Quasi-palindromic Sequence Research Articles

Structural switching/polymorphism by sequential base substitution at quasi-palindromic SNP site (G → A) in LCR of human β-globin gene cluster

The human β-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression contains five tissue-specific DNase I-hypersensitive sites (HSs). A single nucleotide polymorphism (SNP) (A → G) present in HS4 region of locus control region (LCR), have shown a notable association between the G allele and the occurrence of β-thalassemia. This SNP site exhibiting a hairpin − duplex equilibrium manifested in A → B like DNA transition has previously been reported from this laboratory. Since, DNA is a dynamic and adaptable molecule, so any change of a single base within a primary DNA sequence can produce major biological consequences commonly manifested in genetic disorders such as sickle cell anemia and β-thalassemia. Herein, the differential behavior of sequential single base substitutions G → A on the quasi-palindromic sequence (d-TGGGGGCCCCA; HPG11) has been explored. A combination of native gel electrophoresis, circular dichroism (CD), and UV-thermal denaturation (Tm) techniques have been used to investigate the structural polymorphism associated with various variants of HPG11 i.e. HPG11A2 to HPG11A5. The CD spectra confirmed that all the HPG11 variants exhibit a hairpin − duplex equilibrium. Oligomer concentration dependence on CD spectra has been correlated with A → B DNA conformational transition. However, as revealed in gel electrophoresis, HPG11A2 → A5 exhibit the formation of a tetramolecular structure (four-way junction) at higher oligomer concentration. UV-melting studies also supported the melting of hairpin, duplex and four-way junction structure. This polymorphism pattern may possibly be significant for DNA-protein recognition, in the process of regulation of LCR in the β-globin gene.

Crystal structure details of Vibrio fischeri DarR and mutant DarR-M202I from LTTR family reveals their activation mechanism

DarR, a novel member of the LTTR family derived from Vibrio fischeri, activates transcription in response to d-Asp and regulates the overexpression of the racD genes encoding a putative aspartate racemase, RacD. Here, the crystal structure of full-length DarR and its mutant DarR-M202I were obtained by X-ray crystallography. According to the electron density map analysis of full-length DarR, the effector binding site of DarR is occupied by 2-Morpholinoethanesulfonic acid monohydrate (MES), which could interact with amino acids in the effector binding site and stabilize the effector binding site. Furthermore, we elaborated the structure of DarR-M202I, where methionine is replaced by isoleucine resulting in overexpression of the downstream operon. By comparing DarR-MES and DarR-M202I, we found similar behavior of DarR-MES in terms of the stability of the RD active pocket and the deflection angle of the DBD. The Isothermal titration calorimetry and Gel-filtration chromatography experiments showed that only when the target DNA sequence of a particular quasi-palindromic sequence exceeds 19 bp, DarR can effectively bind to racD promoter. This study will help enhance our understanding of the mechanism in the transcriptional regulation of LTTR family transcription factors.

Crystal structure of the Vibrio cholerae VqmA–ligand–DNA complex provides insight into ligand-binding mechanisms relevant for drug design

VqmA is a highly conserved transcriptional regulator of the quorum-sensing system of Vibrio cholerae, a major human pathogen that continues to imperil human health. VqmA represses biofilm formation and plays an important role in V. cholerae pathogenicity in the human host. Although VqmA's biological function is well understood, the molecular mechanisms by which its specific ligand (and effector), 3,5-dimethylpyrazine-2-ol (DPO), controls transcription of the target gene, vqmR, remain obscure. To elucidate the molecular mechanism of DPO binding, we used structural analyses and biochemical assays to study the V. cholerae VqmA-DPO-DNA complex. These analyses revealed that VqmA contains an N-terminal homodimer domain (PAS) and a C-terminal DNA-binding domain (DBD). We observed that VqmA directly binds to a DPO molecule via a compact hydrophobic pocket, consisting of a six-stranded antiparallel β-sheet and several α-helices. We also found that the VqmA dimer interacts with the quasi-palindromic sequence of the vqmR promoter through its DBD. The results of the biochemical studies indicated that a water atom and VqmA residues Phe-67 and Lys-101 play a key role in effector recognition, which is also assisted by Tyr-36 and Phe-99. This is the first molecular level view of the VqmA dimer bound to DPO and DNA. The structure-function analyses presented here improve our understanding of the complex mechanisms in the transcriptional regulation of VqmA in Vibrio spp. and may inform the design of drugs to manage V. cholerae infections.

