Pygmy Populations Research Articles

Population affinities in pre-colonial West Africa: The case of the burial cave Iroungou (Gabon, 14th-15th century CE).

Our knowledge of the populations of sub-Saharan Africa in the periods before European colonization is limited. Few archeological sites containing human remains have been identified, and written sources for these periods are rare. The discovery in 2018 of the Iroungou sepulchral cave (Gabon), whose use predates the arrival of the Portuguese (14th-15th centuries CE), is an exceptional source of information: at least 28 individuals associated with numerous metal artifacts were found there. The anthropobiological remains were left in situ, but the eight best preserved crania were digitized. This study focuses on the population affinities of these crania, whose morphology was described using 237 landmarks. Geometric morphometric analyses were used to compare the eight Iroungou specimens with 154 individuals representing 12 well-defined African populations. After alignment (Generalized Procrustes Analysis), morphological affinity was assessed using Euclidean and Mahalanobis distances, and posterior probabilities of population membership (discriminant analysis). Results indicate that the eight Iroungou crania have, on average, more affinity with Bayaka Pygmy, followed by Central African Bantu. Nevertheless, individually, the Iroungou specimens show an important morphological variation and the eight crania can be separated into different affinity groups: Bayaka and Central African Bantu, KhoeSan, and East-African Bantu. Finally, one individual presents strong affinity with Somalis. This phenetic mapping of the Iroungou sample raises questions about the profile of the individuals deposited in the cave in a geographical area known for the Loango pre-colonial kingdom, which ruling class seemed to have had privileged relationships with the Pygmy populations.

Population structure and genetic diversity of the threatened pygmy newt Triturus pygmaeus in a network of natural and artificial ponds

Pond physical characteristics (connectivity, hydroperiod) have shown to be highly relevant in explaining species presence, reproductive success, and survival in breeding-pond amphibians. However, few studies have addressed the influence that these factors may have on the genetic variability of pond populations. We examined genetic variation at 11 microsatellite loci in Iberian endemic, the pygmy newt (Triturus pygmaeus), from 58 breeding ponds in the Doñana National Park (Andalusia), including both temporary ponds and artificially deepened ponds that remain wet during the whole year. Temporary ponds are located in the North part of the region where the surrounding habitat-wet meadows-facilitates the connectivity among populations, whereas the deepest ponds (‘zacallones’) are located in the southern edge embedded in a matrix of unsuitable habitat (thickets and dry underbrush). We investigated genetic diversity and structure within and among ponds. Our results show that both regions (Doñana-North and Doñana-South) are well-differentiated and form two main clusters. We found higher genetic diversity within ponds from the North region, which also exhibited a higher degree of genetic admixture in comparison with populations from the southern edge. Although we found an isolation-by-distance pattern within each cluster, it arose due to the effect of a few isolated ponds located on the edge of each zone, suggesting the existence of substantial gene flow between ponds in the core area. According to our findings, landscape’s permeability to movement (pond connectivity) may constitute a more important factor than hydroperiod length in determining the genetic diversity and viability of pygmy newt populations in this area. Although Doñana populations show a good state, more peripheral and isolated populations present a more worrisome condition as a result of fragmentation and thus, require conservation efforts. Our study provides key insights that could help guide management practices of this threatened and poorly-studied salamander.

The COVID-19 Pandemic Endangers Africa's Indigenous Pygmy Populations.

