Rathayibacter Species Research Articles

Rathayibacter tanaceti sp. nov., a Novel Actinobacterium from Tanacetum vulgare Infested by Foliar Nematode Aphelenchoides sp.

Two novel yellow-pigmented, rod-shaped and non-motile coryneform actinobacteria, strains VKM Ac-2596T and VKM Ac-2761, were isolated from a plant Tanacetum vulgare (Asteraceae) infested by foliar nematode Aphelenchoides sp. The strains exhibited the highest 16S rRNA gene sequence similarities to Rathayibacter agropyri CA4T (99.71%), Rathayibacter rathayi DSM 7485T (99.65%) and Rathayibacter iranicus VKM Ac-1602T (99.65%). The pairwise average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values between VKM Ac-2596T and VKM Ac-2671 towards the type strains of Rathayibacter species did not exceed 85.24% and 29.40%, respectively, that are well below the thresholds for species delineation. The target strains had key chemotaxonomic properties typical of the genus Rathayibacter, namely, the DAB-based peptidoglycan, rhamnose and mannose as the predominant sugars and a rhamnomannan in the cell, the major menaquinone MK-10 and fatty acids of iso-anteiso type, with a large proportion of anteiso-15:0. The strains showed clear differences from the recognized Rathayibacter species in several phenotypic characteristics, including the difference in the composition of cell wall glycopolymers. Based on the results obtained in this study and the data published previously, we provide a description of a new species, Rathayibacter tanaceti sp. nov., with DL-642T (= VKM Ac-2596T = LMG 33114T) as the type strain.

Comparative Secretome Analyses of Toxigenic and Atoxigenic Rathayibacter Species.

Phytopathogenic Rathayibacter species are unique bacterial plant pathogens because they are obligately vectored by plant parasitic anguinid nematodes to the developing seedheads of forage grasses and cereals. This understudied group of plant-associated Actinomycetes includes the neurotoxigenic plant pathogen R. toxicus, which causes annual ryegrass toxicity in grazing livestock. R. toxicus is currently endemic to Australia and is listed as a plant pathogen select agent by the U.S. Department of Agriculture-Animal and Plant Health Inspection Service. The complex Rathayibacter disease cycle requires intimate interactions with the nematode vector and plant hosts, which warrants an increased understanding of the secretory and surface-associated proteins that mediate these diverse eukaryotic interactions. Here we present the first comparative secretome analysis for this complex, nematode-vectored Rathayibacter genus that compares the three agronomically damaging toxigenic and atoxigenic Rathayibacter species, R. toxicus, R. iranicus, and R. tritici. The exoproteomic comparison identified 1,423 unique proteins between the three species via liquid chromatography-tandem mass spectrometry, leading to the identification of putative pathogenicity-related proteins and proteins that may mediate nematode attachment. Of the uniquely identified proteins, 94 homologous proteins were conserved between the three Rathayibacter exoproteomes and comprised between 43.4 and 58.6% of total protein abundance. Comparative analyses revealed both conserved and uniquely expressed extracellular proteins, which, interestingly, had more similarities to extracellular proteins commonly associated with bacterial animal pathogens than classic plant pathogens. This comparative exoproteome analysis will facilitate the characterization of proteins essential for vector attachment and host colonization and assist in the development of serological diagnostic assays.

D-Rhamnan and Pyruvate-Containing Teichuronic Acid from the Cell Wall of Rathayibacter sp. VKM Ac-2759.

Rathayibacter sp. VKM Ac-2759 (family Microbacteriaceae, class Actinobacteria) contains two glycopolymers in the cell wall. The main chain of rhamnan, glycopolymer 1, is built from the repeating tetrasaccharide units carrying terminal arabinofuranose residues at the non-reducing end, →3)-α-[α-D-Araf-(1→2)]-D-Rhap-(1→2)-α-D-Rhap-(1→3)-α-D-Rhap-(1→2)-α-D-Rhap-(1→. Similar to other described Rathayibacter species, rhamnose in the neutral glycopolymer of the VKM Ac-2759 strain is present in the D-configuration. Acetalated with pyruvic acid teichuronic acid, glycopolymer 2, is composed of the repeating tetrasaccharide units, →4)-β-D-GlcpA-(1→4)-β-D-Galp-(1→4)-β-D-Glcp-(1→3)-β-[4,6-S-Pyr]-D-Manp-(1→. Glycopolymers 1 and 2 were identified in prokaryotic microorganisms for the first time and their structures were established by chemical analysis and NMR spectroscopy. The obtained data can be used in taxonomic research, as well as for elucidating the mechanisms of plant colonization and infection by bacteria of the Rathayibacter genus.