Unusual stability exhibited by (AT)XN12(AT)Y motif associated with high fetal hemoglobin levels

Quasi-palindromic sequences (AT)XN12(AT)Y present in HS2 (hypersensitive site 2) of the human β-globin locus are known to be significantly associated with increased fetal hemoglobin (HbF) levels. High HbF levels in some adults arise due to pathological conditions such as sickle cell disease and β-thalassemia. However, elevated levels of HbF are also associated with a reducing morbidity and mortality in patients with β-thalassemia and thus ameliorate the severity of the disease. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, and circular dichroism (CD) techniques, we demonstrated that it exhibits a hairpin-duplex equilibrium. Intramolecular species (hairpin) were observed in both low and high salt concentrations in gel assay studies displaying the unusual stability of intramolecular species even at the high counter-ion concentration. The unusual stability of hairpin secondary structures was also demonstrated by the monophasic nature of the melting profiles for the oligonucleotides which persisted at low as well as high salt and oligomer concentrations. Change in CD spectra as a function of oligomer concentration indicates that the bimolecular duplex formation is selectively favored over monomolecular hairpin formation at and above 9 µM oligomer concentration. Thus, we hypothesize that imperfect inverted repeat sequence (AT)XN12(AT)Y of HS2 of β-globin gene LCR forms the unusually stable hairpins which may result in the formation of a cruciform structure that may be recruited for binding by various nuclear proteins that could result in elevated HbF levels.Communicated by Ramaswamy H. Sarma.

Copper(I) stabilization by cysteine/tryptophan motif in the extracellular domain of Ctr4

Copper transporter Ctr4 of fission yeast has a quasi-palindromic sequence rich in cysteine and aromatic amino acid residues, CX4YWNWYX4C (where X represents any amino acid), in the N-terminal extracellular domain. A 24-mer peptide comprising this sequence is bound to Cu(I) through the cysteine thiolate coordination. Luminescence, UV absorption and resonance Raman spectra of the Cu(I)-peptide complex show that at least one of the two tryptophan side chains is located in close proximity to the thiolate-Cu(I) center and interacts with the Cu(I) ion via π-electrons of the indole ring. Although the thiolates and Cu(I) are oxidized to disulfide and Cu(II), respectively, only very slowly in air-saturated solutions, replacements of the tryptophan residues to phenylalanine significantly accelerate the oxidation reactions. The results obtained indicate that the interaction between Cu(I) and tryptophan via π-electrons plays a significant role in protecting the thiolate-Cu(I) center against the oxidation. The cysteine- and tryptophan-rich quasi-palindromic sequence may be a metal binding motif that stabilizes Cu(I) in the oxidizing extracellular environment.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A→G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin→duplex equilibrium corresponding to A→B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A→G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5′-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A→B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5′-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein–DNA recognition patterns.