Forest-dependent populations are affected by environmental pressures that include deforestation and forest degradation. Their lives and livelihoods have also been transformed by political decisions in the countries where they live. In Africa, the Pygmy peoples living in the dense tropical forests (4 million km2) that span west–east along the central African belt of the Congo Basin are made up of genetically and ethno-linguistically distinct groups (Bahuchet 2014). They are broadly subdivided into western groups, including Baka and Aka, and eastern groups including Mbuti, Efe, and Asua. All have a similar way of life associated with forest hunting and gathering even though some have taken up some form of agriculture. Additionally to their mode of subsistence, they share distinctive cultural and phenotypic traits such as the “Pygmy phenotype” of small adult body size (Perry and Dominy 2009). The demographic and evolutionary split between Pygmy and non-Pygmy populations is amongst the oldest for modern humans with the divergence estimated from genetic data to be roughly between 60,000 and over 100,000 years ago and the split between Western and Eastern Pygmy groups about 20,000 years ago (Hsieh et al. 2016). The Baka in south-eastern Cameroon, formerly strict hunters-gatherers, still practice a subsistence economy, but also maintain a close association with sedentary Bantu-speaking swidden agriculturalists with whom they have a complex social, economic, and symbolic relationship (Joiris 1998). Although less isolated than other Pygmy groups, especially the Mbuti and Efe, the Baka, like other forest-dependent populations in the Congo Basin, have been affected by a plethora of environmental pressures that include direct impacts from extractive industries (logging, mining), conflict with conservation areas, encroachment into their territories both peacefully along roads or aggressively by poachers and militias, as well as the effects of resettlement and sedentarization (Olivero et al. 2016). Such combination of threats impacts their health and food security. Currently, COVID-19 has reached Africa though apparently with an overall surprisingly low prevalence and mortality (Mbow et al. 2020). We argue that Pygmy communities may be silently ravaged by the disease yet there is a lack of policies or initiatives to monitor their health systematically throughout the Congo Basin. Understanding the impact of COVID-19 on these forest-dependent peoples has never been more important to develop ways of helping them.

Phenotypic diversity and history of the Congo Basin populations: Equatorial Guinea, Bantu Speaking Central Africans and African Pygmies

Background African Pygmy Populations (APP) are believed to be one of the first groups of the Congo Basin rainforest peoples to separate from the rest of modern humanity. The arrival of Bantu speaking agriculturalists from 5,000 BP led to the formation of a large number of ethnic complexes in Central Africa and the Atlantic coastal area, mainly due to a one-way flow of pygmy women. There are now only a few small contingents of African Pygmy population groups who are mixed or who have almost disappeared as a result of migratory flows from Cameroon. Aims We analysed the adult phenotypic diversity of 9 populations (17 groups of both sexes) of the Congo basin and Bioko Island, which were anthropometrically characterised in 1948. The phenotypic clusters that we detected, which we interpret as likely mixing of local Pygmy populations and Bantus, may be useful as references for future studies, particularly genetics. Subjects and methods The matrix of inter-distances between populations was generated, using the 21 variables, with the Euclidean distance between the mean vectors relating to the standardised variables. When the UPGMA (Unweighted Pair Group Method with Arithmetic Mean) was used separately in men and women, the phylogenetic trees showed a clear separation between populations. Results The body measurements that most effectively distinguished the groups are linear dimensions and the width of the hips and mean thoracic circumference. In this study, the cephalo-facial dimensions were of little value in identifying the groups. Conclusions The samples of Equatorial Guinea show a major inter-group overlap, and considerable intra-group variations. There are also notable differences amongst African Pygmy populations in terms of height, but not in body proportions.

Association between APOEε4 genotype and cardiovascular risk factors in Mexican elderly adults with amnestic and non‐amnestic mild cognitive impairment

AbstractBackgroundThe prevalence of mild cognitive impairment (MCI) is 14 to 18%. MCI has been associated with cardiovascular risk factors. Likewise, the APOEε4 genotype is a gene that confers susceptibility to Alzheimer’s disease. However, the association between APOE genotype, cardiovascular risk and MCI in the Mexican population is not clear, probably as a result of genetic heterogeneity.MethodWe included patients from memory clinic (INCMNSZ) from 2017 to 2019, > 70 years. Three groups were studied: controls without cognitive impairment, with amnestic and nonamnestic MCI. Parametric and nonparametric statistics (x2, ANOVA, multivariate logistic regression analysis, Kruskal‐Wallis) were used for the analysis of statistical differences between groups.Result131 patients were studied, 67.9% were women, the average age was 73.6 (SD 7.3) and the educational level was 12.62 (SD 4.98). Regarding the APOE genotype, 93 (71%) were e3 / e3, 35 (26.7%) e3 / e4, 3 (2.3%) e4 / e4. Three groups of cognitive function were formed: cognitively healthy controls: 59 (45%), amnestic MCI: 29 (22.1%) and nonamnestic MCI: 42 (32.1%). In the group with nonamnestic MCI, statistically significant differences were found in dyslipidemia 48% (P = 0.014), history of CVD 16.5% (P = 0.033) and anemia 8% (0.034). For the group with amnestic MCI, 44.4% hypothyroidism was found (p = 0.15). The multivariate logistic regression analysis showed that the APOE genotype did not significantly modify the association with cardiovascular risk factors and MCI. A greater effect on motor executive function was found in the group of carriers of the APOEε4 genotype (p = 0.042)ConclusionOur study found a low frequency of APOE ε4, compared to African or European populations (Pygmy population, khoisan, waiwai) where the frequency is high (possibly related to race). Previous studies have shown an association between cardiovascular risk and cognitive risk in patients with APOE ε4, however, our study does not show an association between the state of APOE and risk for cognitive impairment, possibly related to variability genetics of the Mexican population, as well as the existence of possible polymorphisms not described in this population. Few studies have shown the association between APOE ε4 polymorphism, hypothyroidism and amnestic DCL.

