Coat Protein Research Articles

The first report of cotton leafroll dwarf virus infecting upland cotton plants in Arizona.

Cotton leafroll dwarf virus (CLRDV) represents a persistent threat to cotton production in the United States (U.S.) (Edula et al. 2023). Initially detected in Alabama (Avelar et al. 2019), CLRDV occurs in almost all the states in the U.S. cotton belt, extending from Virginia through Texas. The symptoms associated with CLRDV includes interveinal chlorosis, leaf rolling, stunting, and reduced boll sets. However, asymptomatic CLRDV-infected plants have also been reported (Edula et al. 2023). In the 2023 growing season, upland cotton plants (Gossypium hirsutum) presenting terminal splitting symptoms in the blooming stage were observed in a commercial field in Pinal County, Arizona, at 60% incidence. To evaluate if CLRDV may be associated with these symptoms, young fully expanded terminal leaves were collected from 20 symptomatic and ten asymptomatic plants. Moreover, ten samples were collected from a second asymptomatic block in the same field. Samples were shipped on dry ice to Cornell University in hermetic bags under APHIS PPQ permit 526-23-256-14384. Midribs and petioles were used to extract total nucleic acids from each sample using OPS Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics) per the manufacturer's instructions. Complementary DNA (cDNA) was synthesized using an iScript Reverse transcriptase kit (BioRad) and used for the detection of a partial sequence of the coat protein (CP) of CLRDV using PCR assays as described previously (Mahas et al. 2022). The expected 309-bp product was obtained from only one symptomatic sample. CLRDV presence in the samples was further evaluated using CLRDV-specific primers targeting the RNA-dependent RNA polymerase (RdRp) gene. Primers CLRDV-Pol_innerF1 (5'- ACCCTCCAAGGAACAGAG -3') / R1 (5'- CGAATAATCTGATYGGGTCAC -3') and CLRDV-Pol_outerF1 (5'- AACGCGCCCAGTCCGCACAAATACC-3') / R1 (5'-ACCGGGTTTACTGGGGATTGCACGC-3'), designed based on virus isolates available in GenBank as of September 2022, were used to implement a single-tube nested RT-PCR as detailed by Dey et al. (2012) and to index the presence of CLRDV in all the samples. Two additional symptomatic samples and three asymptomatic samples (two from field one and one from field two) were positive for the virus. Direct Sanger sequencing of the one CP and two RdRp amplicons from symptomatic and asymptomatic samples (PP482918-20) demonstrated they shared >99% nucleotide identity to an isolate from South Carolina (OQ300129). To further evaluate the presence of CLRDV in Arizona, we performed double antibody sandwich (DAS)-ELISA on midrib and petiole samples using camelid single-chain antibodies against the CP as the capture antibody (Filed Patent 18/436,287) and the commercially available Anti-PLRV conjugate (Agdia, Elkhart, IN) as the secondary antibody. DAS-ELISA detected CLRDV in eight symptomatic and three asymptomatic samples, with the positive and negative controls testing positive and negative, respectively. Considering all the diagnostic approaches, ten symptomatic and five asymptomatic samples were positive for CLRDV (Table S1). To the best of our knowledge, this is the first report of CLRDV in Arizona. Future studies are required to evaluate the possible incidence and impact on the crop yield in the state and develop a reliable diagnostic assay to detect the virus in all infected samples. Since our study did not associate CLRDV with the terminal abortion or splitting symptoms, ongoing efforts are underway to elucidate if other viruses may be associated with the symptoms.

Selection of Force Sensors for In Situ Measurement of Neotissue Microenvironments.

