protein-A Sandwich Enzyme-linked Immunosorbent Assay Research Articles

The prevalence of badnaviruses in West African yams (Dioscorea cayenensis-rotundata) and evidence of endogenous pararetrovirus sequences in their genomes

Yam (Dioscorea spp.) is an important vegetatively-propagated staple crop in West Africa. Viruses are pervasive in yam worldwide, decreasing growth and yield, as well as hindering the international movement of germplasm. Badnaviruses have been reported to be the most prevalent in yam, and genomes of some other badnaviruses are known to be integrated in their host plant species. However, it was not clear if a similar scenario occurs in Dioscorea yam. This study was conducted to verify the prevalence of badnaviruses, and determine if badnavirus genomes are integrated in the yam genome.Leaf samples (n=58) representing eight species of yam from global yam collections kept at CIRAD, France, and 127 samples of D. rotundata breeding lines (n=112) and landraces (n=15) at IITA, Nigeria, were screened using generic badnavirus PCR primers. Positive amplification of an expected ca. 579bp fragment, corresponding to a partial RT-RNaseH region, was detected in 47 (81%) of 58 samples analysed from CIRAD collections, and 100% of the 127 IITA D. rotundata samples. All the D. cayenensis and D. rotundata samples from the CIRAD and IITA collections tested PCR-positive, and sequencing of a selection of the PCR products confirmed they were typical of the genus Badnavirus. A comparison of serological and nucleic acid techniques was used to investigate whether the PCR-positives were sequences amplified from badnavirus particles or putative endogenous badnavirus sequences in the yam genome. Protein A sandwich-enzyme-linked immunosorbent assay (PAS-ELISA) with badnavirus polyclonal antisera detected cross-reacting viral particles in only 60% (92 of 153) of the CIRAD collection samples analysed, in contrast to the aforementioned 81% by PCR. Immunosorbent electron microscopy (ISEM) of virus preparations of a select set of 16 samples, representing different combinations of positive and negative PCR and PAS-ELISA results, identified bacilliform particles in 11 of these samples. Three PCR-positive yam samples from Burkina Faso (cv. Pilimpikou) were identified in which no viral particles were detected by either PAS-ELISA or ISEM. Southern hybridisation results using a yam badnavirus RT-RNaseH sequence (Gn155Dr) as probe, supported a lack of badnavirus particles in the cv. Pilimpikou and identified their equivalent sequences to be of plant genome origin. Probe Gn155Dr, however, hybridised to viral particles and plant genomic DNA in three D. rotundata samples from Guinea. These results represent the first data demonstrating the presence of integrated sequences of badnaviruses in yam. The implications of this for virus-indexing, breeding and multiplication of seed yams are discussed.

Occurrence of latent virus infection in visually-rated cowpea (Vigna unguiculata L. Walp) seedlings

The presence of latent infections was studied in five cowpeas varieties. Seeds of the varieties were planted and the seedlings inoculated with antigens from Cucumber mosaic virus (CMV) genus Cucumovirus, Bean common mosaic virus (BCMV) genus Potyvirus (Blackeye cowpea mosaic virus strain), Southern bean mosaic virus (SBMV) genus Sobemovirus and Cowpea mottle virus (CPMoV) genus Carmovirus seven days after planting. Seedlings expressing symptoms were rouged at two weeks after inoculation, while asymptomatic ones were subjected to serological indexing to detect the presence/absence of latent infection. Protein A-sandwich enzyme-linked immunosorbent assay (PAS ELISA) was employed for the serological detection of CMV, SBMV and CPMoV, while antigen-coated plate (ACP) ELISA was used to detect BCMV in the asymptomatic plants. Cowpea seedlings without virus symptoms but with positive serological reactions were considered as being latently infected. All of the inoculated TVu 1272 and SuVita-2 plants showed symptoms consistent with CMV and CPMoV infections, respectively. The rate of CMV latent infection was high in TVu 1179 (14.5%), low in SuVita-2 (1.3%) but not recorded in TVu 1272.

