Prevalence Of Tetracycline Resistance Genes Research Articles

PREVALENCE OF TETRACYCLINE RESISTANCE GENES IN ESCHERICHIA COLI ISOLATED FROM FOOD SAMPLES IN AND AROUND MICHAEL AND CECILIA IBRU UNIVERSITY, NIGERIA

Background: Genes that confer resistance to tetracycline, a common antibiotic used in both human and veterinary medicine, are among the antibiotic resistance genes of most concern. Tetracycline treatment, a crucial weapon in the fight against bacterial infections, can become ineffective because of this resistance. Aim: Determination of the prevalence of tetracycline resistance genes within Escherichia coli strains found in food samples obtained from local food vendors in and around Michael and Cecilia Ibru University, Agbarha-Otor. Methods: Food samples were obtained from 6 out of 10 selected food vendors in and around MCIU campus. A total sample size of 100 respondents were administered questionnaires. Out of a total food sample size of 28, about 25grams of food samples were homogenized with 225 ml of buffered peptone water (BPW) in an electric blender (Vitamix 5200 model). Eosin Methylene Blue (EMB) agar was subsequently used as the culture media. About 0.5 ml aliquots of the inoculum were taken to extract DNA by the modified Boiling Lysis Method. Polymerase Chain Reaction (PCR) was performed using a thermocycler for the detection of tetA gene in E. coli isolates using specific primers (tetA-F CGCCTTTCCTTTGGGTTCTCTATATC; tetA-R CAGCCCACCGAGCAC AGG; Size=182 base pairs). Thereafter, gel electrophoresis was done at 200 volts for 15 minutes and studied under UV light Gel Documentation System (Cleaver Scientific, UK). Statistical analysis was conducted using Chi-square tests to identify significant differences (p<0.05) in resistance patterns among the food categories. Results: Tetracycline resistant gene (tetA) was investigated among 18 of 28 cultured samples which had E. coli growth indicating 64% prevalence. Electrophoresis results indicated the presence of tetA gene in 11 out of the 18 E. coli positive samples as the prevalence of tetA gene was 61%. Lane 2, 4, 5, 6, 7, and 10 showed bands at 182 bp confirming the isolate contained tetA gene. Lane 5 showed additional bands at 780 bp which indicated possible superficial polymorphism of the tetA gene in isolates. The presence of bands at 182 bp confirmed the presence of the gene, and the presence of additional bands at 780 bp in Lane 5 suggested potential genetic variation in the tetA gene. Conclusion: The study contributes to a broader understanding of antibiotic resistance patterns, gene prevalence, and genetic variations in bacterial isolates, with particular reference to E. coli. It underscores the need for continued surveillance and research into antimicrobial resistance, particularly in environments where E. coli contamination is of concern, such as food vendor settings. Peer Review History: Received: 20 June 2023; Revised: 14 July; Accepted: 27 August, Available online: 15 September 2023 Academic Editor: Dr. A.A. Mgbahurike, University of Port Harcourt, Nigeria, amaka_mgbahurike@yahoo.com Received file: Reviewer's Comments: Average Peer review marks at initial stage: 6.0/10 Average Peer review marks at publication stage: 7.0/10 Reviewers: Prof. Hassan A.H. Al-Shamahy, Sana'a University, Yemen, shmahe@yemen.net.ye Dr. Bilge Ahsen KARA, Ankara Gazi Mustafa Kemal Hospital, Turkey, ahsndkyc@gmail.com

Prevalence of tetracycline resistance genes in Staphylococcus aureus isolated from different clinical sources in Diyala, Iraq

Antibiotic resistance showed by many bacterial species such as Staphylococcus aureus is a great global problem. This paper is included the prevalence percentage of some tetracycline's resistance genes in isolates of S.aureus collected from different sources. Seventy five different samples were collected from different sources, including wound, burn, nasal, blood, and urine samples from several hospitals of Baquba city and the samples cultured on two culture agar Blood Agar and Mannitol Salt Agar for studying of colony properties. Gram stain and some biochemical tests such as (coagulase, oxidase, catalase) were done for this purpose. The molecular method was dependent on PCR in the detection of specific genes, 16SrRNA, to diagnose the staphylococcus genus. The results of 16SrRNA PCR detection revealed that fifteen isolates were identified as S. aureus. All the isolates were subjected to polymerase chain reaction to amplify four common tetracycline resistance determinants, tetK, tet38 ,tetL, tetM,. A number of 15 isolates (100%) were found to be positive for tetK genes , Out of 15 resistant S.aureus isolates, 15 (100%) were found to produce tet38 genes,while 5(33.3%) isolates have tetL genes , 8(53.3%) carried tetM genes.

