Presence Of Magnesium Chloride Research Articles

Effect of High Concentrations of Alkaline Mediums in Wet Processing on Cellulosic Materials (Dept.T)

In this research, a study of the effect of good mercerization and cross-linking treatments on cotton fabrics structure and performance was made. The factors affecting enhancement of fabric strength after mercerization were investigated. The results showed that the caustic soda (NaOH) concentration and mercerizing machine speed are the main causes of increasing the fabric breaking load, tear strength and abrasion resistance. Also, for every fabric structure and weight per unit area there are optimum conditions of mercerization; i.e. for light fabrics the NaOH concentration was 260 g/lit and the mercerizing machine speed was 30 m/min, while for heavy fabrics the NaOH concentration ranges from 280 to 300 g/lit, depending on the fabric structure. When these fabrics were subjected to cross-linking treatments, the best DMDHEU concentration was 80 g/lit in the presence of magnesium chloride (Mg Cl2. 6 H2O) as a catalyst at 16 g/lit, the curing temperature was 160°C and the curing time was 4 minutes. Logically, mercerization improves fabric breaking load, tear strength and abrasion resistance by virtue of the favorable effect of mercerization on the degree of orientation and uniformity of cotton structure. When these fabrics were subjected to cross-linking treatment; there was a considerable loss in the tensile, tear strength and abrasion resistance. The good mercerized then cross-linked fabrics retained accepted strength properties compared to the raw fabrics.

Energy Harvesting from Brines by Reverse Electrodialysis Using Nafion Membranes.

Ion exchange membranes (IEMs) have consolidated applications in energy conversion and storage systems, like fuel cells and battery separators. Moreover, in the perspective to address the global need for non-carbon-based and renewable energies, salinity-gradient power (SGP) harvesting by reverse electrodialysis (RED) is attracting significant interest in recent years. In particular, brine solutions produced in desalination plants can be used as concentrated streams in a SGP-RED stack, providing a smart solution to the problem of brine disposal. Although Nafion is probably the most prominent commercial cation exchange membrane for electrochemical applications, no study has investigated yet its potential in RED. In this work, Nafion 117 and Nafion 115 membranes were tested for NaCl and NaCl + MgCl2 solutions, in order to measure the gross power density extracted under high salinity gradient and to evaluate the effect of Mg2+ (the most abundant divalent cation in natural feeds) on the efficiency in energy conversion. Moreover, performance of commercial CMX (Neosepta) and Fuji-CEM 80050 (Fujifilm) cation exchange membranes, already widely applied for RED applications, were used as a benchmark for Nafion membranes. In addition, complementary characterization (i.e., electrochemical impedance and membrane potential test) was carried out on the membranes with the aim to evaluate the predominance of electrochemical properties in different aqueous solutions. In all tests, Nafion 117 exhibited superior performance when 0.5/4.0 M NaCl fed through 500 µm-thick compartments at a linear velocity 1.5 cm·s−1. However, the gross power density of 1.38 W·m−2 detected in the case of pure NaCl solutions decreased to 1.08 W·m−2 in the presence of magnesium chloride. In particular, the presence of magnesium resulted in a drastic effect on the electrochemical properties of Fuji-CEM-80050, while the impact on other membranes investigated was less severe.

Carbothermic synthesis of boron carbide with low free carbon using catalytic amount of magnesium chloride

Microcrystalline boron carbide was synthesized from boric acid and carbon black in the presence of a small amount of magnesium chloride by carbothermal reduction method at 1600 °C. The presence of magnesium chloride in the mixture has a determining effect in increasing the yield of the reaction and lowering the residual free-carbon content of the resulting boron carbide. We have also shown that, compared to several reported carbothermal reduction methods, the present catalyst also considerably lowers the excess amount of boron compound precursor required to afford boron carbide with negligible free carbon. X-ray powder diffraction (XRD) pattern indicated that the product was rhombohedral B4C. No peak, corresponding to free carbon, was observed in the XRD diffraction pattern of the B4C product formed from H3BO3:C:MgCl2 in the molar ratio of 1.0:1.45:0.01. Scanning electron microscopy image also showed that the product is fully crystalline and consisted of uniformly sized particles.

Highly isotactic (>60%) polyacrylonitrile-based carbon fiber: Precursor synthesis, fiber spinning, stabilization and carbonization

High performance carbon fibers are mostly produced from polyacrylonitrile (PAN). Its chemical structures strongly affect the further steps of carbon fiber manufacturing. In this work, highly isotactic (>60%) PAN was synthesized by template-assisted solid phase polymerization in the presence of magnesium chloride. We systematically studied the effect of isotacticity of PAN on its solution rheology, fiber spinning, thermal stabilization and carbonization. Highly isotactic PAN-based carbon fibers were first produced in this work. The higher isotacticity of PAN was observed to affect the storage stability of PAN solutions, coagulation processes, the structures of PAN fibers, stabilization reactions and carbonization yields. The improvement of PAN isotacticity benefits its thermal stabilization, but also introduces many problems during carbon fiber manufacturing which need to be carefully considered.

