Strains Of Rb Research Articles

Novel strains of a pandemic plant virus, tomato spotted wilt orthotospovirus, increase vector fitness and modulate virus transmission in a resistant host.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single-gene resistant cultivars of tomato ("Sw-5b" gene) and pepper ("Tsw" gene) deployed worldwide. However, the emergence of resistance-breaking strains (RB) in recent years has compounded the threat of TSWV to agricultural production worldwide. Despite this, an extensive study on the thrips transmission biology of RB strains is currently lacking. It is also unclear whether mutualistic TSWV-thrips interactions vary across different novel strains with disparate geographical origins. To address both critical questions, we studied whether and how four novel RB strains of TSWV (two sympatric and two allopatric), along with a non-RB strain, impact western flower thrips (WFT) fitness and whether this leads to differences in TSWV incidence, symptom severity (virulence), and virus accumulation in two differentially resistant tomato cultivars. Our findings show that all RB strains increased WFT fitness by prolonging the adult period and increasing fecundity compared to non-RB and non-viruliferous controls, regardless of the geographical origin of strains or the TSWV titers in individual thrips, which were substantially low in allopatric strains. TSWV accumulation in thrips varied at different developmental stages and was unrelated to the infected tissues from which thrips acquired the virus. However, it was significantly positively correlated to that in WFT-inoculated susceptible plants, but not the resistant ones. The TSW incidences were high in tomato plants infected with all RB strains, ranging from 80% to 90% and 100% in resistant and susceptible plants, respectively. However, TSW incidence in the non-RB-infected susceptible tomato plants was 80%. Our findings provide new insights into how novel strains of TSWV, by selectively offering substantial fitness benefits to vectors, modulate transmission and gain a potential epidemiological advantage over non-RB strains. This study presents the first direct evidence of how vector-imposed selection pressure, besides the one imposed by resistant cultivars, may contribute to the worldwide emergence of RB strains.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Reduced fecundity and regulation of reproductive factors in flubendiamide-resistant strains of Plutella xylostella

Diamondback moth (DBM), Plutella xylostella, is an important pest of crucifers worldwide. The extensive use of flubendiamide has led to the development of resistance in field populations and reports of control failures. In this study, the lab-selected (Rf) and field-collected (Rb) flubendiamide-resistant strains of P. xylostella with LC50 resistance ratios of 1890-fold and 1251-fold, respectively, were used, as well as a lab-reared flubendiamide-susceptible strain (S). The results showed that the fecundity of the Rf and Rb-resistant strains was significantly lower than that of S strain. The contents of vitellin and transcripts of P. xylostella vitellogenin (PxVg) and P. xylostella vitellogenin receptor (PxVgR) genes in the Rf and Rb strains were significantly higher than those of S strains at 0–48 h after adult eclosion. At 96 h after eclosion, the content of vitellin in the Rf and Rb strains did not differ significantly from those of S strains, whereas transcripts of the PxVg and PxVgR genes in the Rf and Rb strains were significantly lower than that of the S strain. The content of the juvenile hormone III (JH III), β-ecdysone (20E), and the gene expression level of P. xylostella methoprene tolerant (PxMet) in the Rf and Rb strains were significantly higher than that of the S strain. The activity of trehalase was significantly higher in the Rf and Rb strains than that of the S strain in the first to the third instar larvae, whereas in the fourth instar larvae, there was no significantly difference in the three strains. At different times after adult eclosion, the differences in trehalase activity were erratic between the strains. The transcripts of P. xylostella trehalase (PxTre) gene in the Rf and Rb strains were significantly higher than that of the S strain in most developmental stages. Here, we report differences in fecundity between flubendiamide-resistant and susceptible strains of P. xylostella and discuss gene expression of several reproductive factors, which provides a possible explanation for the mechanism of fecundity reduction concurrent with flubendiamide-resistance in P. xylostella.

Characterization of native Escherichia coli populations from bovine vagina of healthy heifers and cows with postpartum uterine disease.