Targeted (PCR-based) screening of antibiotic resistance genes' prevalence in the gut microbiota of tribal people of Nabarangpur, Odisha, India.

Antibiotic resistance is a major public health concern worldwide. The gut microbiota harbours multiple antibiotic resistant genes (ARGs) that contribute to the existing and future microbial population in a community or ecosystem. This study aimed to investigate the prevalence of 35 antibiotic resistance genes (ARGs) in the gut microbiota of the tribal people of Nabarangpur, Odisha, India. A total of 83 faecal samples were collected from three different tribes (Bhatra, Gond, and Paraja). Total faecal DNA was extracted, and the simplex polymerase chain reaction was performed to detect selected ARGs. Further analysis was done to estimate the incidence of these ARGs across these tribes based on alcohol consumption habits. We identified a higher prevalence of tetracycline resistance genes (tetW, tetQ and tetM) in the gut microbiota among three populations. Furthermore, a significant (P = 0·024) difference in ARG prevalence against vancomycin in individuals with and without alcohol consumption habits was noticed. The overall distribution of ARGs among the three major tribes of this location was found to be very similar. Together, irrespective of the tribes, the people of this location have gut microbiota harbouring different kinds of ARGs and tetracycline-resistant genes are the most commonly found ARGs.

Tetracycline Resistance and Prevalence of Tetracycline Resistance Genes in Bacteria from Marine Aquaculture Farms in Peninsular Malaysia

The indiscriminate use of antibiotic in aquaculture and leaching of antibiotic from aquaculture to the environment may led to the emergence and spread of antibiotic resistant bacteria and their resistant genes which is a public concern. Five tetracycline antibiotics (minocycline, doxycycline, chlorotetracycline, oxytetracycline and tetracycline) and 14 types of tetracycline genes, tet[(A), (B), (C), (D), (E), (G), (K), (L), (M), (O), (S), (P), (Q) and (X)], were investigated in waters from five marine aquaculture farms in Peninsular Malaysia. Tetracycline was detected in low concentrations from <LOQ to 25.6 ng/L. A total of 93 isolates of bacteria were isolated whereby Vibrio (n=29) and Pseudoalteromonas (n=7) were the predominant bacteria. Forty-eight of the isolates carried tet genes with 22.9% encoded multiple tet genes and 72.9% encoded a single tet gene. tet(A) (n = 20, 42%) was the most prevalent gene followed by tet(B) (n = 14, 29%) and tet(K) (n = 13, 27%). A few common tet carriers (Enterobacter, Vibrio, Photobacterium, and Pseudoalteromonas) carrying tet genes that have not been reported were identified. The values of the risk quotients (RQs) of tetracycline in Matang was 0.28 which posed a medium ecological risk to algae. Thus, the antibiotic residues in the aquaculture farm in Matang need to be monitored closely.

Detection of efflux pump genes in multiresistant Acinetobacter baumannii ST2 in Iran.