Rhamnomannans and Teichuronic Acid from the Cell Wall of Rathayibacter tritici VKM Ac-1603T.

The structures of three cell wall glycopolymers of the phytopathogen Rathayibacter tritici VKM Ac-1603T (family Microbacteriaceae, order Micrococcales, class Actinobacteria) were established by chemical methods and NMR spectroscopy. Polymer 1 is a branched rhamnomannan with the repeating unit →3)-α-[β-D-Xylp-(1→2)]-D-Manp-(1→2)-α-D-Rhap-(1→3)-α-D-Manp-(1→2)-α-D-Rhap-(1→; polymer 2 is a linear rhamnomannan with the repeating unit →2)-α-D-Manp-(1→2)-α-D-Rhap-(1→3)-α-D-Manp-(1→2)-α-D-Rhap-(1→; polymer 3 is a branched teichuronic acid containing monosaccharide residues GlcA, Gal, Man, and Glc at a 1 : 1 : 1 : 5 ratio (see the text for the structures). It has been demonstrated that representatives of four Rathayibacter species studied to date (R. tritici VKM Ac-1603T, R. iranicus VKM Ac-1602 T, R. toxicus VKM Ac-1600 and "Rathayibacter tanaceti" VKM Ac-2596) contain differing patterns of phosphate-free glycopolymers. At the same time, the above Rathayibacter strains have a common property - the presence of rhamnomannans with D-rhamnose. These rhamnomannans may be linear or branched and differing in the positions of glycosidic bonds and side substituents. The presence in the cell wall of rhamnomannans with D-rhamnose may serve as useful chemotaxonomic marker of the genus Rathayibacter.

The Identification and Conservation of Tunicaminyluracil-Related Biosynthetic Gene Clusters in Several Rathayibacter Species Collected From Australia, Africa, Eurasia, and North America.

Tunicaminyluracil antibiotics are a novel class of toxigenic glycolipids that are synthesized by several soil-associated Actinomycetes. The acquisition of a tunicaminyluracil biosynthetic gene cluster (TGC) in Rathayibacter toxicus has led to the emergence of the only described, naturally occurring tunicaminyluracil-associated mammalian disease, annual ryegrass toxicity of livestock. Endemic to Australia, R. toxicus is obligately vectored by Anguinid seed gall nematodes to the developing seedheads of forage grasses, in which the bacteria synthesize tunicaminyluracils that may subsequently be consumed by livestock and result in high rates of mortality and morbidity. The potential impact of R. toxicus on U.S. agriculture has led the U.S. Department of Agriculture – Animal and Plant Health Inspection Service to list R. toxicus as a Plant Pathogen Select Agent. R. toxicus is the only characterized phytopathogenic bacterium to produce tunicaminyluracils, but numerous R. toxicus-like livestock poisonings outside Australia suggest additional bacterial sources of tunicaminyluracils may exist. To investigate the conservation of the TGC in R. toxicus and whether the TGC is present in other Rathayibacter species, we analyzed genome sequences of members of the Rathayibacter genus. Putative TGCs were identified in genome sequences of R. toxicus, R. iranicus, R. agropyri, and an undescribed South African Rathayibacter species. In the latter three species, the putative TGCs have homologs of tunicaminyluracil-related genes essential for toxin production, but the TGCs differ in gene number and order. The TGCs appear at least partially functional because in contrast to atoxigenic species, TGC-containing Rathayibacter species were each able to tolerate exogenous applications of tunicamycin from Streptomyces chartreusis. The North American R. agropyri TGC shows extensive diversity among the sequenced isolates, with presense/absense polymorphisms in multiple genes or even the whole TGC. R. agropyri TGC structure does not appear to correlate with date or location of isolate collection. The conservation and identification of tunicaminyluracil-related gene clusters in three additional Rathayibacter species isolated from South Africa, the Middle East, and the United States, suggests a wider global distribution of potentially neurotoxigenic plant-associated bacteria. This potential for additional endemic and exotic toxigenic Rathayibacter species could have widespread and severe implications for agriculture.