Even though Escherichia coli are common bacteria of the bovine vaginal microbiota, they represent an important pathogen that causes diseases in the reproductive tract and subfertility. However, the actual endometrial virulence profile of E. coli is poorly understood. The present study aims to characterize the phylogenetic structure and virulence potential of native vaginal populations of E. coli from healthy heifers (H), and cows with postpartum uterine diseases (PUD), such as metritis/endometritis (MT) or repeat breeder cows (RB). To this end, the virulence repertoire of 97 E. coli isolates was genotypically and phenotypically assessed. Most of them were assigned to phylogenetic group A (74%), followed by B1 (17%) and D (9%); RB strains were significantly (p < 0.05) more represented by B1. Seven of the 15 evaluated virulence genes (VFG) were detected and the most prevalent were fimH (87%), agn43 (41%) and csgA (35%); while traT (27%), fyuA (11%), hlyA (5%) and kpsMT II (5%) were observed in a lower proportion. Particularly, fyuA was significantly higher (p < 0.05) in MT cows whereas csgA showed the same behavior in PUD animals (p < 0.05). When comparing H and PUD strains, these last ones were associated to positive expression of biofilm, fimbriae curli/cellulose and motility; yet RB strains did not show motility. Vaginal B1 E. coli populations, that possess VFG (fyuA and csgA) as well as the expression of motility, curli fimbriae/cellulose and biofilm, may represent risk factors for endometrial disorders; specifically, those that also, have kpsMT II may have a pathogenic potential for causing the RB syndrome. Future research focusing on the detection of these strains in the vaginal microbiota of cows with postpartum uterine diseases should be done since the control of their presence in vagina could reduce the risk that they access the uterus during the postpartum period.

Molecular and biological characterization of a novel mild strain of citrus tristeza virus in California.

Strain differentiating marker profiles of citrus tristeza virus (CTV) isolates from California have shown the presence of multiple genotypes. To better define the genetic diversity involved, full-length genome sequences from four California CTV isolates were determined by small-interfering RNA sequencing. Phylogenetic analysis and nucleotide sequence comparisons differentiated these isolates into the genotypes VT (CA-VT-AT39), T30 (CA-T30-AT4), and a new strain called S1 (CA-S1-L and CA-S1-L65). S1 isolates had three common recombination events within portions of genes from VT, T36 and RB strains and were transmissible by Aphis gossypii. Virus indexing showed that CA-VT-AT39 could be classified as a severe strain, whereas CA-T30-AT4, CA-S1-L and CA-S1-L65 were mild. CA-VT-AT39, CA-S1-L, and CA-S1-L65 reacted with monoclonal antibody MCA13, whereas CA-T30-AT4 did not. RT-PCR and RT-qPCR detection assays for the S1 strain were developed and used to screen MCA13-reactive isolates in a CTV collection from central California collected from 1968 to 2011. Forty-two isolates were found to contain the S1 strain, alone or in combinations with other genotypes. BLAST and phylogenetic analysis of the S1 p25 gene region with other extant CTV sequences from the NCBI database suggested that putative S1-like isolates might occur elsewhere (e.g., China, South Korea, Turkey, Bosnia and Croatia). This information is important for CTV evolution, detection of specific strains, and cross-protection.

Pathogenicity of Genome Reassortant Infectious Bursal Disease Viruses in Chickens and Turkeys.

Infectious bursal disease virus (IBDV) contains two genome segments (segment A/segment B) that can reassort among the viruses. Reassortant IBDVs have been identified in several countries including the United States. These reassortant viruses usually include at least one genome segment from a very virulent (vv)IBDV strain. In vivo virulence of six reassortant IBDV from the United States was assessed relative to the virulence of three frequently described IBDV pathotypes: vvIBDV (rB strain), classic virulent (cv)IBDV (STC strain), and subclinical (sc)IBDV (Del-E strain). Morbidity and mortality in 4-wk-old specific-pathogen-free (SPF) leghorns indicated that reassortant IBDV with a vv genome segment A and non-vv segment B were less pathogenic than the vv/vv rB strain but more pathogenic than the cv/cv STC strain. The sc/vv IBDV strain D6337 (sc/vv) was comparable to the STC strain in pathogenicity. Viruses with a serotype 2 (ser2) genome segment A, regardless of the type of genome segment B, did not cause clinical disease in SPF chickens or turkeys. None of the reassorted viruses caused morbidity, mortality, or gross lesions in SPF turkeys. Histopathologic lesions in the bursa of turkeys were not observed in any group except those challenged with the serotype 2 OH strain, which had a mild lymphocytic depletion. No mortality was observed in maternally immune broilers inoculated with any of the IBDV pathotypes at 1, 2, 3, and 4 wk of age. No bursal lesions were observed in any of the broiler chicken groups at 1 wk of age except for the D2712 (ser2/cv)-inoculated birds that had mild lymphocyte depletion. Based on evaluation of bursal lesion scores and IBDV reverse transcriptase-PCR on broilers challenged at 2 wk of age, the K669 (vv/ser2) virus broke through the maternal immunity while the STC, Del-E, rB, D2712 (ser2/cv), and 7741 (vv/cv) viruses did not. All viruses broke through maternal immunity in the broilers at 3 wk of age except the Del-E scIBDV and D2712 (ser2/cv) reassortant IBDVs. At 4 wk of age, maternal antibodies were very low and bursal lesions were observed in all broilers challenged with the viruses. The data indicate that genome reassortant IBDVs are less pathogenic than is the rB (vv/vv) IBDV. However, the reassortant viruses with a vv genome segment A can still cause morbidity and mortality in SPF chickens, and they were able to break through maternal immunity produced via use of commercial classic and variant vaccines at an early age. This suggests that current breeder vaccination programs may not adequately protect against the reassortant vv/ser2 and vv/cv IBDV strains.