Mechanical forces are a critical stimulus in both native and engineered tissues. Direct measurement of these microenvironmental forces has been challenging, particularly for cell-dense models. To address this, we previously developed hydrogel-based force sensors that are approximately the size of a cell and can be imaged over time to computationally assess the forces exerted by surrounding cells and matrix. The goal of this project was to identify how the physical characteristics of force sensors impact measurements. Sensors were varied in size, elastic modulus, and surface coating before being included in stem cell suspensions that then spontaneously self-assembled into spheroidal neotissues. Using this model of early mesenchymal condensation, we hypothesized that larger, softer sensors would provide greater sensitivity and precision, whereas protein coatings would influence the directionality of applied forces (tensile vs. compressive). These experiments were conducted using a high-content imaging system that allowed analysis of over a thousand sensors to evaluate the various conditions. Results indicated that measurement fidelity was highest for force sensors that had a diameter >20 µm and modulus ∼0.2 kPa. Extremely soft sensors deformed too much, whereas stiffer sensors deformed too little. Collagen and N-cadherin coatings, which replicated cell-matrix or cell-cell binding, respectively, allowed for tensile forces to be exerted on the sensors, with greater forces being observed for N-cadherin sensors in these highly cellular neotissue constructs. Uncoated sensors were universally compressed due to the lack of cell-sensor adhesion. Disruption of the actin cytoskeleton lessened microenvironmental forces, whereas disruption of microtubules had no measurable effect. Potential future applications of the technology include studies of in situ forces in developing tissues as well as a real-time sensor for monitoring the growth of engineered constructs.

First report of citrus yellow vein clearing virus (CYVCV) on citrus in Italy.

In March 2024, symptoms of vein clearing (Fig. S1) were observed on leaves of six lemon (Citrus limon (L.) Burm. f.) trees grown in a private garden in Palma Campania (Campania region, Italy). Symptoms strongly resembled those of yellow vein clearing disease, caused by Potexvirus citriflavivenae (citrus yellow vein clearing virus, CYVCV), genus Potexvirus, sub-genus Mandarivirus (Loconsole et al., 2012; Cui et al., 2018). CYVCV was reported in Pakistan, India, China, Iran, Turkey, Korea and USA (Abrahamian et al., 2024; Catara et al., 1993; EPPO, 2024; Sun and Yokomi, 2024; Jin et al., 2024). Since 2022, considering the potential impact of this emerging virus, CYVCV has been included in the EPPO alert list and it has not been reported in any European Union (EU) Member State where the virus is not regulated. To ascertain possible infection with CYVCV, leaf samples were collected and tested by reverse transcription polymerase chain reaction (RT-PCR). Total nucleic acids (TNAs) from leaves of the symptomatic lemon and non-symptomatic lemon and sweet orange (Citrus sinensis (L.) Osbeck) trees grown in the same garden, were extracted using the silica-capture extraction method (Foissac et al. 2001). TNAs were tested by RT-PCR using CYVCV specific primers (Table S1) designed by Chen et al., (2014) targeting the coat protein gene. All symptomatic trees and an asymptomatic sweet orange from the same garden tested positive generating an amplicon of the expected size (612 bp). Direct Sanger sequencing of amplicons obtained from two symptomatic lemons and one non-symptomatic sweet orange (An PP842725-PP842727) followed by BLAST search showed 97.9-98.08% sequence identity (query coverage 100%) with CYVCV isolates previously reported from a mandarin (An OQ418501) and a lemon (An OQ418493) in California. In contrast, no amplicons were detected in samples from non-symptomatic lemon trees. Virus identity was confirmed by RT-PCR with different primers (Table S1) targeting the RNA-dependent RNA polymerase gene of CYVCV. Amplicons of the expected size (832 bp) were obtained only from samples previously tested positive to the virus and their sequences determined by Sanger sequence (An PQ284953-PQ284955) showed 97.98-98.11% identity (query coverage 100%) with CYVCV sequence previously reported from a mandarin (An OR251443) in New Delhi. Since CYVCV is transmitted by insects (Önelge et al., 2011a, 2011b, Zhang et al., 2018, 2019), TNAs (Foissac et al., 2001) from Aphis aurantii infesting symptomatic lemons, and of A. spiraecola and Dialeurodes citri infesting symptomatic lemon and non-symptomatic sweet orange trees were assayed by RT-PCR with primer pairs designed by Chen et al., (2014). Three samples of 15 specimens from three different trees were tested for each insect. In contrast to D. citri, which tested negative, an amplicon of 612 bp was detected from A. aurantii and A. spiraecola and Direct sequencing of amplicons (An PP842721-PP842724) confirmed the nature of the virus and showed that insect-derived viral sequences shared nucleotide identity of 99.3-100% with those from the infected trees. Altogether, these data support that CYVCV is present in Southern Italy. Likely, it has been introduced illegally through infected citrus propagation material. Given the large A. aurantii and A. spiraecola populations in the areas where CYVCV has been detected, a fast spread of the virus to other areas of Campania region can be expected. Even if the impact of CYVCV on citrus production in Italy remains to be assessed, prompt and extensive surveys may be helpful to establish the actual distribution of the virus. This would allow for a better evaluation of appropriate measures to be adopted to achieve sustainable citrus production. At the best of our knowledge, this is the first report of CYVCV in Italy and in the EU territory.