Rhamnose-Containing Cell Wall Glycopolymers from Rathayibacter toxicus VKM Ac-1600 and "Rathayibacter tanaceti" VKM Ac-2596.

Structures of the cell wall glycopolymers from two representatives of the genus Rathayibacter were investigated using chemical, NMR spectroscopy, and optical methods. The R. toxicus VKM Ac-1600 strain contains two neutral glycopolymers - a linear rhamnomannan →2)-α-D-Rhap-(1→3)-α-D-Manp-(1→ and a branched polysaccharide containing in the repeating unit the residues of D-Manp, D-Glcp, and L-Rhap in the ratios of 2 : 4 : 1, respectively (the structure is presented in the text). The "Rathayibacter tanaceti" VKM Ac-2596 contains a rhamnomannan that is different from the above-described one by localization of glycosidic bonds on the residues of α-Rhap and α-Manp, i.e. →3)-α-D-Rhap (1→2)-α-D-Manp-(1→. The structures of all identified glycopolymers are described for the first time in actinobacteria. The data obtained make it possible to characterize representatives of the studied actinobacteria more fully and can be used to differentiate Rathayibacter species at the phenotype level.

Rathayibacter oskolensis sp. nov., a novel actinobacterium from Androsace koso-poljanskii Ovcz. (Primulaceae) endemic to the Central Russian Upland.

A rod-shaped, non-endospore-forming and non-motile bacterium, strain DL-329T, was isolated from the above-ground part of a plant, Androsace koso-poljanskii Ovcz. (Primulaceae), at the the State Natural Reserve 'Belogorie', Russia. On the basis of 16S rRNA gene sequence comparisons, the strain clustered with members of the genus Rathayibacter, showing the highest sequence similarity to Rathayibacter tritici (98.89 %), Rathayibacter rathayi (98.82 %) and Rathayibacter festucae (98.82 %). The DNA hybridization experiments demonstrated that strain DL-329T represents a separate genomic species. The results of comparative studies of physiological and chemotaxonomic characteristics, including cell-wall sugar patterns, polar lipid profiles, and the matrix-assisted laser desorption/ionization time-of-flight mass spectra of bacterial cells, allowed clear differentiation of VKM Ac-2121T from the recognized Rathayibacter species at the phenotypic level. Based on the data obtained, a new species, Rathayibacter oskolensis sp. nov., is proposed, with DL-329T (=VKM Ac-2121T=LMG 22542T) as the type strain.

Afrina sporoboliae sp. n. (Nematoda: Anguinidae) Associated with Sporobolus cryptandrus from Idaho, United States: Phylogenetic Relationships and Population Structure.

The dropseed gall-forming nematode, Afrina sporoboliae sp. n., is described from seed galls of Sporobolus cryptandrus (Poaceae: Chloridoideae: Sporobolinae) collected in Idaho, USA. This is the third report of an Afrina species in North America and the first report of this genus in a natural plant population on this continent. Morphological, morphometric, and molecular analyses placed this nematode in genus Afrina and demonstrated that it differs from Afrina hyparrheniae and Afrina spermophaga by having longer body and stylet lengths for females and males, and from Afrina wevelli by the absence of tip irregularities on the tails of female and presence of lips noticeably protruding beyond the body contour. The new species has several characters that overlap with Afrina tumefaciens, but differs from this species by inducing seed galls, whereas Afrina tumefaciens induces ovoid galls on stems, leaves, and in flower heads. Evolutionary relationships of Afrina sporoboliae sp. n. with other representatives of the family Anguinidae are presented based on analysis of the internal transcribed spacer (ITS)1-5.8S-ITS2 rRNA and the D2-D3 regions of the rRNA genes. Analysis of 270 sequences of the cox1 gene from 25 populations of Afrina sporoboliae sp. n. revealed seven haplotypes with sequence divergence up to 5%. This study did not demonstrate a significant positive relationship between genetic difference and geographic distance. Seed gall nematodes are important quarantine pests in many countries. The association of this and other seed gall nematodes with Rathayibacter species and their ability to serve as vectors, especially of R. toxicus, is of concern for U.S. agriculture.