Expanded Strain‐Specific RT‐PCR Assay for Differential Detection of Currently Known Citrus Tristeza Virus Strains: a Useful Screening Tool

AbstractGenotypic characterization of Citrus tristeza virus (CTV) strains has progressed significantly, but their phenotypic expression is poorly established as CTV naturally occurs as mixed‐strain populations. A screening system for the analysis of mixed‐strain populations is required for population studies and the correlation with symptom expression. In this study, a published CTV strain‐specific detection assay was expanded and improved to facilitate detection of currently known CTV strains. Supplementary RT‐PCR assays were developed for two variant groups of the RB strain and the HA16‐5 strain, and assays for the T36 strain and generic CTV detection were improved. The value of the strain‐specific assays was shown by the ability to identify the strain components of two CTV cross‐protecting sources, GFMS35 and LMS6, used in the South African budwood certification scheme and to demonstrate the segregation of strains in budwood source trees.

Pathogenicity associated with coinfection with very virulent infectious bursal disease and Infectious bursal disease virus strains endemic in the United States

The pathogenicity induced by co-challenge with the rB strain of very virulent Infectious bursal disease virus (vvIBDV) and IBDV pathotypes endemic in the United States was evaluated in specific pathogen-free chickens. Four- and 6-week-old birds were simultaneously challenged with a 10(5) 50% egg infectious dose (EID50) of rB mixed with a 10(5) EID50 of one of the following viruses: standard classic (STC), subclinical variant (Del-E), subclinical variant (T1), or avirulent serotype 2 (OH). Each challenge group consisted of 5 chickens. The severity of disease was assessed by comparing the 5-day mortality rates, bursal lesions (mean bursal lesion scores), and mean bursal-to-body weight ratios in each of the challenged groups. A mortality of 100% (10/10 and 5/5) was observed in birds inoculated with only the vvIBDV (rB) strain at 4 weeks and 6 weeks of age, respectively. Although the sample sizes were low, a significant reduction in mortality and severity of disease, based on mean bursal lesion scores, was observed in groups co-challenged with rB and the less virulent pathotypes Del-E, T1, or OH at 4 weeks of age. Co-challenge with rB and the antigenically similar STC strain did not result in a significant decrease in mortality compared to challenge with the pathogenic rB strain at 4 weeks of age, but a significant reduction in the mean bursa lesion score was observed. At 6 weeks of age, a significant decrease in mortality and mean bursa lesion score was observed in the rB groups co-challenged with STC, Del-E, or T1 but not OH.

Occurrence and sequence of Sphaeroides Heme Protein and Diheme Cytochrome C in purple photosynthetic bacteria in the family Rhodobacteraceae