Development of infectious clones of mungbean yellow mosaic India virus (MYMIV, Begomovirus vignaradiataindiaense) infecting mungbean [Vigna radiata (L.) R. Wilczek] and evaluation of a RIL population for MYMIV resistance.

Yellow mosaic disease (YMD) is a major constraint for the low productivity of mungbean, mainly in South Asia. Addressing this issue requires a comprehensive approach, integrating field and challenge inoculation evaluations to identify effective solutions. In this study, an infectious clone of Begomovirus vignaradiataindiaense (MYMIV) was developed to obtain a pure culture of the virus and to confirm resistance in mungbean plants exhibiting resistance under natural field conditions. The infectivity and efficiency of three Agrobacterium tumefaciens strains (EHA105, LBA4404, and GV3101) were evaluated using the susceptible mungbean genotype PS16. Additionally, a recombinant inbred line (RIL) population comprising 175 lines derived from Pusa Baisakhi (MYMIV susceptible) and PMR-1 (MYMIV resistant) cross was developed and assessed for YMD response. Among the tested Agrobacterium tumefaciens strains, EHA105 exhibited the highest infectivity (84.7%), followed by LBA4404 (54.7%) and GV3101 (9.80%). Field resistance was evaluated using the coefficient of infection (CI) and area under disease progress curve (AUDPC), identifying seven RILs with consistent resistant reactions (CI≤9) and low AUDPC (≤190). Upon challenge inoculation, six RILs exhibited resistance, while RIL92 displayed a resistance response, with infection occurring in less than 10% of plants after 24 to 29 days post inoculation (dpi). Despite some plants remaining asymptomatic, MYMIV presence was confirmed through specific PCR amplification of the MYMIV coat protein (AV1) gene. Quantitative PCR revealed a very low relative viral load (0.1-5.1% relative fold change) in asymptomatic RILs and the MYMIV resistant parent (PMR1) compared to the susceptible parent (Pusa Baisakhi). These findings highlight the potential utility of the developed infectious clone and the identified MYMIV-resistant RILs in future mungbean breeding programs aimed at cultivating MYMIV-resistant varieties.

Molecular characterization of Begomovirus and Beta satellite virus associated with leaf curl disease of Chilli (Capsicum annum L.) in southern parts of Tamil Nadu

Chilli is one of the widely cultivated commercial vegetable crops in India. Chilli leaf curl is the most devasting disease and causes a yield loss of 100 per cent in Chilli. Fourteen begomovirus species cause chilli leaf curl disease (ChiLCD). An extensive survey was carried out in 2023 to determine the prevalence of the leaf curl disease of Chilli caused by begomovirus in major chilli-growing areas of the Southern Districts of Tamil Nadu. During the survey, 21 isolates of begomovirus infecting Chilli were collected. Among the 21 isolates, the isolate collected from Kalakudi village (BV-KI) exhibited severe symptoms.DNA extracted from 21 isolates of begomovirus were subjected to PCR by using Rojas universal primers, Chilli leaf curl virus (ChiLCV) Coat protein primers and beta satellite virus primers and obtained 1380 bp, 1100 bp and 1400 bp amplicons of top and coat protein region of DNA-A of begomovirus, Chilli leaf curl virus coat protein region and beta satellite virus associated with ChiLCV respectively. The 1380 bp, 1100 bp and 1400 bp amplicons obtained from the BV-KI isolate were sequenced and submitted to the NCBI. The sequences were blast analyzed, and it showed that the nucleotide sequence of the top and coat protein region of DNA-A of begomovirus and CP gene of ChiLCV BV-KI isolate was found to have 90.61 and 99.78% similarity with Bhavanisagar (NC 055130.1) isolate respectively. The nucleotide sequence of the beta satellite virus of BV-KI isolate was found to have 99.93% similarity with the Chilli leaf curl beta satellite virus Meerut (MH355642.1) isolate.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Engineered M13-Derived Bacteriophages Capable of Gold Nanoparticle Synthesis and Nanogold Manipulations