X-Linked Dominant Congenital Ptosis Cosegregating with an Interstitial Insertion of a Chromosome 1p21.3 Fragment into a Quasipalindromic Sequence in Xq27.1

Blepharoptosis (ptosis) is defined as the abnormal drooping of the upper eyelid and is a feature of many conditions. It can be in isolated or syndromic form, bilateral or unilateral and congenital or acquired. Previously we have carried out linkage analysis on a family with dominantly inherited congenital bilateral isolated ptosis and found the condition to be linked to a region of approximately 20 megabases of chromosome Xq24-Xq27.1 with a cumulative LOD score of 5.89. We now describe further analysis using array comparative genomic hybridisation (array CGH), fluorescence in situ hybridisation (FISH), long range PCR and sequencing. This has enabled us to identify and characterise at the level of DNA sequence an insertional duplication and rearrangement involving chromosomes 1p21.3 and a small quasipalindromic sequence in Xq27.1, disruption of which has been associated with other phenotypes but which is cosegregating with X-linked congenital bilateral isolated ptosis in this family. This work highlights the significance of the small quasipalindromic sequence in genomic rearrangements involving Xq27.1 and the importance of comprehensive molecular and molecular cytogenetic investigations to fully characterise genomic structural complexity.

Molecular mechanisms of a novel β-thalassaemia mutation due to the duplication of tetranucleotide ‘AGCT’ at the junction IVS-II/exon 3

We report a new β-thalassaemia allele detected in a young Italian woman, suffering with mild non-haemolytic anaemia (Hb < 10g/dL) and not showing Hb variant or Heinz bodies. The allele is characterised by duplication of tetranucleotide 'AG/CT' (+1344/+1347) including the invariant dinucleotide 'AG' of IVS-II acceptor splicing site and the first two nucleotides of codon 105. β-Globin complementary DNA (cDNA) sequencing did not reveal any mutation and qualitative analysis of the reverse transcription PCR reaction showed that only the proximal 3' splice site present in the duplicated gene is used giving race to an anomalous messenger RNA (mRNA) present in trace (1.5%) because, most probably, rapidly degraded. In the anomalous mRNA, the insertion causes a frameshift and synthesis of an abnormal truncated β-chain (139 residues), unable to form Hb variant because of the severe conformational changes. The duplication might have arisen from secondary structures generated by quasi-palindromic sequence 5'-CCCA(C)AG/CT(CC)TGGG-3'. Restriction fragment length polymorphism analysis for the β-globin haplotype and familiar segregation analysis indicated that the mutant β-globin gene was associated with the haplotype V.

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P₅₂₂₈ promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P₅₂₂₈ promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P₅₂₂₈-β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P₅₂₂₈ promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Size-dependent palindrome-induced intrachromosomal recombination in yeast

Palindromic and quasi-palindromic sequences are important DNA motifs found in various cis-acting genetic elements, but are also known to provoke different types of genetic alterations. The instability of such motifs is clearly size-related and depends on their potential to adopt secondary structures known as hairpins and cruciforms. Here we studied the influence of palindrome size on recombination between two directly repeated copies of the yeast CYC1 gene leading to the loss of the intervening sequence (“pop-out” recombination). We show that palindromes inserted either within one copy or between the two copies of the CYC1 gene become recombinogenic only when they attain a certain critical size and we estimate this critical size to be about 70 bp. With the longest palindrome used in this study (150 bp) we observed a more than 20-fold increase in the pop-out recombination. In the sae2/com1 mutant the palindrome-stimulated recombination was completely abolished. Suppression of palindrome recombinogenicity may be crucial for the maintenance of genetic stability in organisms containing a significant number of large palindromes in their genomes, like humans.

A pseudosymmetric cell adhesion regulatory domain in the β7 tail of the integrin α4β7 that interacts with focal adhesion kinase and src