BackgroundSphaeroides Heme Protein (SHP) was discovered in the purple photosynthetic bacterium, Rhodobacter sphaeroides, and is the only known c-type heme protein that binds oxygen. Although initially not believed to be widespread among the photosynthetic bacteria, the gene has now been found in more than 40 species of proteobacteria and generally appears to be regulated. Rb. sphaeroides is exceptional in not having regulatory genes associated with the operon. We have thus analyzed additional purple bacteria for the SHP gene and examined the genetic context to obtain new insights into the operon, its distribution, and possible function.ResultsWe found SHP in 9 out of 10 strains of Rb. sphaeroides and in 5 out of 10 purple photosynthetic bacterial species in the family Rhodobacteraceae. We found a remarkable similarity within the family including the lack of regulatory genes. Within the proteobacteria as a whole, SHP is part of a 3-6 gene operon that includes a membrane-spanning diheme cytochrome b and one or two diheme cytochromes c. Other genes in the operon include one of three distinct sensor kinase - response regulators, depending on species, that are likely to regulate SHP.ConclusionsSHP is not as rare as generally believed and has a role to play in the photosynthetic bacteria. Furthermore, the two companion cytochromes along with SHP are likely to function as an electron transfer pathway that results in the reduction of SHP by quinol and formation of the oxygen complex, which may function as an oxygenase. The three distinct sensors suggest at least as many separate functional roles for SHP. Two of the sensors are not well characterized, but the third is homologous to the QseC quorum sensor, which is present in a number of pathogens and typically appears to regulate genes involved in virulence.

Abnormal red body coloration of the silkworm, Bombyx mori, is caused by a mutation in a novel kynureninase

Larvae of the body color mutant red blood (rb) of the silkworm, Bombyx mori, display reddish skin whose hemolymph becomes red in air, whereas hemolymphs of normal strains become black during melanization. The irregular coloring was assumed to result from an abnormal accumulation of 3-hydroxykynurenine. However, the gene responsible for the rb phenotype is not yet known. Here, we provide evidence that the rb gene corresponds to a novel bacterial-type kynureninase gene, BmKynu. Kynureninase (KYNU) hydrolyzes kynurenine and 3-hydroxykynurenine to anthranilic acid and 3-hydroxyanthranilic acid, respectively. KYNU has been identified in microorganisms and animals but not in insects. Therefore, BmKynu is the first KYNU gene observed in insects. Our results clearly showed that a point mutation (T102I) in BmKYNU of the rb strain led to a marked decrease in KYNU activity, presumably resulting in abnormal accumulation of 3-hydroxykynurenine. Additionally, linkage analysis indicated that no recombination between rb and BmKynu was detected. We conclude that T102I in BmKYNU causes the red body coloration in the rb strain. Our study proves that B. mori has a unique side branch in the kynurenine pathway, distinctly different from other insects.

Phenotypic and Genotypic Characteristics of Persistent Methicillin‐ResistantStaphylococcus aureusBacteremia In Vitro and in an Experimental Endocarditis Model

Persistent MRSA bacteremia (PB) represents an important subset of Staphylococcus aureus infections and correlates with poor clinical outcomes. We profiled relevant in vitro phenotypic and genotypic characteristics of MRSA isolates from 39 persons with bacteremia (21 had PB and 18 had resolving bacteremia [RB]). We also compared the intrinsic virulence and responsiveness to vancomycin of selected PB and RB strains in an experimental endocarditis model (IE). PB and RB isolates differed significantly with regard to several in vitro characteristics that are believed to impact endovascular infections. PB isolates exhibited significantly more resistance to the cationic defensin hNP-1, enhanced membrane fluidity, and substantially greater adhesion to fibronectin, fibrinogen, and endothelial cells. Genotypically, PB isolates had higher frequency of SCCmec II, CC30, and spa 16; and higher rates of agr type III, cap8, tst-1, and cna carriage. Finally, a prototypic PB strain was more resistant to vancomycin treatment in the infective endocarditis model than a RB comparator strain, despite equivalent virulence profiles. Our findings indicate that PB isolates may have specific virulence signatures that distinguish them from RB isolates. These data suggest that methods might be developed to identify patients at higher risk for PB in real-time, thereby optimizing the effectiveness of anti-MRSA therapeutic strategies.

Biological Control of Fusarium Wilt in Tomato Caused by Fusarium oxysporum f. sp. lycopersici by AMF Glomus intraradices and some Rhizobacteria