For years, gold nanoparticles (AuNPs) have been widely used in medicine and industry. Although various experimental procedures have been reported for their preparation and manipulation, none of them is optimal for all purposes. In this work, we engineered the N-terminus of the pIII minor coat protein of bacteriophage (phage) M13 to expose a novel HLYLNTASTHLG peptide that effectively and specifically binds gold. In addition to binding gold, this engineered phage could synthesize spherical AuNPs of 20 nm and other sizes depending on the reaction conditions, aggregate them, and precipitate gold from a colloid, as revealed by transmission electron microscopy (TEM), atomic force microscopy (AFM), and scanning electron microscopy (SEM), as well as ultraviolet–visible (UV–vis) and Fourier-transform infrared (FTIR) spectroscopic methods. We demonstrated that the engineered phage exposing a foreign peptide selected from a phage-displayed library may serve as a sustainable molecular factory for both the synthesis of the peptide and the subsequent overnight preparation of AuNPs from gold ions at room temperature and neutral pH in the absence of strong reducing agents, such as commonly used NaBH4. Taken together, the results suggest the potential applicability of the engineered phage and the new, in vitro-identified gold-binding peptide in diverse biomimetic manipulations.

Viral Diversity in Mixed Tree Fruit Production Systems Determined through Bee-Mediated Pollen Collection

Commercially cultivated Prunus species are commonly grown in adjacent or mixed orchards and can be infected with unique or commonly shared viruses. Apple (Malus domestica), another member of the Rosacea and distantly related to Prunus, can share the same growing regions and common pathogens. Pollen can be a major route for virus transmission, and analysis of the pollen virome in tree fruit orchards can provide insights into these virus pathogen complexes from mixed production sites. Commercial honey bee (Apis mellifera) pollination is essential for improved fruit sets and yields in tree fruit production systems. To better understand the pollen-associated virome in tree fruits, metagenomics-based detection of plant viruses was employed on bee and pollen samples collected at four time points during the peak bloom period of apricot, cherry, peach, and apple trees at one orchard site. Twenty-one unique viruses were detected in samples collected during tree fruit blooms, including prune dwarf virus (PDV) and prunus necrotic ringspot virus (PNRSV) (Genus Ilarvirus, family Bromoviridae), Secoviridae family members tomato necrotic ringspot virus (genus Nepovirus), tobacco necrotic ringspot virus (genus Nepovirus), prunus virus F (genus Fabavirus), and Betaflexiviridae family member cherry virus A (CVA; genus Capillovirus). Viruses were also identified in composite leaf and flower samples to compare the pollen virome with the virome associated with vegetative tissues. At all four time points, a greater diversity of viruses was detected in the bee and pollen samples. Finally, the nucleotide sequence diversity of the coat protein regions of CVA, PDV, and PNRSV was profiled from this site, demonstrating a wide range of sequence diversity in pollen samples from this site. These results demonstrate the benefits of area-wide monitoring through bee pollination activities and provide new insights into the diversity of viruses in tree fruit pollination ecosystems.

The guanylate-binding protein GBP1 forms a protein coat that enwraps cytosol-invasive bacteria

The guanylate-binding protein GBP1 forms a protein coat that enwraps cytosol-invasive bacteria

Glycerophosphodiester phosphodiesterase 1 mediates G3P accumulation for Eureka lemon resistance to citrus yellow vein clearing virus