English

  Cocoa Swollen Shoot Virus Disease (CSSVD) is one of the major diseases affecting cocoa production in West Africa, especially Ghana. The lack of any published article on the continued presence or absence of this viral disease has necessitated this investigation.  Cocoa leaf samples from plants showing symptoms of leaf chlorosis, interveinal chlorosis with mottling and swollen shoot were collected from Cocoa Research Institute of Nigeria, Ibadan, and two farmers’ plots at Offa-Igbo, both in Oyo State, Nigeria. Detection of Cocoa Swollen Shoot Virus (CSSV) in the leaf samples was done by Enzyme Linked Immunosorbent Assay (ELISA) using antiserum raised against mild and severe strains of the virus. CSSV was readily detected in 60% of the samples by Antigen Coated Plate ELISA (ACP-ELISA) but not with the Protein A Sandwich ELISA (PAS-ELISA).  Of the positive samples, 16.67% reacted to both the mild and severe strains of the virus. CSSV was detected in most of the positive samples from farmers’ plot 1 (68.96%) than from farmers’ plot 2 and CRIN respectively (54.16 and 55.55%).  The result has re-established the natural occurrence of the virus in Nigeria and thus calls for a re-evaluation of the economic importance of the disease in Nigeria.   Key words: Cocoa, cocoa swollen shoot virus, ELISA.

Globularia nudicaulis, a new host for Cucumber mosaic virus

) is a perennial, foundnaturally on European mountains at altitudes between 900 and 2000 m.In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variega-tion on malformed leaves, were noted among plant species cultivated in theBotanical Garden at Bologna University, Italy. No elongated virus-likeparticles were observed in affected-leaf extracts by transmission electronmicroscopy using a leaf dip method. By applying a protein A sandwichenzyme-linked immunosorbent assay (PAS-ELISA) technique ( Edwards Csystemic symptoms were observed in Nicotiana tabacum , N. benthamiana ,N. glutinosa, N. clevelandii and Capsicum annuum, and Cucumis sativusand C. melo. Reverse transcription-polymerase chain reaction (RT-PCR)and single-strand conformation polymorphism (SSCP) were employed tocharacterize the CMV isolate. Total RNA was extracted from affected G.nudicaulis leaf samples with a RNeasy Plant Minikit (Qiagen) accordingto the manufacturer’s instructions. RT-PCR was carried out using specificprimers for the movement protein gene of RNA3 of CMV (forward MP +CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt,and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938ntto 959nt; Lin et al., 2004). All samples yielded DNA fragments ofthe expected size: 841 bp. PCR products were then analysed by SSCP toidentify specific sequence variants and compare genetic relationships withother CMV isolates from the Botanical Garden (MGB & SD, unpublishedresults).The results showed a sequence variant that was different from otherlocal CMV isolates, indicating that CMV isolate G in G. nudicaulis is anew accession in this location. This is the first time that CMV has beenisolated from G. nudicaulis.ReferencesEdwards ML, Cooper JI, 1985. Plant virus detection using a new form of indirect ELISA.

A new Ilarvirus found in rose

Globularia nudicaulis (family Globulariaceae ) is a perennial, found naturally on European mountains at altitudes between 900 and 2000 m. In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variegation on malformed leaves, were noted among plant species cultivated in the Botanical Garden at Bologna University, Italy. No elongated virus-like particles were observed in affected-leaf extracts by transmission electron microscopy using a leaf dip method. By applying a protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA) technique (Edwards & Cooper, 1985), Cucumber mosaic virus (CMV) was detected using a polyclonal antiserum (PVAS 30, American Type Culture Collection, Manassas, VA, USA). CMV from G . nudicaulis leaves was mechanically transmitted to 10 of 14 species tested. Local lesions were observed in Chenopodium murale and C. quinoa ; systemic symptoms were observed in Nicotiana tabacum , N. benthamiana , N. glutinosa , N. clevelandii and Capsicum annuum , and Cucumis sativus and C. melo . Reverse transcription-polymerase chain reaction (RT-PCR) and single-strand conformation polymorphism (SSCP) were employed to characterize the CMV isolate. Total RNA was extracted from affected G. nudicaulis leaf samples with a RNeasy Plant Minikit (Qiagen) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP + CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt; Lin et al ., 2004). All samples yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with other CMV isolates from the Botanical Garden (MGB & SD, unpublished results). The results showed a sequence variant that was different from other local CMV isolates, indicating that CMV isolate G in G. nudicaulis is a new accession in this location. This is the first time that CMV has been isolated from G. nudicaulis.