AbstractIn the present study, the effects of the arbuscular mycorrhizal fungus (AMF) Glomus intraradices Schenck &amp; Smith and four rhizobacteria (RB; 58/1 and D/2: Pseudomonas fluorescens biovar II; 17: P. putida; 21: Enterobacter cloacae), which are the important members of the rhizosphere microflora and biological control agents against plant diseases, were examined in the pathosystem of Fusarium oxysporum f. sp. lycopersici [(Sacc) Syd. et Hans] (FOL) and tomato with respect to morphological parameters (fresh and dry root weight) and phosphorous (P) concentration in the roots. Treatments with single and dual inoculation with G. intraradices and RB strains reduced disease severity by 8.6–58.6%. Individual bacteria inoculations were more effective than both the single AMF and dual (G. intraradices + RB) inoculations. In addition, the RB and G. intraradices enhanced dry root weight effectively. Significant increases in root weights were recorded particularly in the triple inoculations compared with single or dual inoculations. Compared with the non‐treated controls all biological control agents increased P‐content of treated roots of plants. Colonization with RB increased especially in triple (FOL + G. intraradices + RB) inoculations whereas colonization of G. intraradices was significantly decreased in treatment of FOL + G. intraradices compared with triple inoculations. The results suggest that suitable combinations of these biocontrol agents may ameliorate plant growth and health.

First report in Italy of a resistance‐breaking strain of Tomato spotted wilt virus infecting tomato cultivars carrying the Sw5 resistance gene

In 2004, leaf samples of a processing tomato variety carrying the Sw5 resistance gene to Tomato spotted wilt virus (TSWV) were collected from field-grown plants in Mesagne (BR), Apulia, southern Italy. Leaf extracts were tested by lateral flow and/or ELISA (Roggero et al., 2002) for TSWV, Impatiens necrotic spot virus (INSV), Cucumber mosaic virus (CMV), Tobacco mosaic virus (TMV) and Potato virus Y (PVY). Leaf dips were also observed with a transmission electron microscope, and two of these samples were inoculated mechanically on to a set of test plants. Only TSWV was detected in all field samples tested. One of the TSWV field isolates, T992, was investigated for the ability to overcome the resistance gene Sw5. T992 was mechanically inoculated onto 20 plants of each F1 hybrid tomato cultivar carrying the Sw5 gene (cvs Donald, York, Rovente, Valiente, Hermes, UGX 9233, Diaz, ISI 19343, Es 5302, Scipio and Herdon); cv. Marmande was used as a susceptible control. Another set of F1 hybrids was mechanically inoculated with strain p105, a wild-type strain of TSWV (Roggero et al., 2002). Tomato plantlets were inoculated at the four- to five-true-leaf stage and systemic infection was tested 20 days postinoculation using ELISA. All hybrids carrying the Sw5 gene were uninfected systemically by strain p105, with the exception of four plants of F1 UGX 9233. In contrast, T992 systemically infected all F1 hybrids tested. Marmande was infected systemically by both p105 and T992. These results showed that strain T992 can overcome Sw5 gene resistance. Portions of the S and M genome of T992 were cloned and sequenced, and the data deposited in GenBank (Accession Nos AY848922 and AY848921, respectively). Using a 560 bp fragment corresponding to part of the nonstructural protein of the middle segment (NSm), the closest identity was found to the SAN-1 isolate (AY124966), previously described from Apulia (Finetti-Sialer et al., 2002). Using a 780 bp N fragment, the closest identity was to the LE98-527 strain from Bulgaria (99·6% identity at the nucleotide level; Heinze et al., 2001). T992 was classified as an A-type isolate according to the MaeI restriction pattern used previously (Finetti-Sialer et al., 2002). This is the first confirmed report of RB strains of TSWV in tomato in Italy. Previously, RB strains of TSWV on tomato in Europe had been identified only in Spain (Aramburu & Martí, 2003).

Rhythmic gene expression in a purple photosynthetic bacterium, Rhodobacter sphaeroides

Circadian rhythms are known to exist in all groups of eukaryotic organisms as well as oxygenic photosynthetic bacteria, cyanobacteria. However, little information is available regarding the existence of rhythmic behaviors in prokaryotes other than cyanobacteria. Here we report biological rhythms of gene expression in a purple bacterium Rhodobacter sphaeroides by using a luciferase reporter gene system. Self-bioluminescent strains of Rb. sphaeroides were constructed, which produced a bacterial luciferase and its substrate, a long chain fatty aldehyde, to sustain the luminescence reaction. After being subjected to a temperature or light entrainment regime, the reporter strains with the luciferase genes driven by an upstream endogenous promoter expressed self-sustained rhythmicity in the constant free-running period. The rhythms were controlled by oxygen and exhibited a circadian period of 20.5 h under aerobic conditions and an ultradian period of 10.6–12.7 h under anaerobic conditions. The data suggest a novel endogenous oscillation mechanism in purple photosynthetic bacteria. Elucidation of the clock-like behavior in purple bacteria has implications in understanding the origin and evolution of circadian rhythms.