Rathayibacter toxicus, Other Rathayibacter Species Inducing Bacterial Head Blight of Grasses, and the Potential for Livestock Poisonings.

Rathayibacter toxicus, a Select Agent in the United States, is one of six recognized species in the genus Rathayibacter and the best known due to its association with annual ryegrass toxicity, which occurs only in parts of Australia. The Rathayibacter species are unusual among phytopathogenic bacteria in that they are transmitted by anguinid seed gall nematodes and produce extracellular polysaccharides in infected plants resulting in bacteriosis diseases with common names such as yellow slime and bacterial head blight. R. toxicus is distinguished from the other species by producing corynetoxins in infected plants; toxin production is associated with infection by a bacteriophage. These toxins cause grazing animals feeding on infected plants to develop convulsions and abnormal gate, which is referred to as "staggers," and often results in death of affected animals. R. toxicus is the only recognized Rathayibacter species to produce toxin, although reports of livestock deaths in the United States suggest a closely related toxigenic species may be present. A closely related but undescribed species, Rathayibacter sp. EV, originally isolated from Ehrharta villosa var. villosa in South Africa, is suspected of producing toxin. Many of the diseases caused by Rathayibacter species occur in arid areas and the extracellular polysaccharide they produce is believed to aid in their survival between crops. For example, R. "agropyri" was isolated from infected plant material after being stored for 50 years in a herbarium. Similarly, the anguinid vectors associated with these bacteria form seed galls in infected plants and are capable of surviving for very long periods of time under dry conditions. The addition of R. toxicus to the list of Select Agents has raised concern over its potential introduction and a realization that current diagnostic methods are inadequate to distinguish among Rathayibacter species. In addition, little is known about the Rathayibacter species and their seed gall nematode vectors present in the United States.

Rathayibacter iranicus isolated from symptomless wheat seeds in Turkey

Rathayibacter iranicus (Ri), originally reported in Iran in 1961 (Sharif, 1961), has not been reported outside Iran and only one strain is known to exist. Like R. tritici (Rt), Ri causes a gumming disease of wheat in association with the nematode Anguina tritici (Paruthi et al., 1989). During 2003, a survey of wheat seed for Rathayibacter species (RS) in Turkey using samples from 799 farmers in six provinces in Central Anatolia was conducted. Identification of the three strains as Ri was further supported by 16s rDNA sequence similarities to Ri and Rt of 100%and 99.3%, respectively (GenBank Accession Nos. FJ595101 - Ri, ICPB 70005 and FJ595102 – Rt, ICPB 70004). Identification asRi was confirmed by AFLP analysis (EcoRI+0 and MseI+C) showing a pattern of 90% similarity to Ri but only 46% to Rt. This is the first report of Ri outside of Iran.

Use of a Seed Scarifier for Detection and Enumeration of Galls of Anguina and Rathayibacter Species in Orchard Grass Seed.

Seed galls, caused by Anguina spp., are normally detected visually in cereals such as wheat and barley. However, in grasses such as orchard grass, the presence of galls induced by Anguina or Rathayibacter spp. are difficult to detect visually due to their infrequent occurrence and masking by lemmas and paleas. To develop improved seed assays for the presence of the nematode and bacterial galls, a small scarifier was used to remove lemmas and paleas without causing major damage to seeds or galls. Following scarification, the galls were visually identified and manually counted under a dissecting microscope. Using the scarifier, several orchard grass seed lots were screened for Anguina and Rathayibacter spp. The percentage of samples of orchard grass seed harvested in the Willamette Valley of Oregon during 1996, 1997, and 2000 containing galls of Anguina sp. were 37, 46, and 48, respectively. The percentage of samples containing bacterial galls with Rathayibacter sp. was 27, 31, and 40, respectively. Total galls with Anguina sp. per 25 g of orchard grass sample ranged from 1 to 24. The mean of Anguina sp. galls per sample in 1996, 1997, and 2000 were 4, 5, and 5, respectively. Total galls with bacteria per 25 g of sample ranged from 27 to 40; mean number of galls per sample in 1996, 1997, and 2000 were, 6, 5, and 11, respectively. This is the first report confirming the presence of Rathayibacter sp. galls in orchard grass in Oregon.