Abstract Glycerophosphodiester phosphodiesterase 1 (GDPD1) plays an important function in the abiotic stress responses and participates in the accumulation of sn-glycerol-3-phosphate (G3P) in plants, which is key to plant systemic acquired resistance (SAR). However, the role of GDPD1 in plant responses to biotic stress remains poorly understood. This study characterized the antivirus function of the GDPD1 gene (designated as ClGDPD1) from Eureka lemon. ClGDPD1 is located in the membrane and endoplasmic reticulum, where it interacts with the citrus yellow vein clearing virus (CYVCV) coat protein (CP). Compared to individually express ClGDPD1 or co-expressed ClGDPD1 + CP140-326, transiently co-expressed ClGDPD1 + CP or ClGDPD1 + CP1-139 significantly up-regulated the key substance contents and genes expression involved in glycerophospholipid metabolism. Over-expression of ClGDPD1 significantly facilitated the accumulation of G3P, up-regulated the expression of SAR-related genes, and increased the resistance of transgenic Eureka lemon to CYVCV infection. Furthermore, exogenous glycerol treatment and over-expression of ClGPDH increased the G3P content and reduced CYVCV titers in plants or hairy roots. These results indicated that the enhanced resistance of ClGDPD1 transgenic Eureka lemon to CYVCV may be due to facilitating G3P accumulation through the interaction of ClGDPD1 with CP. Our findings provide novel insights into the role of ClGDPD1 as an important regulatory center in mediating the citrus defense response to viral infections.

First Report of Paprika mild mottle virus Infecting pepper (Capsicum annuum L.) in China.

Paprika mild mottle virus (PaMMV), a tobamovirus from the Virgaviridae family, has been reported to infect pepper (Capsicum annuum L.) in the Netherlands (García-Luque et al., 1993), Japan (Hamada et al., 2003), Bulgaria (Ruíz del Pino et al., 2003), and Israel (Luria et al., 2018). Pepper has become the most widely planted vegetable and the most heavily consumed spicy condiment, with a large planting area (>21,000 km2) in China (Zou et al., 2021). However, the crop's productivity is limited by viral diseases. In August 2021, a survey of viral diseases was conducted across five pepper-growing regions in Linyi, Shandong Province, China, revealed that 5% to 10% of plants in most fields exhibited symptoms such as stunting, leaf narrowing, chlorosis, and crinkling of leaf tissue (Fig. S1-a). Subsequently, seven symptomatic samples (Fig. S1-b) were collected from a plot (118° 29' E, 34° 65' N) where thin-skinned peppers were grown. All samples tested positive in a Western blot assay using a polyclonal antibody for tobacco mosaic virus (TMV), indicating the presence of a tobamovirus (Fig. S1-c). To identify the virus, total RNAs were extracted from 10 different symptomatic pepper plant samples, using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) and combined into a single sample in equal amounts (100 ng/μL each). RNA-Seq was performed on this mixture using the Illumina NovaSeq 6000 (Illumina, San Diego, USA). Raw reads (6.92G) in fastq format were processed with in-house perl scripts to yield clean reads (6.68G), which were assembled into 780 contigs (mean length: 2036 bp) using Trinity software (v2.6.6). These contigs were then analysed using the NCBI BLASTX program (http://www.ncbi.nlm.nih.gov/blast) against the viral RefSeq database. The results demonstrated that the contigs exhibited an average genome coverage of 40.16%. Notably, one unique contig (6453 bp) was mapped to the PaMMV genome (reference sequence KX187305.1) with 98.34% identity. To verify the RNA-Seq result, a PaMMV-specific primer pair (forward: 5'-GAGTTCATAGAGGCAGTACC-3'; reverse: 5'-CTTCGATTTAAGTGGAGGGAT-3') was designed for amplifying an 800-nt fragment of the PaMMV coat protein (CP) gene by RT-PCR. The 800-nt fragment was successfully amplified from all the symptomatic samples (Fig. S1-d). Sequenced RT-PCR products (GenBank No. OR365081.1) showed 99.75% nucleotide identity with PaMMV isolates (OQ198318.1, China, goat) according to BLAST analysis. Mechanical transmission of PaMMV from three infected pepper plants collected in Linyi to healthy pepper plants confirmed pathogenicity. Three pepper cultivars (trade name: Qiemen, Tianyu, Haonong11) were tested and showed varying symptoms post-inoculation (Fig. S1-e). All cultivars were confirmed in the lab to be PMMoV-sensitive and exhibited significant viral disease symptoms after PMMoV inoculation (data not shown). Each variety was inoculated with at least 3 seedlings from different field-collected virulence sources. Qiemen (cultivar: sweet pepper) exhibited severe symptoms with necrotic spots, Tianyu (cultivar: Chaotian pepper) had mild leaf wrinkling, and Haonong11 (cultivar: Pickled pepper) showed yellow mottle and leaf shrinking. All tested seedlings were positive for PaMMV by RT-PCR (Fig. S1-f). To our knowledge, this is the first report of PaMMV infecting pepper in China, highlighting the need for vigilant monitoring to protect the chili industry and prevent the virus's spread to other crops.