Acinetobacter baumannii, as a nosocomial pathogen has become a worldwide concern in recent years. In the current study, the resistance to tetracyclines and colistin were assessed in the isolates from different provinces of Iran.During the timeline of this study, a number of 270 isolates of A. baumannii were collected from tracheal aspirates, wounds, urine and blood cultures. The minimum inhibitory concentration (MIC) for tetracycline, doxycycline, minocycline, tigecycline and colistin were evaluated. Tetracycline resistance genes were assessed by PCR. The mean expression level of adeB, adeJ and adeG were assessed using semi quantitative Real-Time PCR. The clonal relationship of the isolates was evaluated by the repetitive extragenic palindromic PCR (REP-PCR), International Clonal (IC) Lineage Multiplex PCR and multilocus sequence typing (MLST) (Pasteur scheme) methods.The MIC by microdilution method showed that 87.5, 51.4, 28, 0.74 and 0% of the isolates were resistant to tetracycline, doxycycline, minocycline, tigecycline and colistin respectively. The prevalence of tetracycline resistance genes was 99.2, 99.2, 98, 86.7, 10, 3.33, 0.37, 0% for adeB, adeJ, adeG, tetB, tetA(39), tetA, tetM and tetH in tetracycline-resistant isolates. Moreover, the expression level of adeB, adeJ, adeG genes in tigecycline-nonsusceptible A. baumannii (TNAB) strain was higher compared to the tigecycline-susceptible A. baumannii (TSAB). A broad genomic diversity was revealed, but ST2 was the most prevalent ST. Our results indicated that tetracycline resistance in Iran is mediated by resistance-nodulation-cell division (RND) and tetB efflux pumps.

Occurrence of Antibiotic Resistance Genes in Hermetia illucens Larvae Fed Coffee Silverskin Enriched with Schizochytrium limacinum or Isochrysis galbana Microalgae.

Hermetia illucens larvae are among the most promising insects for use as food or feed ingredients due to their ability to convert organic waste into biomass with high-quality proteins. In this novel food or feed source, the absence of antibiotic-resistant bacteria and their antibiotic resistance (AR) genes, which could be horizontally transferred to animal or human pathogens through the food chain, must be guaranteed. This study was conducted to enhance the extremely scarce knowledge on the occurrence of AR genes conferring resistance to the main classes of antibiotics in a rearing chain of H. illucens larvae and how they were affected by rearing substrates based on coffee silverskin supplemented with increasing percentages of Schizochytrium limacinum or Isochrysis galbana microalgae. Overall, the PCR and nested PCR assays showed a high prevalence of tetracycline resistance genes. No significant effect of rearing substrates on the distribution of the AR genes in the H. illucens larvae was observed. In contrast, the frass samples were characterized by a significant accumulation of AR genes, and this phenomenon was particularly evident for the samples collected after rearing H. illucens larvae on substrates supplemented with high percentages (>20%) of I. galbana. The latter finding indicates potential safety concerns in reusing frass in agriculture.

Antimicrobial resistance and prevalence of tetracycline resistance genes in Escherichia coli isolated from lesions of colibacillosis in broiler chickens in Sistan, Iran

BackgroundAntibiotics have long been the first line of defense to prevent Escherichia coli infections, but they have lost their potency since bacteria have grown increasingly resistant to treatment. The present research aimed to study the drug resistance and the prevalence of tetracycline resistance genes in E. coli isolated from broilers with colibacillosis.ResultsThe results showed that the most prevalent type of drug resistance was to tetracycline at 95.0%, and the least was to gentamicin at 21.7%. The prevalences of antimicrobial resistance among the tested antibiotics were significantly different (p < 0.001). A statistically significant difference was observed between the prevalence of the tet genes (p < 0.001). The tetD positive isolates and antibiotic sensitivity to tetracycline showed statistical significant differences (p = 0.017).ConclusionsConsidering the results, tetA is the most common tetracycline resistance gene, and the presence of tetD and antibiotic sensitivity to tetracycline had a significant relationship in E. coli isolated from colibacillosis infections.

Multidrug resistant Aeromonas spp. isolated from zebrafish (Danio rerio): antibiogram, antimicrobial resistance genes and class 1 integron gene cassettes.

