Qualitative DNA Analysis Research Articles

Comparing and combining bovine cornea decellularization methods for ocular surface biomaterials and tissue engineering applications

Aims/Purpose: The purpose of this research was to evaluate the decellularization efficiency of various individual protocols and their combinations for bovine cornea intended for ocular surface biomaterial applications.Methods: Two fundamental decellularization protocols, namely sodium chloride (NaCl) and Ammonium & Triton X‐100 were taken as benchmark and their combinations with freeze–thaw and lyophilization, were assessed whether, the decellularization efficiency improved (n = 3). Overall, protocols that were investigated were as follows: (1) Lyophilization followed by NaCl, (2) Freeze–Thaw followed by NaCl, (3) Lyophilization, Ammonium and Triton X‐100 (1%), (4) Ammonium and Triton X‐100 (5%), (5) Freeze–thaw, Ammonium and Triton X‐100 (1%), (6) Lyophilization, Ammonium and Triton X‐100 (5%), (7) Freeze–thaw and (8) NaCl. These methods were assessed using gel electrophoresis for qualitative DNA analysis and NanoDrop for quantitative DNA content. Efficient decellularization was achieved in the presence of DNA content below 50 ng/mg ECM dry weight and <200 bp DNA fragment length.Results: Gel electrophoresis revealed DNA content over 200 bp in groups 1, 2,7 and 8 while other groups fulfilled the criterion for efficient decellularization. DNA content as measured by NanoDrop indicated efficient decellularization in all groups, except group 7.Conclusions: Our study provides valuable insights into the effectiveness of combined and individual decellularization protocols for bovine cornea. Our findings suggest, that NaCl and its combinations with lyophilization and freeze–thaw yield in ineffective decellularization. On the other hand, Ammonium and Triton X‐100, individually or in combinations, result in favourable decellularization.

Association of Met/Val polymorphism of BDNF gene with Alzheimer's disease in Chinese patients.

Alzheimer's is the most common cause of dementia in the elderly. In this disease, genetic and environmental factors are involved. In Alzheimer's, changes of nucleotide 196 (G> A) or valine polymorphism of 66-methionine in the BDNF gene is a risk factor for brain-derived neurogenic factors. In China, this polymorphism has not been studied in Alzheimer's patients and perhaps this study could provide appropriate information on the prognosis and susceptibility of the disease. Therefore, in this case-control study, 73 patients with Alzheimer's disease and 100 patients as a healthy control group were studied. Blood samples were taken from the mentioned individuals and DNA was extracted. After quantitative and qualitative DNA analysis, a PCR-RFLP test was performed and the results of both groups were compared. The results showed that 14 patients and 7 people in the control group had BDNF gene polymorphism. In the patient group, the number of people with normal allele was 59. Heterozygous people were 8 and people with methionine/methionine alleles were 6. In the control group, 93 normal individuals, 5 heterozygous individuals, and 2 people had methionine/methionine alleles. In general, increasing the accumulation of valine/methionine polymorphism of the BDNF gene in Alzheimer's patients compared to control can indicate the role of this polymorphism. Clinically, patients with this polymorphism had a more unfavorable clinical condition compared to patients without it. Therefore, evaluation of the presence of this polymorphism can provide appropriate information about the disease status.

An Effective Method for Extracting DNA From Human Hair Samples

Introduction: In historical cases, mass disasters, missing person’s identification, and Archaeogenetic investigations, the bone, teeth, and hair samples are often the best and the only biological material available for DNA typing. In this study, we demonstrated an extremely effective protocol for DNA extraction of hair. Materials and Methods: Obtaining genetic information from hair samples for DNA typing involves the following steps: sterilization, DNA extraction, quality control, PCR, and profiling. After extracting aDNA (Ancient DNA) from the hair, autosomal STR analyses were performed for each sample using the AmpFlSTR® MiniFiler™ and Identifiler™ kits. Result: Qualitative analysis of DNA by electrophoresis showed the excellent quality of the extracted samples so that the electrophoresed bands were clearly visible. Conclusions: The results demonstrated that the FDEH method is cheaper and faster than commercial kits; moreover, this new method enhances DNA recovery from hair. Because of simple protocol and high quality, this method can be utilized in Medical.