Study of traditional mycological knowledge of Pygmy and Bantu populations of Ogooué-Ivindo (Northeast of Gabon), Central Africa

This article presents a comparative table of traditional mycological knowledge of Pygmy and Bantu populations of Ogooué-Ivindo (northeast of Gabon). An ethnomycological investigation was carried out in five villages of this province, to Pygmy (Baka) and Bantu (Kota and Kwélé) populations. The results of this study showed that traditional mycological knowledge of these populations varies according to ethnolinguistic membership, age and practiced activity. Bakoya Pygmies, who identified 93% of total species, got the best fungi knowledge than Kota (60%) and Kwele (33%). However, there was no significant difference between the sex as regards traditional mycological knowledge within the same ethnic group. Concerning age groups, active population representatives (26-60 years) who identified all the inventoried species and young people (10-25 years) who identified 67% of species had better fungi knowledge than senior citizens (> 60 years old) who identified only 40% of inventoried species. About activities practiced by respondents, our results distinguish three homogeneous groups; the first made up of hunters who have the best traditional mycological knowledge (93% of identified species), followed by fishermen and farmers (67-73% of identified species) and the last group is made up of pupils who manage to barely identify inventoried species.

Study of traditional mycological knowledge of Pygmy and Bantu populations of Ogooué-Ivindo (Northeast of Gabon), Central Africa.

Study of traditional mycological knowledge of Pygmy and Bantu populations of Ogooué-Ivindo (Northeast of Gabon), Central Africa.

Colonization dynamics of Streptococcus pneumoniae in a remote African population: A prospective cohort study

The aim of this study was to analyze the population dynamics of Streptococcus pneumoniae in a remotely living African Pygmy population. The same pygmy population (Gabon) was prospectively screened for nasopharyngeal S. pneumoniae colonization in 2011 (n = 103), 2013 (n = 104) and 2017 (n = 107). Non-duplicate isolates (n = 126) were serotyped and tested for antimicrobial resistance (broth microdilution). At the three sampling time points, resistance rates were highest for tetracycline (36–58%), followed by penicillin (parenteral, meningitis-breakpoints, 6–39%) and chloramphenicol (3–15%). The majority of isolates was non-typeable (NT, n = 18/126, 14.3%) followed by serotype 6B (n = 17/126, 13.5%), 21 and 15A (n = 9/126, 7.1%, each). The distribution of serotypes was highly dynamic as only three serotypes (14, 17F, NT) were detected during all three visits. Resistance rates and serotypes of nasopharyngeal S. pneumoniae markedly changed in the remote Babongo population. This rapid change in serotypes could challenge the selection of pneumococcal vaccine.