Development of Loop-Mediated Isothermal Amplification (LAMP) Assay for In-Field Detection of American Plum Line Pattern Virus.

American plum line pattern virus (APLPV) is the most infrequently reported Ilarvirus infecting stone fruit trees and is of sufficient severity to be classified as an EPPO quarantine A1 pathogen. In late spring, yellow line pattern symptoms were observed on leaves in a few flowering cherries (Prunus serrulata Lindl.) grown in a public garden in Northwest Italy. RNA extracts from twenty flowering cherries were submitted to Ilarvirus multiplex and APLPV-specific RT-PCR assays already reported or developed in this study. One flowering cherry (T22) with mixed prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) infection also showed infection with APLPV. Blastn analysis of PCR products of the full coat protein (CP) and movement protein (MP) genes obtained from flowering cherry T22 showed 98.23% and 98.34% nucleotide identity with reference APLPV isolate NC_003453.1 from the USA. Then, a LAMP-specific assay was designed to facilitate the fast and low-cost identification of this virus either in the laboratory or directly in the field. The developed assay allowed not only the confirmation of APLPV (PSer22IT isolate) infection in the T22 flowering cherry but also the identification of APLPV in an asymptomatic flowering cherry tree (TL1). The LAMP assay successfully worked with crude flowering cherry extracts, obtained after manually shaking a single plant extract in the ELISA extraction buffer for 3-5 min. The developed rapid, specific and economic LAMP assay was able to detect APLPV using crude plant extracts rather that RNA preparation in less than 20 min, making it suitable for in-field detection. Moreover, the LAMP assay proved to be more sensitive in APLPV detection in flowering cherry compared to the specific one-step RT-PCR assay. The new LAMP assay will permit the estimation of APLPV geographic spread in the territory, paying particular attention to surrounding gardens and propagated flowering cherries in ornamental nurseries.

SEC31a-ATG9a Interaction Mediates the Recruitment of COPII Vesicles for Autophagosome Formation.

Autophagy plays an important role in determining stem-cell differentiation. During the osteogenic differentiation of mesenchymal stem cells (MSCs), autophagosome formation is upregulated but the reason is unknown. A long-standing quest in the autophagy field is to find the membrane origin of autophagosomes. In this study, cytoplasmic coat protein complex II (COPII) vesicles, endoplasmic reticulum-derived vesicles responsible for the transport of storage proteins to the Golgi, are demonstrated to be a critical source of osteoblastic autophagosomal membrane. A significant correlation between the number of COPII vesicle and the autophagy level is identified in the rat bone tissues. Disruption of COPII vesicles restrained osteogenesis and decreased the number and size of autophagosomes. SEC31a (an outer coat protein of COPII vesicle) is found to be vital to regulate COPII vesicle-dependent autophagosome formation via interacting with ATG9a of autophagosomal seed vesicles. The interference of Sec31a inhibited autophagosome formation and osteogenesis in vitro and in vivo. These results identified a novel mechanism of autophagosome formation in osteogenic differentiation of stem cells and identified SEC31a as a critical protein that mediates the interplay between COPII and ATG9a vesicles. These findings broaden the understanding of the regulatory mechanism in the osteogenic differentiation of MSCs.

Phylogeographic analysis of Begomovirus coat and replication-associated proteins.