The effect of bleaching agents on the DNA analysis of bloodstains on different floor coverings.

Blood at crime scenes is one of the most significant traces of evidence in investigation proceedings. Cleaning up these traces with household cleaning products, often containing bleaching agents, inhibits or complicates the detection of DNA. In this study, human blood was applied onto different floor coverings (carpet, laminate, parquet, PVC, tile) and subsequently cleaned with water and bleaching agents (hydrogen peroxide, sodium hypochlorite, DanKlorix®, Vanish Oxi Action®) at different times. Samples have been collected afterwards from the floors. The samples underwent a quantitative and qualitative DNA analysis. Cleaning smooth surfaces with water is usually sufficed to prohibit retrieving a DNA profile in most of the cases. Cleaning carpets was more difficult due to their absorbent surface whereas the use of bleaching agents caused an additional reduction of verifiable DNA concentrations. Retrieving partial or complete profiles after the use of bleaching agents was only possible when cleaning with low concentrations of 3% hydrogen peroxide.

Determination of serum DNA purity among patients undergoing antiretroviral therapy using NanoDrop-1000 spectrophotometer and polymerase chain reaction

Background: The study aimed to determine the effects of antiretrovirals on host DNA purity and to qualitatively quantify the DNA primers quality using NanoDrop-1000 spectrophotometer and polymerase chain reaction (PCR). Methods: Serum samples from 50 HIV/AIDS-positive patients who were undergoing antiretroviral therapy were collected at the point of their routine CD4 level checkup. The samples subjected to initial purifications and subsequent qualitative quantification using the NanoDrop-1000 spectrophotometer and PCR analysis. Results: The purity of the DNA from the subject was determined by the NanoDrop-1000 spectrophotometer, and the adequate yield from 1.13 (lowest) to 149 ng/μl (highest) was obtained across the 50 subjects at 260 and 280 nm. The ratio of the absorbance was compared. Thus, DNA products were obtained with high purity, and PCR showed that all patients had the right gene to code for the respective drug-metabolizing enzyme. The NanoDrop-1000 technique and PCR analysis proved to be beneficial in the measurement of both quantity and purity of DNA in the samples. Conclusion: This technique does not only designs better experiments but also ensures improved reporting and significant time- and energy-saving qualitative analysis of DNA and related molecules.

Ekstraksi DNA total dari sumber jaringan hewan (Ikan Kerapu) menggunakan metode kit for animal tissue

DNA extraction is a series of processes to separate DNA from other cell components. Extraction is the most crucial early stage in molecular research. There are two methods in DNA extraction: traditional organic extraction and non-organic adoption extraction method. Traditional organic extraction method are used by many laboratories to obtain amount of high-yield DNA. However, in recent years it has been a tendency to adopt non-organic commercial protocols, known as extraction kit. This method was relatively faster, low times-consuming and avoid the toxicity due to phenol use. This study aims to determine the steps of DNA extraction to obtain total DNA from muscle tissue of fish grouper using Extraction Kit for Animal Tissue. The Kit extraction method has an advantages that is the processing time is shorter, simple, non-toxic and high-purity DNA yields. A total of 4 tissue samples from grouper muscle were successfully extracted using an Extraction Kit that was indicated by the visualization of the band on qualitative DNA analysis in 1% agarose gel.
 Keywords: DNA extraction, extraction kit, high-yield DNA, molecular method

Phylogenetic Patterns of Genus Megophrys (Anura: Megophryidae) from Java and Sumatra

