OR)=5.05; 95% confidence interval (CI), 1.62-15.71, p=0.003) was significantly overrepresented in the ACL-injured group compared with CON. The frequency of the A allele was higher in the ACL-injured group (21.4%) compared with CON (20.2%), but the difference was not statistically significant (p=0.72). This study revealed an association between the COL3A1 rs1800255 polymorphism and ACL ruptures in Polish skiers.

Analysis of Multiple Cytokine Polymorphisms in Individuals with Untreated Deep Carious Lesions Reveals IL1B (rs1143643) as a Susceptibility Factor for Periapical Lesion Development

IntroductionIt has been proposed that individual genetic predisposition may contribute to persistent apical periodontitis. Cytokines are associated with levels of inflammation and are involved in caries, pulpal, and periapical tissue destruction. We hypothesized that polymorphisms in cytokine genes may contribute to an individual's increased susceptibility to apical tissue destruction in response to deep carious lesions. MethodsSubjects with deep carious lesions with or without periapical lesions (≥3 mm) were recruited at the University of Pittsburgh, Pittsburgh, PA, and the University of Texas at Houston, Houston, TX. Genomic DNA samples of 316 patients were sorted into 2 groups: 136 cases with deep carious lesions and periapical lesions (cases) and 180 cases with deep carious lesions but no periapical lesions (controls). Nine single-nucleotide polymorphisms in IL1B, IL6, TNF, RANK, RANKL, and OPG genes were selected for genotyping. Genotypes were generated by end point analysis using TaqMan chemistry (Invitrogen, Carlsbad, CA) in a real-time polymerase chain reaction instrument. Allele and genotype frequencies were compared among cases and controls using the PLINK program (http://pngu.mgh.harvard.edu/purcell/plink/). Ninety-three human periapical granulomas and 24 healthy periodontal ligament tissues collected postoperatively were used for messenger RNA expression analyses of IL1B. ResultsA single-nucleotide polymorphism in IL1B (rs1143643) showed allelic (P = .02) and genotypic (P = .004) association with cases of deep caries and periapical lesions. We also observed altered transmission of IL1B marker haplotypes (P = .02) in these individuals. IL1B was highly expressed in granulomas (P < .001). ConclusionsVariations in IL1B may be associated with periapical lesion formation in individuals with untreated deep carious lesions. Future studies could help predict host susceptibility to developing periapical lesions.

Detection of the FCGR3a polymorphism using a real-time polymerase chain reaction assay

The fragment crystallizable (Fc) region of the immunoglobulin G, low affinity III A receptor (FCGR3a, also known as CD16) belongs to the Fc gamma receptor family (FCGR), which plays an important role in immunoinflammatory processes. It is a low affinity, transmembrane receptor that is mainly expressed in monocytes, natural killer cells, and macrophages. It has been implicated in various inflammatory conditions, and recently a polymorphism (rs396991) in this gene has been shown to influence response to rituximab (anti-CD20) therapy in various disorders. We evaluated two molecular methods to genotype this polymorphism. Archived, formalin-fixed, paraffin-embedded samples from 26 biopsies of diffuse large B-cell lymphoma were retrieved and DNA was extracted. The samples were tested for the FCGR3a polymorphism using real-time polymerase chain reaction (PCR) followed by melt curve analysis or by a standard TaqMan allelic discrimination assay using the ABI 7500 FAST real-time PCR instrument. With the TaqMan allelic discrimination assay, we found that 16 cases were the wild type genotype, homozygous phenylalanine (F/F), for the FCGR3a receptor, whereas two cases had the homozygous valine (V/V) polymorphism and eight cases were heterozygous with a V/F genotype. Results with the real-time PCR followed by melt curve analysis were similar for 25 cases; however, four samples did not have sufficient DNA for the melt curve analysis method, and the result from one sample was discordant. The new TaqMan assay offers several advantages over previously published assays, such as faster turnaround time and ease of interpretation. These performance characteristics make it highly suitable for use in a clinical laboratory.