Effect of light and oxygen and adaptation to changing light conditions in a photosynthetic mutant in which the LHII complex of Rhv. sulfidophilum was heterologously expressed in a strain of Rb. capsulatus whose puc operon was deleted.

In this paper we show the effect of oxygen and light on the expression of the photosynthetic apparatus of a mutant heterologously expressing the puc operon. This mutant was obtained by introducing in trans an expression plasmid, bearing the puc A, B, and C genes of Rhv. sulfidophilum, as well as its own promoter, in an LHII(-) mutant of Rb. capsulatus. The results showed that oxygen and light repressed LHII expression. Even low-light intensities lowered the LHII content to undetectable levels by spectrophotometry or by SDS-PAGE. In high-light grown cells, where the relative ratios of LHI and LHII complexes were significantly diminished, we were able to detect LHII complexes. Under the latter condition, the absorption spectrum showed that some pigment accumulated in the membrane even in the absence of cell division. These pigments were used in a later step to assemble LHII complexes, when the high-light grown cells were transferred to semiaerobiosis in the dark. Transition of high-light grown cells to low-light conditions allowed us to study the adaptability of these heterologous mutant cells. We observed that adaptation never occurred, in part probably owing to energy limitation.

Functional assembly of the foreign carotenoid lycopene into the photosynthetic apparatus of Rhodobacter sphaeroides, achieved by replacement of the native 3-step phytoene desaturase with its 4-step counterpart from Erwinia herbicola.

Photosynthetic organisms synthesize a diverse range of carotenoids. These pigments are important for the assembly, function and stability of photosynthetic pigment-protein complexes, and they are used to quench harmful radicals. The photosynthetic bacterium Rhodobacter sphaeroides was used as a model system to explore the origin of carotenoid diversity. Replacing the native 3-step phytoene desaturase (CrtI) with the 4-step enzyme from Erwinia herbicola results in significant flux down the spirilloxanthin pathway for the first time in Rb. sphaeroides. In Rb. sphaeroides, the completion of four desaturations to lycopene by the Erwinia CrtI appears to require the absence of CrtC and, in a crtC background, even the native 3-step enzyme can synthesize a significant amount (13%) of lycopene, in addition to the expected neurosporene. We suggest that the CrtC hydroxylase can intervene in the sequence of reactions catalyzed by phytoene desaturase. We investigated the properties of the lycopene-synthesizing strain of Rb. sphaeroides. In the LH2 light-harvesting complex, lycopene transfers absorbed light energy to the bacteriochlorophylls with an efficiency of 54%, which compares favourably with other LH2 complexes that contain carotenoids with 11 conjugated double bonds. Thus, lycopene can join the assembly pathway for photosynthetic complexes in Rb. sphaeroides, and can perform its role as an energy donor to bacteriochlorophylls.

Excitation trap approach to analyze size and pigment-pigment coupling: reconstitution of LH1 antenna of Rhodobacter sphaeroides with Ni-substituted bacteriochlorophyll.

Replacement of the central Mg in chlorophylls by Ni opens an ultrafast (tens of femtoseconds time range) radiationless de-excitation path, while the principal ground-state absorption and coordination properties of the pigment are retained. A method has been developed for substituting the native bacteriochlorophyll a by Ni-bacteriochlorophyll a ([Ni]-BChl) in the light harvesting antenna of the core complex (LH1) from the purple bacterium, Rhodobacter (Rb.) sphaeroides, to investigate its unit size and excited state properties. The components of the complex have been extracted with an organic solvent from freeze-dried membranes of an LH1-only strain of Rb. sphaeroides and transferred into the micelles of n-octyl-beta-glucopyranoside (OG). Reconstitution was achieved by solubilization in 3.4% OG, followed by dilution, yielding a complex nearly identical to the native one, in terms of absorption, fluorescence, and circular dichroism spectra as well as energy transfer efficiency from carotenoid to bacteriochlorophyll. By adding increasing amounts of [Ni]-BChl to the reconstitution mixture, a series of LH1 complexes was obtained that contain increasing levels of this efficient excitation trap. In contrast to the nearly unchanged absorption, the presence of [Ni]-BChl in LH1 markedly affects the emission properties. Incorporation of only 3.2 and 20% [Ni]-BChl reduces the emission by 50% and nearly 100%, respectively. The subnanosecond fluorescence kinetics of the complexes were monoexponential, with the lifetime identical to that of the native complex, and its amplitude decreasing in parallel with the steady-state fluorescence yield. Quantitative analysis of the data, based on a Poisson distribution of the modified pigment in the reconstituted complex, suggests that the presence of a single excitation trap per LH1 unit suffices for efficient emission quenching and that this unit contains 20 +/- 1 BChl molecules.