The emergence of Java and Sumatra islands at the end of Miocene, has impact to the diversity of fauna that living in the islands. Amphibia, as one of a genetic information series, can be used as a good phylogenetic comparison. Genus Megophrys (Anura: Megophryidae), is a member of amphibians that live isolated at an altitude of 1000 ASL (Above Sea Level) or more. The purpose of this research is to analyze the phylogenetic patterns of genus Megophrys in Java and Sumatra based on the analysis of 16s rRNA gene. We also analyzed the zoogeography to understand the history of relationship and the establishment of these islands. We took samples on 12 localities: 10 areas of Sumatra and 2 areas of Java. We used Qiamp Blood and Tissue Kit to extract the DNA from tissues. Qualitative analysis of DNA was done by running electrophoresis on 1% agarose gel. Qualitative analysis of DNA was done by running electrophoresis on 1% agarose gel. Results show that Clade A has 2 subclasses: I and II. Subclade I consists of Sumatran specimens, whereas subclade II consists of Javanese specimens. Subclaude I and II have paraphyletic connections. Clade B classified as politomy clade consists of Megophrys sp. from West Pasaman, Megophry s sp. from West Sumatra and Megophrys sp. from Pasawaran, Lampung. The result shows that Megophrys sp. of subclade I (clade A) and clade B, belongs to the same group, both of them were originated from Sumatra. Megophrys sp. subclade I (clade A) originated from Tanggamus (Lampung) and West Lampung (Lampung) separated with 2 species of Megophrys sp. of clade B originated from Pasawaran (Lampung). Keywords: 16s rRNA, Java, Megohprys , Sumatra, zoogeography

EFFECT OF DIFFERENT HUMAN MUSCLE TISSUE PRESERVATIVES ON QUALITY AND QUANTITY OF DNA: MEDICO LEGAL ASPECT

Background: Disaster victim identification (DVI) is a part of a collective response to mass disasters with the intention of identifying victims and body parts. Muscle tissue is sampled during DVI operations to identify victims by DNA analysis. Aim: To provide an effective field based method for preservation of DNA in human muscle tissues. Methods: A cross sectional comparative study was carried out on normal healthy human muscle tissues which were collected from patients admitted to Suez Canal University Hospital for surgical amputation of a part of limb. Muscle tissue was stored for 4 weeks in a number of preservatives at room temperature (15- 20°C). This process was repeated at 37°C to simulate the conditions expected during DVI operations in warm conditions. Samples were also stored at -20oC which represents the optimum storage condition used in many countries. Quantitative and qualitative analysis of DNA extracted from samples was done for each preservative during the 4 weeks. The study was conducted in the clinical pathology department in faculty of medicine-Suez Canal University, Ismailia, Egypt. Results: All preservatives could retain DNA up to the 4 weeks. Ethanol 70% (EtOH) gave the highest DNA concentration in both conditions (p value <0.001), followed by Dimethyl sulfoxide (DMSO) in room temperature and Sodium Chloride (NaCl) in 37 oC. All used preservatives did not show degradation in room temperature, while NaCl and Ethanol 70% showed degradation in DNA extracted in day 28 in 37 oC condition ( p value <0.001). Conclusion: DMSO is a successful method of preservation of DNA in human muscle tissue up to 4 weeks in both room temperature and 37 oC. While NaCl and Ethanol 70% are successful methods of preservation of DNA in muscle tissue up to 2 weeks only in 37 oC and up to 4 weeks in room temperature (15-20oC).

Assessing oral brushing technique as a source to collect DNA and its use in detecting human papillomavirus

Collecting buccal cell DNA has a number of advantages in terms of practicality and technical quality when employed for detecting human papillomavirus (HPV), arguably an important etiological factor for head and neck carcinomas. The objective of the present study was to assess oropharyngeal mucosa brushing as an effective method for collecting DNA samples and for detecting HPV. Forty-three female patients diagnosed with cervical intraepithelial neoplasia, and 21 of their spouses, both groups without clinically detectable oral lesions, were submitted to quantitative and qualitative DNA analysis obtained through buccal cell brushing, with spectrophotometry assessment and beta-globin PCR. DNA samples were also checked for the presence of HPV. Efficient collection of DNA was achieved in all the sample cases. Two samples, a male and a female (not sexual partners), showed HPV-positivity. The results revealed that the oral brushing technique is an effective method for DNA collection to detect HPV, confirming that it could usefully contribute to epidemiological studies undertaken in Brazil's Public Health System. HPV detection using PCR showed that only 3.12% of the cases were HPV-positive. Although the sample was small, our study nevertheless allowed the detection of HPV in DNA samples of oral biological material.