Divergent Trajectories of BMI over Age for Adult Baka Pygmy People and their Sympatric Non-Pygmy Populations

Differences in socioeconomic conditions and health have been reported for African Pygmies and their sympatric populations of other ethnic groups. We collected anthropometric data in southern Cameroon from Baka and their Bantu neighbours, and also extracted data from the five available and representative Demographic and Health Surveys (DHS) in sub-Saharan African countries that have Pygmy populations..Our results show that the Baka exhibited a weak but significant decline of body mass index (BMI) with age (p = 0.003) without a sex difference. At a larger geographical scale, all five DHS surveys revealed flat or negative slopes for Pygmy BMI with age. Except for one non-Pygmy ethnic group, the slope was less than for all DHS- surveyed non-Pygmy African ethnicities. Pygmy populations were the least wealthy in all surveys, but no pattern for anaemia levels versus BMI emerged. We argue that the declining or stagnant trajectory of Pygmy BMI over age is most concerning, since this sets them apart not only from all other ethnic groups in the region, but from the general trend of increasing body weight over age. We suggest that our results do not reflect the influence of ethnicity per se, but the fact Pygmy populations are socially and materially deprived groups. These findings are fully aligned with the extraordinary high premature death rate among the Baka and need to be addressed for sustainable development initiatives to be effectively implemented.

Is the HERV-K HML-2 Xq21.33, an endogenous retrovirus mutated by gene conversion of chromosome X in a subset of African populations, associated with human breast cancer?

The human endogenous retroviruses HERV-K HML-2 have been considered a possible cause of human breast cancer (BrC). A HERV-K HML-2 fully intact provirus Xq21.33 was recently identified in some West African people. We used PCR technology to search for the Xq21.33 provirus in DNA from Nigerian women with BrC and controls. to see if Xq21.33 plays any role in predisposing to BrC. This provirus was detected in 27 of 216 (12.5%) women with BrC and in 22 of 219 (10.0%) controls. These results were not statistically significant. The prevalence of provirus in premenopausal control women 44 years or younger [18/157 (11.46%)} vs women with BrC [12/117 (10.26%)] showed no statistical difference. The prevalence of virus in postmenopausal control women > 45 yrs. was 7.4% (4/54) vs 15.31% (15/98) in postmenopausal women with BrC. These changes were not statistically significant at <.05, but the actual p value of <.0.079, suggests that Xq21.33 might play some role in predisposing to BrC in postmenopausal women. Provirus was present in Ghanaian women (6/87), in 1/6 Pygmy populations and in African American men (4/45) and women (6/68), but not in any Caucasian women (0/109). Two BrC cell lines (HCC 70 and DT22) from African American women had Xq21.33. Env regions of the virus which differed by 2–3 SNPs did not alter the protein sequence of the virus. SNP at 5730 and 8529 were seen in all persons with provirus, while 54% had an additional SNP at 7596.Two Nigerian women and 2 Ghanaian women had additional unusual SNPs. Homozygosity was seen in (5/27) BrC and (2/22) control women. The genetic variation and homozygosity patterns suggested that there was gene conversion of this X chromosome associated virus. The suggestive finding in this preliminary data of possible increased prevalence of Xq21.33 provirus in post-menopausal Nigerian women with BrC should be clarified by a more statistically powered study sample to see if postmenopausal African and/or African American women carriers of Xq21.33 might show increased risk of BrC. The implication of finding such a link would be the development of antiretroviral drugs that might aid in preventing BrC in Xq21.33+ women.

Tooth dimensions and body size in a Pygmy population

Background: The relationship between tooth size and stature has been analysed extensively at the interspecies level but has received less attention at the intraspecies level. The relationship between these two parameters does not seem to be the same among modern human populations.Aim: The aim of this study is to analyse the relationship between tooth dimensions and body measurements in the Baka Pygmies.Subjects and methods: Height, weight, and tooth dimensions were obtained for 45 adult Baka females and 17 males from Le Bosquet (Cameroon). Correlations were obtained between the variables and compared to results for other human populations.Results: The Baka population is distinctive in the small number of significant correlations. Only two buccolingual diameters among Baka females show any significant correlation with height. The lack of significant correlations between tooth dimensions and body dimensions among the Baka means that changes in body size are accompanied by random variations in tooth dimensions.Conclusion: The absence of correlations may be accounted for by the impact of environmental effects on the somatic growth of the Baka producing a Pygmy phenotype adapted to live in the forest. It is worth noting that many correlations become significant when sexes are pooled.

PF-3 Is nigerian breast cancer associated with endogenous retrovirus Xq21.33?