The beta7 integrins alpha4beta7 and alphaEbeta7 play key roles in forming the gut-associated lymphoid tissue, and contribute to chronic inflammation. The alpha4beta7 integrin-mediated adhesion of activated lymphocytes is largely due to a transient increase in avidity from ligand-induced clustering of alpha4beta7 at the cell-surface. Here, we report that L and D enantiomers of a cell-permeable peptide YDRREY encompassing residues 735-740 of the cytoplasmic tail of the beta7 subunit inhibit the adhesion of T cells to beta7 integrin ligands. The YDRREY peptide abrogated mucosal addressin cell adhesion molecule-1-induced clustering of alpha4beta7 on the surface of activated T cells. A mutated form of the YDRREY peptide carrying either single or double conservative mutations at Tyr(735)Phe and Tyr(740)Phe was unable to inhibit T cell adhesion, suggesting that both tandem tyrosines are critical for activity. The YDRREY peptide was bound and phosphorylated by focal adhesion kinase and src, which may serve to sequester cytoskeletal proteins to the cytoplasmic domain of alpha4beta7. The quasi-palindromic sequence YDRREY within the beta7 cytoplasmic tail constitutes a cell adhesion regulatory domain that modulates the interaction of beta7-expressing leukocytes with their endothelial and epithelial ligands. Cell-permeable peptidomimetics based on this motif have utility as anti-inflammatory reagents for the treatment of chronic inflammatory disease.

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of β-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A → B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

Cis and Trans-acting Effects on a Mutational Hotspot Involving a Replication Template Switch

A natural mutational hotspot in the thyA gene of Escherichia coli accounts for over half of the mutations that inactivate this gene, which can be selected by resistance to the antibiotic trimethoprim. This T to A transversion, at base 131 of the coding sequence, occurs within a 17 bp quasi-palindromic sequence. To clarify the mechanism of mutagenesis, we examine here cis and trans-acting factors affecting thyA131 mutational hotspot activity at its natural location on the E.coli chromosome. Confirming a template-switch mechanism for mutagenesis, an alteration that strengthens base-pairing between the inverted repeat DNA sequences surrounding the hotspot stimulated mutagenesis and, conversely, mutations that weakened pairing reduced hotspot activity. In addition, consistent with the idea that the hotspot mutation is templated from DNA synthesis from mispaired strands of the inverted repeats, co-mutation of multiple sites within the quasipalindrome was observed as predicted from the DNA sequence of the corresponding repeat. Surprisingly, inversion of the thyA operon on the chromosome did not abolish thyA131 hotspot mutagenesis, indicating that mutagenesis at this site occurs during both leading and lagging-strand synthesis. Loss of the SOS-induced DNA polymerases PolII, PolIV, and PolV, caused a marked increase in the hotspot mutation rate, indicating a heretofore unknown and redundant antimutagenic effect of these repair polymerases. Hotspot mutagenesis did not require the PriA replication restart factor and hence must not require fork reassembly after the template-switch reaction. Deficiency in the two major 3' single-strand DNA exonucleases, ExoI and ExoVII, stimulated hotspot mutagenesis 30-fold and extended the mutagenic tract, indicating that these exonucleases normally abort a large fraction of premutagenic events. The high frequency of quasipalindrome-associated mutations suggests that template-switching occurs readily during chromosomal replication.

Isolation and characterization of simple repeat sequences from the yellow fin sea bream Acanthopagrus latus (Sparidae)

We isolated DNA fragments containing various repetitive elements from the genome of a sea bream Acanthopagrus latus. Sequence analysis indicated that two fragments have particularly interesting features. Fragment AL87 contained a tetranucleotide repeat and a quasipalindromic sequence. Sequence comparison suggested that AL87 may be a part of a gene encoding a serine/threonine protein kinase, and that the quasipalindrome is situated at the junction of an intron and an exon. Moreover, the quasipalindrome is conserved in several other fishes, even though it has the potential to form a stem-loop structure at the splicing site. Fragment AL79 contained a minisatellite sequence made up of six 30-bp units in tandem. DNase I sensitivity assays and statistical analyses showed the repeat region to be flexible when subjected to bending stress. In addition, atomic force microscopic imaging of AL79 showed the presence of highly curved (kinked) segments flanking the repeat region. The structural features of these repetitive elements may be key factors facilitating the amplification of the repeats.