Pola Hasil Amplifikasi Partial Gen BMP-15 dan GDF-9 pada Sapi Bali

The aim of this research was to determine the polymorphisms of BMP - 15 and GDF-9 gene of Bali cattle. DNA was isolated from blood samples of six female cattles with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment BMP-15 gene was amplified using Forward (5’- AGTTTGTACTGAGCCGGTCT -3'), Reverse (5’- CTGACACACGAA GCGGAGT -3’), while to get DNA fragmen GDF-9 gene was amplified using Forward primer (5’-CAAGGAGGGGACCCCTAAAT-3’), reverse primer (5’- ACCAGAGGCTCAAGAGGAGC- -3’) for GDF-9 . The results of amplification showed 4 haplotypes for BMP-15 and GDF-9 gene. It was concluded that there is polymorphism of BMP- 15 and GDF- 9 gene of Bali cattle.

Identifikasi Polimorfisme Gen GDF-9 dan BMP-15 pada Kambing Kacang

The aim of this research was to determine the polymorphisms of BMP-15 and GDF-9 gene of Kacang goat. DNA was isolated from blood samples of five female goats with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment GDF-9 gene was amplified using Forward 5'-AGTTTGTACTGAGCAGGTCT -3 ', Reverse 5'-ACTCCGCTTCGTATGTCAG-3', while to get DNA fragmen BMP-15 gene was amplified using Forward primer 5’-CAAGGAGGGGACCCCTAAAT-3’, reverse primer 5’- ACCAGAGGCTCAAGAGGAGC-3 for GDF-9. The results of amplification was a specific DNA band with the length of 1400 bp for GDF-9 gene and 400 bp for BMP-15 gene. Restriction with HaeIII enzyme of GDF-9 PCR product was resulted a haplotype with fragment size 1100 bp, 300 bp, and 100 bp. While, restriction with AluI enzymes of BMP-15 PCR product was resulted a haplotype which consist of two fragments with sizes 180 bp and 120 bp. It was concluded that there are no polymorphism of GDF-9 and BMP-15 gene of Goat Beans.

Comparison of Accuracy on DNA Quantitation Determined by MALDI-TOF Mass Spectrometry and UV Spectrometry

ABSTRACT Although the UV absorbance of DNA at 260 nm has been recognized as a standard method for DNA quantitation, there are limitations of using UV spectrometry to determine the purity and identity of DNA. Recently, MALDI-TOF MS has proven to be an accurate technique for qualitative DNA analysis. In this study, the accuracy of MALDI-TOF MS for determining the concentration of DNA is evaluated and compared with that of the standard UV method. The results indicated that the accuracy of quantitative MALDI-TOF MS was comparable to that of the standard UV method and that measured DNA concentrations correlated well with those determined by the standard UV method.

Densitometric DNA analysis in agarose electrophoretic gels

Agarose gel electrophoresis is a basic separation tool used in molecular biology, mostly for qualitative DNA analysis. There are constraints limiting its use in quantitative analysis, namely low repeatability and a narrow linear range. However, by using an internal standard or internal normalization, repeatability and linear range could be significantly improved. In the work discussed in this paper it was shown that an approximately fivefold improvement in repeatability and an over threefold wider linear range could be achieved by applying internal normalization. Using the proposed approach, genetic markers, for example RAPD and PCR-RFLP, or even microsatellite markers, could be conveniently quantitatively assessed using agarose gel electrophoresis.