Aeromonas spp. are Gram-negative opportunistic bacteria which have been commonly associated with fish diseases. In this study, antibiogram, antimicrobial resistance genes and integrons of 43 zebrafish-borne Aeromonas spp. were studied. The isolates were identified as six Aeromonas species (A. veronii biovar veronii (n=26), A. veronii biovar sobria (n=3), A. hydrophila (n=8), A. caviae (n=3), A. enteropelogenes (n=2) and A. dhakensis (n=1)). Antibiogram of the isolates indicated that most of them were resistant to amoxicillin (100·00%), nalidixic acid (100·00%), oxytetracycline (100·00%), ampicillin (93·02%), tetracycline (74·42%), rifampicin (67·44%) and imipenem (65·15%). Multiple antimicrobial resistance (MAR) index values ranged from 0·19-0·44 to 90·70% isolates showed multidrug resistance. PCR of antimicrobial resistance genes revealed that the tetracycline resistance gene (tetA) was the most predominant (67·44%) among the isolates. The qnrS (53·49%), tetB (30·23%), tetE (30·23%), qnrB (23·26%) and aac(6')-Ib-cr (4·65%) genes were also detected. Class 1 integrase (IntI1) gene was found in 46·51% of the isolates. Two types of class 1 integron gene cassette profiles (qacG-aadA6-qacG and drfA1) were identified. The results showed that zebrafish-borne aeromonads can harbour different types of antimicrobial resistance genes and class 1 integrons. SIGNIFICANCE AND IMPACT OF THE STUDY: Aeromonas spp. are important pathogens found in diverse environments. Antimicrobial resistance genes and integrons of ornamental fish-borne Aeromonas spp. are not well studied. The antibiogram, antimicrobial resistance genes and class 1 integrons of Aeromonas spp. isolated from zebrafish were characterized for the first time in Korea. The prevalence of tetracycline resistance genes, plasmid-mediated quinolone resistance genes and class 1 integron gene cassettes were observed among the isolates. The qacG-aadA6-qacG gene cassette was identified for the first time in Aeromonas spp. The results suggest that the wise use of antimicrobials is necessary for the better management of the ornamental fish.

Dynamics of microbial community and tetracycline resistance genes in biological nutrient removal process

The occurrence of antibiotics in wastewater has become a serious concern due to the possible development of antibiotic resistant bacteria in wastewater treatment process. In order to understand the dynamics of microbial community and tetracycline resistance genes in biological nutrient removal (BNR) process, three lab-scale sequencing batch reactors (SBRs) were operated under the stress of tetracycline. Results indicated that microbial community structure was altered, and tetracycline efflux pump genes were enhanced over 150-day operation in the presence of trace tetracycline of 20 and 50 μg L−1, respectively. Furthermore, when the initial tetracycline concentrations were increased to 2 and 5 mg L−1, substantial enhancement of tetracycline resistance was observed, accompanied with a sharp shift in microbial community structure. In this study, horizontal gene transfer was found to be the main mechanism for the development of tetracycline resistance genes under the long-terms stress of trace tetracycline. About 90.34% of the observed variations in tetracycline resistance genes could be explained by the dynamics of potential hosts of tetracycline resistance genes and class 1 integron. It should be noticed that the functional bacteria (e.g. Nitrospira, Dechloromonas, Rhodobacter and Candidatus_Accumulibacter) responsible for nutrient removal were positively correlated with tetracycline resistance, which might promote the prevalence of tetracycline resistance during biological wastewater treatment. Consequently, this study provided in-depth insights into the occurrence and prevalence of tetracycline resistance genes and their microbial hosts in BNR process.

Antimicrobial resistance profile and prevalence of tetracycline resistance genes in Escherichia coli isolates from broiler chickens, northwestern Iran

Antimicrobial resistance profile and prevalence of tetracycline resistance genes in Escherichia coli isolates from broiler chickens, northwestern Iran

Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria.

BackgroundAntibiotic resistance genes [ARGs] in aquatic systems have drawn increasing attention they could be transferred horizontally to pathogenic bacteria. Water treatment plants (WTPs) are intended to provide quality and widely available water to the local populace they serve. However, WTPs in developing countries may not be dependable for clean water and they could serve as points of dissemination for antibiotic resistant bacteria. Only a few studies have investigated the occurrence of ARGs among these bacteria including tetracycline resistance genes in water distribution systems in Nigeria.MethodologyMulti-drug resistant (MDR) bacteria, including resistance to tetracycline, were isolated from treated and untreated water distribution systems in southwest Nigeria. MDR bacteria were resistant to >3 classes of antibiotics based on break-point assays. Isolates were characterized using partial 16S rDNA sequencing and PCR assays for six tetracycline-resistance genes. Plasmid conjugation was evaluated using E. coli strain DH5α as the recipient strain.ResultsOut of the 105 bacteria, 85 (81 %) and 20 (19 %) were Gram- negative or Gram- positive, respectively. Twenty-nine isolates carried at least one of the targeted tetracycline resistance genes including strains of Aeromonas, Alcaligenes, Bacillus, Klebsiella, Leucobacter, Morganella, Proteus and a sequence matching a previously uncultured bacteria. Tet(A) was the most prevalent (16/29) followed by tet(E) (4/29) and tet30 (2/29). Tet(O) was not detected in any of the isolates. Tet(A) was mostly found with Alcaligenes strains (9/10) and a combination of more than one resistance gene was observed only amongst Alcaligenes strains [tet(A) + tet30 (2/10), tet(A) + tet(E) (3/10), tet(E) + tet(M) (1/10), tet(E) + tet30 (1/10)]. Tet(A) was transferred by conjugation for five Alcaligenes and two E. coli isolates.ConclusionsThis study found a high prevalence of plasmid-encoded tet(A) among Alcaligenes isolates, raising the possibility that this strain could shuttle resistance plasmids to pathogenic bacteria.