Background: Wildschutte et al recently discovered a new HERV K HML-2 (HK2) endogenous retrovirus Xq21.33 (NCBI GenBank accession no. KU054272) to be uncommonly present in Pygmy populations and in Nigerian people in Africa (&lt;4%). It has been estimated that this virus has been inserted in the human genome between ∼0.67–1.3 Mya and possibly earlier. Since this virus is fully intact and is similar to mouse mammary tumor virus, we looked to see if it is associated with breast cancer in Nigerian populations. Methods: Peripheral blood mononuclear cells were obtained with informed consent from Nigerian women with breast cancer (BCa) (237) and matched controls (225) without BCa. Samples from the United States included samples from a BCa study and HIV study carried out earlier. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Samples were tested for the Xq21.33 virus using primer Xq21.33R2 ACGCTGTTTTGTCCCTTTGA and K1011 CGTCGACTTGTCCTCAATGACCACGCT to screen samples, and primers 1584R TTTGCGTTGACTGAGCCATTACCG, 2499R TTG AGC AAC ATC TTG GAG CCT TGC, 3460R ACTTGCCCAATATGCAGCCTTTCCTCC, 6115R TCAACTATGGCCTGTCCTTGC, F Flank TCAGTCTGAAGACAATGACATACT T and 5359F TCGGCTCAAAGAGCAGAGATGGTT to confirm positive samples. Samples were tested using the Long Amp PCR kit (New England Bio Labs) conditions suggested by the manufacturer using a total volume of 25ul. Hetero vs Homozygosity was determined using F Flank and Xq21.33R2 with Platinum taq Hi Fi Thermo Fisher also using conditions suggested by the manufacturer. Samples with adequate DNA were tested using primer K1011 and Xq21.1R2. Positive samples were all confirmed using Xq21.33R2 to 1584R, 2499R, 3460R and 5359F to F Flank. One batch of samples did not yield good quality DNA and some samples had such low yields of DNA that the data on these patients was not included in this study. Results: We detected 28/220 (12.7%) positive samples in women with BCa vs 23/236 (9.7%) in women without BCa. These differences were not statistically significantly different. 5/28 women with BCa (ages 38, 44, 50, 53, 82) vs 2/23 (ages 32, 58) normal women were homozygous for Xq21.33. As shown below women with BCa and virus were more likely to be post-menopausal (46%) than women without BCa and virus (8.7%). Similarly women with BCa and no virus were also more likely to be post-menopausal 35% vs women with no BCa and no virus 19.7%. There was not enough power in this study to determine if the virus is contributing to more cases of post-menopausal breast cancer in positive women. Among women who are older than 47 years, the proportion of virus xq21.33 positives is higher among women with BCa (14.9%) than women without BCa (5.13%), but it is not significant (P-value = 0.15) [see below] Virus xq21.33 in cases and controls in age groups &gt;47 years n = 126. Among women who are 47 years or younger, the proportion of virus xq21.33 is lower among women with BCa (10.07%) than women without BCa (12.21%), but it is not significant (P-value = 0.60). Virus xq21.33 in cases and controls in age groups &lt;47 years n = 321. We also tested for Xq21.33 in the following USA samples: Conclusions: Our sample size does not provide sufficient power to see if Xq21.33 presents an increased risk for breast cancer. However, the trend too increased risk in virus positive women 12.7% vs 9.7% in controls, and the increase in numbers of women &gt;47 year with +BCa +virus (46.4%) vs the +BCa −virus (35.6%), and the striking low numbers of women in −BCa +virus (8.7%) vs (19.7%) in −BCa −virus and greater homozygosity in +Bca +virus women suggests differences which may be caused by carrying this provirus. We suggest designing trials with adequate sample sizes of virus+ and − young women without BCa to assess the future risk of cancer from this provirus. We are now sequencing the env gene to see if women with BCa have a more replicative competent virus. We are gathering pathological data to see if +women have different forms of BCa than –women. This virus may be still present in Nigerian rodent and primate populations and should be searched for in these animals. It may still infect people contributing to BCa without becoming endogenized. It could be detected by deep sequencing DNA from BCa tissue looking for integrated Xq21,33 in other sites than the X chromosome. Molecular clones and more cell lines, like DT22, should be established from BCa+ Virus+ to look for replicative virus with alternative integration sites. Virus should be searched for in HIV+ Nigerians to see if it contributes to other neoplasms. The discovery of a human BCa virus would present a new way of treating or preventing breast cancer using antiretrovirals.