Screening Cowpea (<I>Vigna unguiculata</I> (l) walp) lines for infection responses to some Cowpea Viruses in Nigeria

Thirty-three cowpea varieties were screened in a screen-house in Ibadan, Nigeria for responses to four cowpea viruses; namely, Bean common mosaic potyvirus - blackeye cowpea strain (BCMV-BlC), Cowpea aphid-borne mosaic potyvirus (CABMV), Cowpea Mottle Carmovirus (CMeV) and Southern bean mosaic sobemovirus (SBMV). 33 x 5 factorial experiment in completely randomised design was used, disease severity was measured at the second and sixth weeks after mechanical inoculation of the viruses and scored from 1 (no infection) to 5 (very severe infection). Symptomless plants were serologically tested with Protein – A sandwich enzyme linked immunosorbent assay (PAS-ELISA) to distinguish lines with latent infection from none infected lines. The yield in 2000 was not significantly (p KEY WORDS: Cowpea viruses, Disease incidence, Cowpea, Vigna, ELISA. Global Jnl Pure and Applied Sciences Vol.10(4) 2004: 473-478

First Report of a Disease of Peony Caused by Alfalfa mosaic virus.

During the summers of 2001 and 2002, Japanese peony (Paeonia albiflora Pall., synonym P. lactiflora, family Paeoniaceae) plants, cultivated in the Botanical Garden of the University of Parma (Emilia Romagna Region of northern Italy), were found affected by a disease with virus-like symptoms. The oldest leaves showed yellow, mosaic, oak-like arabesques and line-patterns; the remaining leaves and pink flowers were symptomless. A disease of peony, known as peony ring spot disease, has been reported worldwide (Europe, United States, Japan, and New Zeland) for several years and is associated with strains of Tobacco rattle virus (TRV) (1). Electron microscopic observations of peony leaf sap (leaf dip preparations stained with uranyl acetate and phospotungstic acid) did not show the presence of any rod-shaped virus particles, including TRV. Mechanical inoculations of sap from symptomatic leaves caused symptoms typical of Alfalfa mosaic virus (AMV) on Chenopodium amaranticolor Coste & Reyn. (local chlorotic and necrotic lesions and systemic periveinal line-patterns), Ocimum basilicum L. (yellow mosaic), Vigna unguiculata (L.) Walp. (red, local necrotic lesions), and Nicotiana tabacum cv. Samsun (white, necrotic lesions, systemic leaf malformation, and mosaic), and N. glutinosa L. (systemic leaf variegation). Symptomatic leaves of peony and infected herbaceous plants were analyzed for virus presence by protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA). The polyclonal antisera tested were those to AMV (PVAS 92, American Type Culture Collection, Manassas, VA), AMV-Vinca minor L. (DiSTA collection, Italy), and the nepoviruses Strawberry latent ringspot virus, Tomato ringspot virus, and Cherry leaf roll virus. PAS-ELISA revealed only the presence of AMV. Immunoelectron microscopy and gold-labeled decoration confirmed the identity of the virus. In 2001, five symptomless peony plants (provided by a commercial grower and previously analyzed for AMV and TRV presence) were grafted with shoots from peony showing yellow mosaic on the leaves and maintained in a greenhouse under aphid-proof cage. During the summer of 2002, one of the grafted plants showed a mild mosaic on the leaves; PAS-ELISA revealed this peony was infected by AMV. To our knowledge, this is the first report of AMV in peony. Reference: (1) Chang et al. Ann. Phytopathol. Soc. Jpn. 42:325, 1976.