Prevalence of tetracycline resistance genes and identification of tet(M) in clinical isolates of Escherichia coli from sick ducks in China

Tetracycline resistance is one of the most frequently encountered resistance properties in bacteria of animal origin. The aim of the present study was to investigate the prevalence and diversity of tetracycline resistance (tet) genes among Escherichia coli clinical isolates from diseased ducks in China and to report the identification and sequencing of the tet(M) gene. The susceptibility of 85 Escherichia coli strains to tetracyclines was determined by broth microdilution, and the presence of tet genes was investigated by multiplex PCR. All of the 85 isolates were fully resistant to both oxytetracycline and tetracycline, and 76.5 % were resistant to doxycycline. Seventy-seven of the isolates (90.6 %) encoded multiple tet genes, with 17.6, 38.8 and 34.1 % encoding two, three and four tet genes, respectively, and only 7.1 % encoded a single tet(A) gene. The MICs of oxytetracycline and tetracycline for all isolates ranged from 16 to ≥128 µg ml(-1) with a MIC90 of >128 µg ml(-1), regardless of the type or number of tet genes encoded. Isolates containing tet(M) commonly had more than one tet gene per strain. The doxycycline resistance rate in the tet(M)-positive isolates was significantly higher than in the tet(M)-negative isolates (P<0.05). A full-length tet(M) gene, including the promoter region, was obtained by PCR in seven of the 41 tet(M)-positive isolates and was sequenced and cloned. The cloned tet(M) gene conferred resistance to tetracyclines in the recombinant Escherichia coli host strain. These results revealed that, in these isolates, the prevalence of multiple tet genes was strikingly high and that tet(M) played a role in doxycycline resistance.

Tetracycline Resistance Genes Persist at Aquaculture Farms in the Absence of Selection Pressure

The prophylactic and therapeutic use of tetracyclines in aquaculture has been shown to contribute to the spread of tetracycline resistance in the environment. In this work, the prevalence of four different tetracycline-resistance genes, tetA, tetC, tetH, and tetM, in sediments from four aquaculture farms and their surroundings in the Baltic Sea was monitored by quantitative polymerase chain reaction (qPCR). The presence of three additional tetracycline-resistance genes (tetE, tetG, and tetW) was studied qualitatively by standard PCR, and the amount of bioavailable tetracyclines and total amounts of tetracycline and oxytetracycline in samples were also measured. None of the farms were using tetracycline at the time of the sampling and one of the farms had stopped all antibiotic use six years prior to the first sampling. Two of the farms were sampled over four successive summers and two were sampled once. Our results showed greater copy numbers of tetA, tetC, tetH, and tetM at the farms compared to pristine sites and demonstrated the presence of tetE, tetG, and tetW genes in the sediments under aquaculture farms at most sampling times. However, no resistance genes were found in samples collected 200 m from any of the farms. None of the samples contained therapeutically active concentrations of tetracyclines at any of the sampling times, suggesting that the increase in the prevalence of tetracycline resistance genes is caused by the persistence of these genes in the absence of selection pressure.