Hairpin-duplex equilibrium reflected in the A-->B transition in an undecamer quasi-palindrome present in the locus control region of the human beta-globin gene cluster.

Our recent work on an A-->G single nucleotide polymorphism (SNP) at the quasi-palindromic sequence d(TGGGG[A/G]CCCCA) of HS4 of the human beta-globin locus control region in an Indian population showed a significant association between the G allele and the occurrence of beta-thalassemia. Using UV-thermal denaturation, gel assay, circular dichroism (CD) and nuclease digestion experiments we have demonstrated that the undecamer quasi- palindromic sequence d(TGGGGACCCCA) (HPA11) and its reported polymorphic (SNP) version d(TGG GGGCCCCA) (HPG11) exist in hairpin-duplex equilibria. The biphasic nature of the melting profiles for both the oligonucleotides persisted at low as well as high salt concentrations. The HPG11 hairpin showed a higher T(m) than HPA11. The presence of unimolecular and bimolecular species was also shown by non-denaturating gel electrophoresis experiments. The CD spectra of both oligonucleotides showed features of the A- as well as B-type conformations and, moreover, exhibited a concentration dependence. The disappearance of the 265 nm positive CD signal in an oligomer concentration-dependent manner is indicative of an A-->B transition. The results give unprecedented insight into the in vitro structure of the quasi-palindromic sequence and provide the first report in which a hairpin-duplex equilibrium has been correlated with an A-->B interconversion of DNA. The nuclease-dependent degradation suggests that HPG11 is more resistant to nuclease than HPA11. Multiple sequence alignment of the HS4 region of the beta-globin gene cluster from different organisms revealed that this quasi-palindromic stretch is unique to Homo sapiens. We propose that quasi-palindromic sequences may form stable mini- hairpins or cruciforms in the HS4 region and might play a role in regulating beta-globin gene expression by affecting the binding of transcription factors.

Repeat expansion by homologous recombination in the mouse germ line at palindromic sequences.

Genetic instability can be induced by unusual DNA structures and sequence repeats. We have previously demonstrated that a large palindrome in the mouse germ line derived from transgene integration is extremely unstable and undergoes stabilizing rearrangements at high frequency, often through deletions that produce asymmetry. We have now characterized other palindrome rearrangements that arise from complex homologous recombination events. The structure of the recombinants is consistent with homologous recombination occurring by a noncrossover gene conversion mechanism in which a break induced in the palindrome promotes homologous strand invasion and repair synthesis, similar to mitotic break repair events reported in mammalian cells. Some of the homologous recombination events led to expansion in the size of the palindromic locus, which in the extreme case more than doubled the number of repeats. These results may have implications for instability observed at naturally occurring palindromic or quasipalindromic sequences.

Elongation of repetitive DNA by DNA polymerase from a hyperthermophilic bacterium Thermus thermophilus.

Short repetitive DNA sequences are believed to be one of the primordial genetic elements that served as a source of complex large DNA found in the genome of modern organisms. However, the mechanism of its expansion (increase in repeat number) during the course of evolution is unclear. We demonstrate that the DNA polymerase of the hyperthermophilic bacterium Thermus thermophilus can elongate oligoDNA with several tandem repeats to very long DNA in vitro. For instance, 48mer repetitive oligoDNA (TACATGTA)(6), which has 25% GC content and a palindromic sequence, can be elongated up to approximately 10 000 bases by DNA polymerase at 74 degrees C without template DNA. OligoDNA having a different GC content or a quasi-palindromic sequence can also be elongated, but less efficiently. A spectroscopic thermal melting experiment with the oligoDNA showed that its hairpin-coil transition temperature was very close to the elongation reaction temperature (74 degrees C), but was much higher than the temperature at which duplex oligoDNA can exist stably. Taken together, we conclude that repetitive oligoDNA with a palindromic or quasi-palindromic sequence is elongated extensively by a hyperthermophilic DNA polymerase through hairpin-coil transitions. We propose that such an elongation mechanism might have been a driving force to expand primordial short DNA.