Mixed Infection of Hard Red Winter Wheat with High Plains Virus and Wheat Streak Mosaic Virus from Wheat Curl Mites in Nebraska

A new disease of wheat and corn caused by the High Plains virus (HPV) has been observed in the High Plains region of western United States. HPV is transmitted by the wheat curl mite, Aceria tosichella, which is also the vector of wheat streak mosaic virus (WSMV). In the field it is extremely difficult to visually differentiate plants infected with WSMV from those with HPV. An indirect protein-A sandwich enzyme-linked immunosorbent assay (PAS-ELISA) and Western blot analysis were used to identify WSMV and HPV. Samples of wheat curl mites were collected from arbitrarily chosen sites from commercial wheat plantings in 1995 and 1996 and used to infest caged wheat plants. After 3 weeks, leaf samples were harvested and assayed. Both Western blot analysis and PAS-ELISA were effective at identifying samples positive for WSMV and HPV, both alone and in mixed infections. Western blot results showed that over the 2 years, 65% of the samples were positive for WSMV, 46% were positive for HPV, and mixed infections were found in 40% of the samples. HPV presence was verified with similar results from field collected plant samples. These levels of virus indicate an unexpectedly high incidence of HPV in wheat curl mite populations in Nebraska.

Changes in Neotyphodium coenophialum Infestation Levels in Tall Fescue Pastures Due to Different Grazing Pressures

Infection of tall rescue (Festuca arundinacea Schreb.) with the mutualistic fungal endophyte Neotyphodium coenophialum (Morgan‐ Jones & Gams) Glenn, Bacon & Hanlin results in numerous biochemical and physiological changes that increase host persistence. This study was conducted to determine effects of steer (Bos taurus L.) grazing on changes in endophyte infestation levels of tall rescue pastures. Eighteen 1.2‐ha pastures were seeded in 1992 in 20‐cm drill rows involving combinations of high, medium, or low grazing pressure and ‘Ky 31’ tall fescue infested with N. coenophialum at four levels ranging from endophyte‐free (E−) to 80% infestation (E+). Pastures grazed for about 10 mo. each year from fall 1993 until summer 996, although animals on some of the high grazing pressure pastures occasionally had to be removed because of insufficient forage. Endophyte levels were monitored yearly with protein‐A sandwich enzyme‐linked immunosorbent assay (PAS‐ELISA). Stand density of tall fescue remained satisfactory throughout the study. After 2 yr, endophyte infestation levels in low grazing pressure pastures were at the same level as at the beginning of the study, and E+ levels remained constant in all pastures that started at high E+, regardless of grazing pressure. However, in high and medium grazing pressure pastures, E+ levels increased by 20 to 30%. Based on these data, we conclude that moderate and high grazing pressures influence endophyte infestation level of pastures and must be taken into account when designing pasture management systems.

Plant virus detection using a new form of indirect ELISA

A novel form of indirect enzyme-linked immunosorbent assay (ELISA) has been devised for the detection of viruses in plants. The method uses protein A in two applications to sandwich antibody-antigen-antibody layers. The first applied layer of protein A prepares the plate for the coating antibody layer. The second layer of protein A is conjugated to the enzyme and detects the second antibody layer. The orientation of the IgG induced in the coating layer of antibody prevents later unwanted reaction with the conjugated protein A. Using seven antisera, protein A sandwich ELISA (PAS-ELISA) detected homologous virus isolates in standard dilutions of infected plant homogenates at A 405 values which were at least one absorbance unit greater than those of healthy controls. The PAS-ELISA method was more sensitive than the direct double antibody sandwich form of ELISA (DAS-ELISA), e.g. not only were A 405, values for homologous reactions greater in PAS-ELISA but also an antiserum to a birch isolate of cherry leaf roll virus detected four related isolates with the new method against only one with DAS-ELISA. However, dilution end points for the homologous virus were about the same in both methods. In a practical application, PAS-ELISA detected prune dwarf virus in 18–36% of tested Prunus avium seeds.