Phenotypic and genotypic characterization of tetracycline and minocycline resistance in Clostridium perfringens

The aim of this study was to determine the incidence of tetracycline resistance and the prevalence of tetracycline-resistance genes in strains of Clostridium perfringens isolated from different sources between 1994 and 2005. Susceptibility to tetracycline and minocycline in strains from humans (35 isolates), chickens (15 isolates), food (21 isolates), soil (16 isolates) and veterinary sources (6 isolates) was determined, and tetracycline-resistance genes were detected. Resistance was most common in strains isolated from chickens, followed by those from soils, clinical samples and foods. The most highly resistant strains were found among clinical and food isolates. tetA(P) was the most common resistance gene, and along with tetB(P) was found in all resistant strains and some sensitive strains. One tetracycline-resistant food isolate had an intact tet(M) gene. However, PCR fragments of 0.4 or 0.8 kb with high degrees of identity to parts of the tet(M) sequences of other bacteria were found, mainly in clinical isolates, and often in isolates with tetB(P). No correlation between level of sensitivity to tetracycline or minocycline and the presence of tetA(P), tetB(P) or part of tet(M) was found. The presence of part of tet(M) in some strains of C. perfringens containing tetB(P) may have occurred by recent gene transfer.

A metagenomic approach for determining prevalence of tetracycline resistance genes in the fecal flora of conventionally raised feedlot steers and feedlot steers raised without antimicrobials

To compare prevalence of tetracycline resistance genes in the fecal flora of conventionally raised feedlot steers and feedlot steers raised without antimicrobials. 61 fecal samples from conventionally raised steers and 61 fecal samples from steers raised without antimicrobials at a single feedlot. Total DNA was extracted from each fecal sample and analyzed by means of 4 multiplex PCR assays for 14 tetracycline resistance genes. At least 3 tetracycline resistance genes were identified in all 122 fecal samples. For 5 of the 14 tetracycline resistance genes, the percentage of samples in which the gene was detected was significantly higher for fecal samples from conventionally raised cattle than for fecal samples from antimicrobial-free cattle, and for 1 gene, the percent-age of samples in which the gene was detected was significantly higher for fecal samples from antimicrobial-free cattle than for fecal samples from conventionally raised cattle. The percentage of samples with > or = 11 tetracycline resistance genes was significantly higher for fecal samples from conventionally raised cattle (35/61 [57%]) than for fecal samples from antimicrobial-free cattle (16/61 [26%]). Results suggested that the prevalence of tetracycline resistance genes was significantly higher in the fecal flora of conventionally raised feedlot steers than in the fecal flora of feedlot steers raised without antimicrobials and that a metagenomic approach may be useful in understanding the epidemiology of antimicrobial resistance in food animals.

A1.22 Prevalence of tetracycline resistance genes in clinical isolates of enterococci in a Japanese hospital

A1.22 Prevalence of tetracycline resistance genes in clinical isolates of enterococci in a Japanese hospital

Prevalence of tetracycline resistance genes in oral bacteria.

Tetracycline is a broad-spectrum antibiotic used in humans, animals, and aquaculture; therefore, many bacteria from different ecosystems are exposed to this antibiotic. In order to determine the genetic basis for resistance to tetracycline in bacteria from the oral cavity, saliva and dental plaque samples were obtained from 20 healthy adults who had not taken antibiotics during the previous 3 months. The samples were screened for the presence of bacteria resistant to tetracycline, and the tetracycline resistance genes in these isolates were identified by multiplex PCR and DNA sequencing. Tetracycline-resistant bacteria constituted an average of 11% of the total cultivable oral microflora. A representative 105 tetracycline-resistant isolates from the 20 samples were investigated; most of the isolates carried tetracycline resistance genes encoding a ribosomal protection protein. The most common tet gene identified was tet(M), which was found in 79% of all the isolates. The second most common gene identified was tet(W), which was found in 21% of all the isolates, followed by tet(O) and tet(Q) (10.5 and 9.5% of the isolates, respectively) and then tet(S) (2.8% of the isolates). Tetracycline resistance genes encoding an efflux protein were detected in 4.8% of all the tetracycline-resistant isolates; 2.8% of the isolates had tet(L) and 1% carried tet(A) and tet(K) each. The results have shown that a variety of tetracycline resistance genes are present in the oral microflora of healthy adults. This is the first report of tet(W) in oral bacteria and the first report to show that tet(O), tet(Q), tet(A), and tet(S) can be found in some oral species.