Begomoviruses are globally distributed plant pathogens that significantly limit crop production. These viruses are traditionally described according to phylogeographic distribution and categorized into two groups: begomoviruses from the Africa, Asia, Europe and Oceania (AAEO) region and begomoviruses from the Americas. Monopartite begomoviruses are more common in the AAEO region, while bipartite viruses predominate in the Americas, where the begomoviruses lack the V2/AV2 gene involved in inter-cellular movement and RNA silencing suppression found in AAEO begomoviruses. While these features are generally accepted as lineage-defining, the number of known species has doubled due to sequence-based discovery since 2010. To re-evaluate the geographic groupings after the rapid expansion of the genus, we conducted phylogenetic analyses for begomovirus species representatives of the two longest and most conserved begomovirus proteins: the coat and replication-associated proteins. Both proteins still largely support the broad AAEO and Americas begomovirus groupings, except for sweet potato-infecting begomoviruses that form an independent, well-supported clade for their coat protein regardless of the region they were isolated from. Our analyses do not support more fine-scaled phylogeographic groupings. Monopartite and bipartite genome organizations are broadly interchanged throughout the phylogenies, and the absence of the V2/AV2 gene is highly reflective of the split between Americas and AAEO begomoviruses. We observe significant evidence of recombination within the Americas and within the AAEO region but rarely between the regions. We speculate that increased globalization of agricultural trade, the invasion of polyphagous whitefly vector biotypes and recombination will blur begomovirus phylogeographic delineations in the future.

Two plant membrane-shaping reticulon-like proteins play contrasting complex roles in turnip mosaic virus infection.

Positive-sense RNA viruses remodel cellular cytoplasmic membranes as the membranous sources for the formation of viral replication organelles (VROs) for viral genome replication. In plants, they traffic through plasmodesmata (PD), plasma membrane-lined pores enabling cytoplasmic connections between cells for intercellular movement and systemic infection. In this study, we employed turnip mosaic virus (TuMV), a plant RNA virus to investigate the involvement of RTNLB3 and RTNLB6, two ER (endoplasmic reticulum) membrane-bending, PD-located reticulon-like (RTNL) non-metazoan group B proteins (RTNLBs) in viral infection. We show that RTNLB3 interacts with TuMV 6K2 integral membrane protein and RTNLB6 binds to TuMV coat protein (CP). Knockdown of RTNLB3 promoted viral infection, whereas downregulation of RTNLB6 restricted viral infection, suggesting that these two RTNLs play contrasting roles in TuMV infection. We further demonstrate that RTNLB3 targets the α-helix motif 42LRKSM46 of 6K2 to interrupt 6K2 self-interactions and compromise 6K2-induced VRO formation. Moreover, overexpression of AtRTNLB3 apparently promoted the selective degradation of the ER and ER-associated protein calnexin, but not 6K2. Intriguingly, mutation of the α-helix motif of 6K2 that is required for induction of VROs severely affected 6K2 stability and abolished TuMV infection. Thus, RTNLB3 attenuates TuMV replication, probably through the suppression of 6K2 function. We also show that RTNLB6 promotes viral intercellular movement but does not affect viral replication. Therefore, the proviral role of RTNLB6 is probably by enhancing viral cell-to-cell trafficking. Taken together, our data demonstrate that RTNL family proteins may play diverse complex, even opposite, roles in viral infection in plants.

Functional Diversification of Sec13 Isoforms for Storage Protein Trafficking in Rice Endosperm Cells.

Coat protein complex II (COPII) vesicles play crucial roles in mediating the endoplasmic reticulum (ER) exit of newly synthesized proteins to the Golgi in eukaryotic cells. However, the molecular functions of COPII components and their functional diversifications in plant seeds remain obscure. Here, we showed that the rice (Oryza sativa) glutelin precursor accumulation12 (gpa12) mutant is defective in storage protein export from the ER, resulting in the formation of aggregated protein bodies. Map-based cloning revealed that GPA12 encodes a COPII outer layer protein, Sec13a, that mainly localizes to endoplasmic reticulum exit sites (ERES) and partially localizes to the Golgi. Biochemical experiments verified that Sec13a physically interacts with Sec31 and Sec16, and mutation in Sec13 compromises its interaction with Sec31 and Sec16, thereby affecting the membrane association of the inner complex components Sar1b and Sec23c. Apart from Sec13a, the rice genome encodes two other Sec13 isoforms, Sec13b and Sec13c. Notably, we observed an abnormal accumulation of globular ER structures in the sec13bc double mutant but not in the single mutants, suggesting a functional redundancy of Sec13b and Sec13c in modulating ER morphology. Taken together, our results substantiated that Sec13a plays an important role in regulating storage protein export from the ER, while Sec13b and Sec13c are required for maintaining ER morphology in rice endosperm cells. Our findings provide insights into the functional diversification of COPII components in plants.