High diversity in Curtobacterium flaccumfaciens pv. flaccumfaciens characterized by serology and rep-PCR genomic fingerprinting

The diversity found in culture collection strains of Curtobacterium flaccumfaciens pv. flaccumfaciens was characterized by serology and repetitive-sequence-based polymerase chain reaction (rep-PCR). Using strain NCPPB 559 as the reference antigen, immunofluorescence tests with polyclonal and monoclonal antibodies confirmed that no epitope appeared to be common to all strains of this pathovar. Screening of hybridoma cell lines againsl strains of this pathovar, as well as against other members of this genus and species, identified two distinct epitopes. Phylogenetic analysis of the rep-PCR genomic fingerprints of Curtobacter, Clavibacter, and Rathayibacter species, grouped all the C. flaccumfaciens strains and pathovars together, but the C. flaccumfaciens pv. flaccumfaciens strains did not form a single cluster. Rather, they dispersed into two clusters, along with strains of other pathovars of this species. Members of one cluster reacted with one of the monoclonal antibodies, while members of the other did not.

A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease.

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

Rathayibacter gen. nov., Including the Species Rathayibacter rathayi comb. nov., Rathayibacter tritici comb. nov., Rathayibacter iranicus comb. nov., and Six Strains from Annual Grasses

A new genus, Rathayibacter, is proposed to accommodate three species of gram-positive, aerobic, coryneform bacteria previously placed in the genus Clavibacter (Rathayibacter rathayi comb. nov., Rathayibacter tritici comb. nov., and Rathayibacter iranicus comb. nov.), as well as six strains that were isolated from annual cereal grasses, may be responsible for ryegrass toxicity, and are very similar to the recently described organism Clavibacter toxicus sp. nov. (I. T. Riley and K. M. Ophel, Int. J. Syst. Bacteriol. 42:64-68, 1992). The properties of members of the genus Rathayibacter include coryneform morphology, peptidoglycan based on 2,4-diaminobutyric acid (type B2γ), predominant menaquinones of the MK-10 type, and phosphatidylglycerol and diphosphatidylglycerol as basic polar lipids. The DNA base compositions range from 63 to 72 mol% G+C. The members of the new genus form a phenetic cluster distinct from Clavibacter spp. at a level of 71% (simple matching coefficient) and exhibit 7 to 9% DNA-DNA reassociation with strains of Clavibacter spp. In contrast to Clavibacter spp., most Rathayibacter strains are associated with nematodes belonging to the genus Anguina. The Rathayibacter species differ from species belonging to related genera (e.g., Clavibacter and Agromyces species) in the following characteristics: Menaquinone and whole-cell sugar compositions, results of lysozyme-sodium dodecyl sulfate test (which indicates differences in cell wall composition), ability to utilize a number carbon sources, resistance to bacteriocins of some Clavibacter spp., and other characteristics. The Rathayibacter species can be differentiated from each other by following characteristics: Presence or absence of xylose and galactose in the cell walls, fatty acid composition, ability to assimilate various sources of carbon and nitrogen, hydrolytic activity, tolerance to 5% NaCI and 0.03% potassium tellurite, susceptibility to iranicin, and absence or presence of plasmids of certain sizes. The type species of the genus Rathayibacter is R. rathayi. The type strains of the species are R. rathayi VKM Ac-1601 (= ICMP 2574), R. iranicus VKM Ac-1602 (= ICMP 3496), and R. tritici VKM Ac-1603 (= ICMP 2626).