Proposed mechanism for a novel insertion/deletion frameshift mutation (I414G415ATCG-->CCA) in the hepatocyte nuclear factor 1 alpha (HNF-1 alpha) gene which causes maturity-onset diabetes of the young (MODY).

Maturity-onset diabetes of the young (MODY) is a monogenic subgroup of non-insulin dependent diabetes (NIDDM) characterized by an early age of diagnosis (usually < 25 years) and an autosomal dominant mode of inheritance. Mutations in the hepatocyte nuclear factor 1 alpha (HNF-1alpha) [MODY3] gene represent the most common cause of MODY in the UK and a common cause of MODY in many other populations. Sixty-three different mutations have been described in a total of 112 families worldwide. This report describes two families, not known to be related, who carry a novel insertion/deletion mutation (I414G415ATCG-->CCA) and a 6bp intronic deletion of the HNF-1alpha gene in cis. We propose that the insertion/deletion mutation has arisen by formation of a hairpin loop due to the presence of a quasi-palindromic sequence, followed by insertion of CC and deletion of TCG resulting in the increased stability of the hairpin loop.

Sequence specific mutagenesis of the major (+)-anti-benzo[a]pyrene diol epoxide-DNA adduct at a mutational hot spot in vitro and in Escherichia coli cells.

In the supF gene, most (+)-anti-benzo[a]pyrene diol epoxide ((+)-anti-B[a]PDE) mutagenesis hot spots in Escherichia coli are in 5'-GG sequences [Rodriguez and Loechler (1993) Carcinogenesis 14, 373-383]. A major hot spot was detected at G1 in the sequence 5'-GCG1G2-CCAAAG, whereas G2 yielded very few mutants. In order to investigate the details of such sequence context effects of (+)-anti-B[a]PDE mutagenesis, we have constructed 25-mer oligonucleotides and single-stranded M13 genomes containing the above decamer sequence, in which the trans-N2-dG adduct induced by (+)-anti-B[a]PDE [(+)-trans-anti-B[a]P-N2-dG] at G1 or G2 was introduced. In vitro DNA synthesis on the adducted 25-mers was strongly blocked at each site, although the 3'-->5' exonuclease-deficient Klenow fragment could incorporate a nucleotide opposite the adduct in the presence of Mn2+. For both sites purine nucleotides were preferred. The ratio Vmax/K(m) indicated that the efficiency of incorporation of dGTP opposite these sites was very similar, but dATP incorporation opposite the adduct at G1 was five-fold more efficient than that at G2. For each site, further extension beyond the adducted nucleotide was investigated by annealing four different primers, in which only the nucleotide opposite the adducted deoxyguanosine was altered. Significant extension was only observed when deoxyadenosine was located opposite adducted G1. When the M13 genomes containing the (+)-trans-anti-B[a]P-N2-dG were replicated in E. coli, survival of each adducted genome was less than 1% as compared to the unadducted genome. Upon induction of SOS, viability increased 2-6-fold. DNA sequencing showed no base substitutions in the progeny from SOS-uninduced cells, although small deletions in a quasipalindromic sequence occurred with the adduct being located at either site. However, following SOS induction, up to 40% targeted base substitutions were detected when the adduct was located at G1, while approximately 12% of the progeny were mutants with the adduct at G2. Most base substitutions were targeted G-->T transversions. We conclude that (+)-trans-anti-B[a]P-N2-dG is a highly mutagenic and replication blocking lesion. In addition, the biological consequence of this adduct depends on whether it is located at G1 or G2, suggesting that sequence context plays a major role in the mutagenic processing of this adduct.

Microdeletions in the factor IX gene: three recurrences associated with a quasipalindromic sequence

Microdeletions in the factor IX gene: three recurrences associated with a quasipalindromic sequence