New chalcone derivatives containing morpholine-thiadiazole: Design, synthesis and evaluation of against tobacco mosaic virus

Twenty chalcone derivatives containing morpholine-thiadiazole were designed and synthesized from the natural product chalcone. The bioactivity test results indicate that some compounds exhibit good antiviral activity against tobacco mosaic virus (TMV). In particular, the EC50 values for the curative and protective activity of S14 against TMV were 91.8 and 130.6 μg/mL, which was better than that of the antiviral agent ningnanmycin (NNM, 237.8, 220.6 μg/mL). The results of preliminary mechanism study indicated that S14 had strong binding capacity and affinity to tobacco mosaic virus coat protein (TMV-CP). In the chlorophyll content assay, the chlorophyll content of tobacco leaves increased significantly after the action of S14, so that it can enhance the photosynthetic capacity of plants. In addition, the results of malondialdehyde (MDA) content assay also indicated that S14 could improve the disease resistance of tobacco.

Nanomaterial inactivates environmental virus and enhances plant immunity for controlling tobacco mosaic virus disease

Tobacco mosaic virus (TMV) is extremely pathogenic and resistant to stress There are great needs to develop methods to reduce the virus in the environment and induce plant immunity simultaneously. Here, we report a multifunctional nano-protectant to reduce the virus in the environment and induce plant immunity simultaneously. The star polycation (SPc) nanocarrier can act as an active ingredient to interact with virus coat protein via electrostatic interaction, which reduces the proportion of TMV particles to 2.9% and leads to a reduction of the amount of virus in the environment by half. SPc can act as an adjuvant to spontaneously assemble with an immune inducer lentinan (LNT) through hydrogen bonding into nanoscale (142 nm diameter) LNT/SPc complex, which improves the physicochemical property of LNT for better wetting performance on leaves and cellular uptake, and further activates plant immune responses. Finally, the LNT/SPc complex displays preventive and curative effects on TMV disease, reducing TMV-GFP relative expression by 26% in the laboratory and achieving 82% control efficacy in the field We hope the strategy reported here would be useful for control of crop virus disease.

Development of a Multiplex Polymerase Chain Reaction Assay for Detecting Five Previously Unreported Papaya Viruses for Quarantine Purposes in Korea

There are concerns about the introduction and spread of plant pests and pathogens with globalization and climate change. As commercial control agents have not been developed for plant viruses, it is important to prevent virus spread. In this study, we developed a multiplex polymerase chain reaction (PCR) detection method to rapidly diagnose and control three DNA (papaya golden mosaic virus, Lindernia anagallis yellow vein virus, and melon chlorotic leaf curl virus) and two RNA (papaya leaf distortion mosaic virus and lettuce chlorosis virus) viruses that infect papaya. Specific primer sets were designed for the virus coat protein. Performing PCR, clear bands were observed with no non-specific reaction. Our multiplex PCR method can simultaneously detect small amounts of DNA/RNA to diagnose five viruses infecting papaya and prevent the spread of the virus.

Next Generation Sequencing and Genetic Analyses Reveal Factors Driving Evolution of Sweetpotato Viruses in Uganda.

Sweetpotato (Ipomoea batatas L.) is an essential food crop globally, especially for farmers facing resource limitations. Like other crops, sweetpotato cultivation faces significant production challenges due to viral infections. This study aimed to identify and characterize viruses affecting sweetpotato crops in Uganda, mostly those associated with sweetpotato virus disease (SPVD). Infected leaf samples were collected from farmers' fields in multiple districts spanning three regions in Uganda. MiSeq, a next-generation sequencing platform, was used to generate reads from the viral nucleic acid. The results revealed nine viruses infecting sweetpotato crops in Uganda, with most plants infected by multiple viral species. Sweet potato pakakuy and sweet potato symptomless virus_1 are reported in Uganda for the first time. Phylogenetic analyses demonstrated that some viruses have evolved to form new phylogroups, likely due to high mutations and recombination, particularly in the coat protein, P1 protein, cylindrical inclusion, and helper component proteinase regions of the potyvirus. The sweet potato virus C carried more codons under positive diversifying selection than the closely related sweet potato feathery mottle virus, particularly in the P1 gene. This study provides valuable insights into the viral species infecting sweetpotato crops, infection severity, and the evolution of sweet potato viruses in Uganda.