A16055 Hypertension and associated risk factors in rural and urban pygmies of southern region cameroon

Objectives: Determine the prevalence of hypertension and associated risk factors in adult pygmy and Bantu populations in rural and urban areas of southern Cameroon region Methods: This was a cross-sectional study carried out on pygmies 100 traditional pygmies 100 traditional Bantus (TB), and 100 contemporary pygmies (CP) and 100 contemporary Bantus (CB) both sharing the same urban environment located in south region Cameroon. We recorded in all participants’ lifestyle and socio-demographic data, and clinical parameters. Results: Pygmy participants were younger than Bantus (38 ± 16 vs 45 ± 17 years, p = 0.0001). In the whole study population, the prevalence of hypertension was 14.5%. Age-adjusted prevalence of hypertension was lower in pygmies than Bantus globally (7.5% vs 21.5% p = 0.0001),even in both areas:4% vs 19 in rural; and 11% vs 24 % in urban, respectively, both p < 0.01). In pygmy participants taken separetely, the age-adjusted prevalence of hypertension was greater in CP than in TP (11% vs 4%,). Age-adjusted SBP and DBP were higher in Bantus than pygmies, p < 0.0001, but the within group difference was not significant. In the whole study population, multivariate logistic regression analysis revealed that hypertension was independently associated with urban area (OR = 2.15,95%CI:1.14–4.05), Bantu status (OR = 2.17, 95%CI:1.09–4.34), age ≥ 50 years (OR = 2.15, 95%CI:1.14–4.05), and abdominal obesity (OR = 0.20 95%CI:0.09–0.46) (all p < 0.05). In pygmy group taken separately, in multiple logistic regression analysis age ≥ 50 years (OR = 3.83, CI95%: 1.33–11.36) and urban city (OR = 3.33, CI95%: 1.04–11.11) (both p < 0.05) appeared as independent determinant of hypertension. Conclusion: Our study reveals that hunter-gatherer subsistence mode is associated with lower prevalence of hypertension as illustrated in TP.

Estimation of parameters in a closed pygmy population in Cameroon

Estimation of parameters in a closed pygmy population in Cameroon

Evolutionary history and adaptation of a human pygmy population of Flores Island, Indonesia.

Flores Island, Indonesia, was inhabited by the small-bodied hominin species Homo floresiensis, which has an unknown evolutionary relationship to modern humans. This island is also home to an extant human pygmy population. Here we describe genome-scale single-nucleotide polymorphism data and whole-genome sequences from a contemporary human pygmy population living on Flores near the cave where H. floresiensis was found. The genomes of Flores pygmies reveal a complex history of admixture with Denisovans and Neanderthals but no evidence for gene flow with other archaic hominins. Modern individuals bear the signatures of recent positive selection encompassing the FADS (fatty acid desaturase) gene cluster, likely related to diet, and polygenic selection acting on standing variation that contributed to their short-stature phenotype. Thus, multiple independent instances of hominin insular dwarfism occurred on Flores.

Systematic detection of positive selection in the human-pathogen interactome and lasting effects on infectious disease susceptibility.

Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS) to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV) 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS), providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.

East Urals Radioactive Trace: Dose-dependent functional-metabolic effects in the myocardium of the pygmy wood mouse (Apodemus uralensis) taking into account population size

The population dynamics, radiometric data and biochemical parameters (concentrations of total lipids, proteins, DNA and RNA, activity of succinate dehydrogenase, glucose phosphate isomerase and catalase, as well as lipid peroxidation level) in the myocardium of the pygmy wood mouse (Apodemus uralensis Pall., 1811) inhabiting the area of the East Urals Radioactive Trace (EURT) were analyzed. The functional-metabolic radiation effects as a result external and internal exposure to 137Cs and 90Sr (unweighted total dose rate 0.04–0.5 mGy/day) are characterized by a reduction in lipid catabolism, mitochondrial oxidation and antioxidant defense, as well as the activation of anaerobic glycolysis as well as the protein-synthesizing and genetic apparatus. The data indicate the low efficiency of cell energy production and allow us to state that compensatory myocardial hypertrophy can improve myocardial contractile function. The level of the functional-metabolic response in pygmy wood mice in the EURT area increased with increasing whole-body radiation dose rate and was more pronounced with a large pygmy wood mouse population size. The harmful effects (cardiac decompensation stage) of synergies resulting from non-radiation and radiation factors manifest after population abundance above 30 ind./100 trap-day and a radiation burden above 0.1 mGy/day.