Quantitative Analysis of Circulating Plasma DNA as a Tumor Marker in Thoracic Malignancies

Increased plasma DNA has been found in cancer patients and may have potential as a tumor marker. The objectives of this study were to develop a controlled, quantitative PCR (QPCR) assay to measure plasma DNA and then evaluate plasma DNA concentrations as a tumor marker in patients with thoracic malignancies. We developed a QPCR assay for DNA, using the human beta-actin gene. Plasma samples were analyzed from 58 patients with esophageal cancer (EC; 20 banked samples and 38 prospectively collected samples) and 25 patients with lung cancer (LC; all prospectively collected). Control groups consisting of 51 patients with gastroesophageal reflux disease (GERD; 23 banked samples and 28 prospectively collected) and 11 healthy volunteers were also analyzed. The assay had an experimental variability <4%. In our banked samples, the mean concentration of plasma DNA in EC was 819.0 microg/L (range, 46.2-4738.0 microg/L) vs 432.0 microg/L (6.0-2888.0 microg/L) in GERD (P = 0.02). However, the prospectively collected samples had lower DNA concentrations, and there was no difference between cancer patients and controls. The mean DNA concentration was 10.6 microg/L (range, 7.0-14.0 microg/L) in healthy volunteers and 10.5 microg/L (range, 4.0-23.5 microg/L) in GERD controls vs 13.0 microg/L (range, 4.5-46.5 microg/L) in EC and 14.6 microg/L (range, 3.0-30.0 microg/L) in LC. Our data indicate that plasma DNA concentrations are of limited diagnostic value when samples are prospectively collected and uniformly handled. This is in contrast to previously published results. Qualitative analysis of DNA may be needed if plasma nucleic acids are to be used as a diagnostic tool in cancer screening.

Sulphur mustard induced DNA damage in mice after dermal and inhalation exposure

Sulphur mustard (SM) is a chemical warfare agent of the blistering agent category for which there is still no effective therapy. SM, being a strong electrophile, readily reacts with a wide range of cellular macromolecules including DNA, RNA and protein. Since the main intoxication routes for SM are inhalation and dermal penetration, in the present study we have exposed female mice to different concentrations of SM by dermal and inhalation exposures and estimated the DNA damage in different organs viz., liver, lung, spleen and thymus. SM was applied at 38.7, 77.4, 154.7 mg/kg body weight, on the hair-clipped skin (dermal exposure) equivalent to 0.25, 0.5 and 1.0 of the LD 50. Inhalation exposure was carried out at 10.6, 21.2 and 42.3 mg/m 3 for 1 h duration equivalent to 0.25, 0.5 and 1.0 LC 50. SM induced a dose-dependent DNA damage in all the organs except the lung in dermal exposure. Similarly the inhalation exposure resulted in dose- and time-dependent effect in all the organs including lung. By both routes of exposure liver was the most affected organ followed by spleen, thymus and lung in decreasing order. The quantitative data were corroborated by qualitative analysis of DNA on agarose gel electrophoresis. The genomic DNA analysis of the organs had revealed random nuclear DNA fragmentation resulting in a ‘smear’ typical of necrotic form of cell death. Since DNA damage is not reversible especially in liver, this can be used as a marker for SM exposure through either the dermal or inhalation route.

Brefeldin A-induced apoptosis in prostatic cancer DU-145 cells: a possible p53-independent death pathway.

To investigate the growth inhibitory mechanism of brefeldin A (BFA), an antiviral antibiotic, in androgen-independent prostatic cancer DU-145 cells. The inhibitory effects of BFA (30 ng/mL) on cell growth were monitored by cell counting and viability tests after specified exposures. Flow cytometry and western immunoblot analysis were performed to examine the effects of BFA on the cell cycle and on specific growth regulators. The possible induction of apoptosis by BFA was further assessed by in situ hybridization (ISH) assay and by qualitative DNA analysis using agarose-gel electrophoresis. Cell growth was completely inhibited with BFA (30 ng/mL), accompanied by 40-50% cell death. Cell cycle analysis revealed that this growth inhibition coincided with an 85% reduction in the S-phase cell population. Western blots showed that the expression of cell cycle-dependent kinases (cdk2 and cdk4), cyclin D1 and p53 was significantly reduced, while WAF1 was increased, after BFA treatment. Apoptosis was confirmed by both the ISH assay, which showed the characteristic brownish staining of BFA-treated cells, and by DNA analysis, which revealed the internucleosomal DNA ladder. BFA-induced growth inhibition in DU-145 cells is primarily due to the modulation of specific G1 cell-cycle regulators, blocking the G1-S phase progression. Such a growth arrest ultimately results in apoptosis, presumably through a p53-independent pathway.