Specific mutagenesis of the rieske iron-sulfur protein in Rhodobacter sphaeroides shows that both the thermodynamic gradient and the pK of the oxidized form determine the rate of quinol oxidation by the bc(1) complex.

In the Rieske iron-sulfur protein (ISP) of the ubiquinol:cytochrome c(2) oxidoreductase (bc(1) complex) of Rhodobacter sphaeroides, residue Tyr 156 is located close to the iron-sulfur cluster. Previous studies of the equivalent residue in both Saccharomyces cerevisiae [Denke, E., Merbitz-Zahradnik, T., Hatzfeld, O. M., Snyder, C. H., Link, T. A., and Trumpower, B. L. (1998) J. Biol. Chem. 273, 9085-9093] and Paracoccus denitrificans [Schroter, T., Hatzfeld, O. M., Gemeinhardt, S., Korn, M., Friedrich, T., Ludwig, B. , and Link, T. A. (1998) Eur. J. Biochem. 255, 100-106] have indicated that mutations at this site can lead to modifications in the redox potential of the ISP. To study the effect of similar modifications on the thermodynamic behavior and kinetics of partial reactions of the bc(1) complex upon flash activation, we have constructed four mutant strains of Rb. sphaeroides where Tyr 156 was mutated to His, Leu, Phe, or Trp. The bc(1) complex was assembled and able to support photosynthetic growth in all mutants. Three substitutions (Leu, Phe, Trp) led to alteration of the midpoint potential (E(m)) of the ISP and a slowing in rate of quinol oxidation, suggesting that electron transfer from quinol to the oxidized ISP controls the overall rate and that this step includes the high activation barrier. The Trp mutation led to an increase of approximately 1 pH unit in the pK value of the oxidized ISP. The pH dependence of the rate of quinol oxidation in this mutant was also shifted up by approximately 1 pH unit, showing the importance of the protonation state of the ISP for quinol oxidation. This provides support for a model in which the dissociated form of the oxidized ISP is required for formation of the enzyme-substrate complex [Ugulava, N., and Crofts, A. R. (1998) FEBS Lett. 440, 409-413].

CD-monitored redox titration of the Rieske Fe-S protein of Rhodobacter sphaeroides: pH dependence of the midpoint potential in isolated bc1 complex and in membranes

The redox potential of the Rieske Fe-S protein has been investigated using circular dichroism (CD)-spectroscopy. The CD features characteristic of the purified bc 1 complex and membranes of Rhodobacter sphaeroides were found in the region between 450 and 550 nm. The difference between reduced and oxidized CD-spectra shows a negative band at about 500 nm with a half of width 30 nm that corresponds to the specific dichroic absorption of the reduced Rieske protein (Fee, J.A. et al. (1984) J. Biol. Chem. 259, 124–133; Degli Esposti, M. et al. (1987) Biochem. J. 241, 285–290; Rich, P.R. and Wiggins, T.E. (1992) Biochem. Soc. Trans. 20, 241S). It was found that the redox potential at pH 7.0 for the Rieske center in the isolated bc 1 complex and in chromatophore membranes from the R-26 strain of Rb. sphaeroides is 300±5 mV. In chromatophores from the BC17C strain of Rb. sphaeroides, the E m value measured for the Rieske iron-sulfur protein (ISP) was higher (315±5 mV), but the presence of carotenoids made measurement less accurate. The E m varied with pH in the range above pH 7, and the pH dependence was well fit either by one p K at ∼7.5 in the range of titration, or by two p K values, p K 1=7.6 and p K 2=9.8. Similar titrations and p K values were found for the Rieske Fe-S protein in the isolated bc 1 complex and membranes from the R-26 strain of Rb. sphaeroides. The results are discussed in the context of the mechanism of quinol oxidation by the bc 1 complex, and the role of the iron sulfur protein in formation of a reaction complex at the Q o-site.