Differences between Pygmy and Non-Pygmy Hunting in Congo Basin Forests.

We use data on game harvest from 60 Pygmy and non-Pygmy settlements in the Congo Basin forests to examine whether hunting patterns and prey profiles differ between the two hunter groups. For each group, we calculate hunted animal numbers and biomass available per inhabitant, P, per year (harvest rates) and killed per hunter, H, per year (extraction rates). We assess the impact of hunting of both hunter groups from estimates of numbers and biomass of prey species killed per square kilometre, and by examining the proportion of hunted taxa of low, medium and high population growth rates as a measure of their vulnerability to overhunting. We then map harvested biomass (kg-1P-1Yr-1) of bushmeat by Pygmies and non-Pygmies throughout the Congo Basin. Hunting patterns differ between Pygmies and non-Pygmies; Pygmies take larger and different prey and non-Pygmies sell more for profit. We show that non-Pygmies have a potentially more severe impact on prey populations than Pygmies. This is because non-Pygmies hunt a wider range of species, and twice as many animals are taken per square kilometre. Moreover, in non-Pygmy settlements there was a larger proportion of game taken of low population growth rate. Our harvest map shows that the non-Pygmy population may be responsible for 27 times more animals harvested than the Pygmy population. Such differences indicate that the intense competition that may arise from the more widespread commercial hunting by non-Pygmies is a far more important constraint and source of conflict than are protected areas.

THE PYGMY MIMIC

ABSTRACTThe Pygmy mimic is an extremely persistent colonial trope that continues to inform contemporary anthropological understandings of Africa's Pygmy populations. Mimicry is now understood as being a key component of the social reproduction of a distinct Pygmy way of being. In this paper I examine the historical accounts of mimicry and try to bring a historical perspective to bear on contemporary ethnographic accounts of its practice. I also set my own research among the Sua Pygmies of Uganda against these other examples. The intention behind this is to acknowledge the common humanity of Africa's Pygmies and to create new grounds of comparison – such as a shared history of oppression – that are not dependent on a unique foraging mode of thought.

High prevalence of IgG antibodies to Ebola virus in the Efé pygmy population in the Watsa region, Democratic Republic of the Congo.

BackgroundFactors related to the natural transmission of Ebola virus (EBOV) to humans are still not well defined. Results of previous sero-prevalence studies suggest that circulation of EBOV in human population is common in sub-Saharan Africa. The Efé pygmies living in Democratic Republic of the Congo are known to be exposed to potential risk factors of EBOV infection such as bush meat hunting, entry into caves, and contact with bats. We studied the pygmy population of Watsa region to determine seroprevalence to EBOV infection and possible risks factors.MethodVolunteer participants (N = 300) aged 10 years or above were interviewed about behavior that may constitute risk factors for transmission of EBOV, including exposures to rats, bats, monkeys and entry into caves. Samples of venous blood were collected and tested for IgG antibody against EBOV by enzyme-linked immunosorbent assay (ELISA). The χ2-test and Fisher’s exact test were used for the comparison of proportions and the Student’s t-test to compare means. The association between age group and anti-EBOV IgG prevalence was analysed by a nonparametric test for trend.ResultsThe prevalence of anti-EBOV IgG was 18.7 % overall and increased significantly with age (p = 0.023). No association was observed with exposure to risk factors (contacts with rats, bats, monkeys, or entry into caves).ConclusionsThe seroprevalence of IgG antibody to EBOV in pygmies in Watsa region is among the highest ever reported, but it remains unclear which exposures might lead to this high infection rate calling for further ecological and behavioural studies.Electronic supplementary materialThe online version of this article (doi:10.1186/s12879-016-1607-y) contains supplementary material, which is available to authorized users.