Murine peritoneal macrophages treated with cisplatin and interferon-gamma undergo NO-mediated apoptosis via activation of an endonuclease.

We investigated whether murine peritoneal macrophages treated with cisplatin or interferon (IFN)-gamma alone, or in combination, could undergo apoptosis, and whether this results either from the cytotoxic effect of the activating agents or indirectly in an autocrine manner by the cytotoxic molecules released by them upon activation. Our data suggest that cisplatin, which has been shown to induce apoptosis in a number of normal as well as tumor cell types, did not induce apoptosis in murine peritoneal macrophages nor was apoptosis caused by IFN-gamma. However, combined treatment with cisplatin and IFN-gamma induced apoptosis in macrophages as studied by percent DNA fragmentation assay, qualitative analysis of DNA on agarose gel electrophoresis, and morphological and nuclear alterations studied by phase contrast and fluorescence microscopy. The factor responsible for inducing apoptosis in macrophages was found to be a higher concentration of NO produced by them upon activation with cisplatin and IFN-gamma. Macrophages treated with cisplatin or IFN-gamma alone produced a low level of NO and did not undergo apoptosis. The inhibitor of NO synthase, L-NMMA, prevented apoptosis in macrophages treated with cisplatin and IFN-gamma, suggesting the involvement of NO in the induction of apoptosis in macrophages. The role of NO in inducing apoptosis in macrophages was further confirmed by the observation that direct treatment with sodium nitroprusside, a NO donor, resulted in apoptosis in macrophages. We have also shown that NO-induced apoptosis in macrophages activated with cisplatin and IFN-gamma requires activation of an endonuclease, as the endonuclease inhibitor, aurine tricarboxylic acid, prevented apoptosis in them.

Quantitative and qualitative analysis of DNA extracted from postmortem muscle tissues

DNA extracted from 33 postmortem muscle specimens was analyzed using MZ 1.3, a hypervariable minisatellite probe, as well as locus-specific minisatellite probes (g3, MS1 and MS43). After storage at -25 degrees C for 10 months, DNA from all the samples was partially (approximately 21% of total DNA) degraded even when autopsy was performed 1 day postmortem. However, more than 90% of DNA samples up to at least 3 days postmortem were suitable to obtain good restriction fragment length polymorphism (RFLP) patterns. When small strips of specimen were stored for 8 days at room temperature in moist chambers, approximately 42% of total DNA was degraded. Only 30% of these DNA samples still showed good RFLP patterns. However, no obvious relation between qualities of DNA analyzed by detection of RFLP and quantities of total and high-MW DNA became apparent. A case of familial relationship was ascertained by DNA fingerprints. Since DNA of good quality can be recovered from muscle tissues in large quantities, DNA extraction from muscle tissues and detection of RFLP patterns should be very useful for individual identification in autopsy cases.

Quantitative and qualitative analysis of DNA extracted from postmortem muscle tissues

DNA extracted from 33 postmortem muscle specimens was analyzed using MZ 1.3, a hypervariable minisatellite probe, as well as locus-specific minisatellite probes (g3, MS1 and MS43). After storage at −25°C for 10 months, DNA from all the samples was partially (approximately 21% of total DNA) degraded even when autopsy was performed 1 day post mortem. However, more than 90% of DNA samples up to at least 3 days post mortem were suitable to obtain good restriction fragment length polymorphism (RFLP) patterns. When small strips of specimen were stored for 8 days at room temperature in moist chambers, approximately 42% of total DNA was degraded. Only 30% of these DNA samples still showed good RFLP patterns. However, no obvious relation between qualities of DNA analyzed by detection of RFLP and quantities of total and high-MW DNA became apparent. A case of familial relationship was ascertained by DNA fingerprints. Since DNA of good quality can be recovered from muscle tissues in large quantities, DNA extraction from muscle tissues and detection of RFLP patterns should be very useful for individual identification in autopsy cases.