Salts Influence Cathechins and Flavonoids Encapsulation in Liposomes: A Molecular Dynamics Investigation.

Cathechins and flavonoids are responsible of numerous health benefits. Two of the most representatives' compounds for their antioxidant and therapeutic effects are Epigallocatechin 3-Gallate (EGCG), from green tea extracts, and morelloflavone (MF), from Garcinia dulcis. Here we explore, by atomistic Molecular Dynamics simulations, how EGCG and MF interact with lipid bilayers and we show the salts' influence on their encapsulation degree in neutral liposomes. As a result, we found out that EGCGs naturally bind to the hydrophilic regions of phospholipids, positioning themselves mostly at the interface between water and lipid phases. The presence of a salt clearly influences the EGCG molecules' absorption and the total effect depends strongly on the salt nature and concentration. Beside, for MF, we observed a high stability of the intermolecular MFs aggregates in water that strongly penalizes the flavonoid's interaction with the lipid polar heads. However, salts can influence MF's liposomal penetration, even if they are not able to promote completely its absorption inside the bilayer. For both compounds, the increase of penetration is more marked in presence of magnesium chloride, whilst calcium chloride showed the opposite effect.

Effect of tacticity on the cyclization of polyacrylonitrile copolymers

This work investigated polyacrylonitrile copolymers synthesized using methyl acrylate (MA) and dimethyl itaconate (DMI) as second monomers by bulk polymerization in the presence of magnesium chloride as a reagent to control the tacticity of polyacrylonitrile copolymers. The copolymers synthesized by solution polymerization were used as a control group to study the tacticity effect. The 13C-NMR results confirm that the isotacticity by bulk polymerization is increased approximately double for either P(AN-co-MA) or P(AN-co-DMI). The X-ray diffraction (XRD) and the isothermal DSC results show that the P(AN-co-MA) produced by bulk process, as compared to that by solution polymerization, has higher domain size (L c ) and crystallinity (CI); moreover, its cyclization period is decreased significantly. It indicates that the increase of isotacticity for P(AN-co-MA) makes the crystalline domain larger and the cyclization takes place more easily. However, such positive correlations do not hold good for the P(AN-co-DMI) system. It is due to the high steric-hindrance effect for the DMI monomer, which has long reactive branches on both sides of the vinyl DMI monomer, complicating the mechanisms of crystallization and cyclization and resulting in diminishing the contribution of high isotacticity to lower the barrier of cyclization reaction.

Effect of KCl and MgCl2 on the kinetics of methane hydrate formation and dissociation in sandy sediments

Natural gas hydrate is one of the potential energy resources in the future. However, the extraction of energy from hydrates remains uncertain due to limited understanding on how hydrates are formed and dissociated under different perturbations. More than 90% of NGH resource exists within marine location where salts are present. In this study, we investigated the formation and dissociation behavior of methane hydrate in the presence of magnesium chloride (MgCl2) and potassium chloride (KCl), two salts found in seawater, at 1.5 wt% and 3.0 wt%; and compared it with the cases of water and NaCl from our previous work. We found that on top of thermodynamic inhibition, both MgCl2 and KCl act as kinetic inhibitors on hydrate formation, retarding the rate of formation – with KCl exhibiting a weaker inhibition compared to MgCl2. For hydrate dissociation via thermal stimulation, we demonstrated that hydrate dissociates more rapidly in the presence of salts as compared to water despite a comparable temperature driving force (ΔT = 5.3 K) applied. Our results indicated that the weaker thermodynamic inhibitor, KCl, has a milder kinetic inhibition effect on hydrate formation and a weaker promoting effect on hydrate dissociation as compared to MgCl2 and NaCl.

Structure of the H-NS-DNA nucleoprotein complex.

Nucleoid associated proteins (NAPs) play a key role in the compaction and expression of the prokaryotic genome. Here we report the organisation of a major NAP, the protein H-NS on a double stranded DNA fragment. For this purpose we have carried out a small angle neutron scattering study in conjunction with contrast variation to obtain the contributions to the scattering (structure factors) from DNA and H-NS. The H-NS structure factor agrees with a heterogeneous, two-state binding model with sections of the DNA duplex surrounded by protein and other sections having protein bound to the major groove. In the presence of magnesium chloride, we observed a structural rearrangement through a decrease in cross-sectional diameter of the nucleoprotein complex and an increase in fraction of major groove bound H-NS. The two observed binding modes and their modulation by magnesium ions provide a structural basis for H-NS-mediated genome organisation and expression regulation.

Catalytic effect of MgCl2 on cotton stalk pyrolysis for chemical production at low temperature

Cotton stalk pyrolysis catalyzed by magnesium chloride was carried out in a fixed bed reactor in a temperature range of 493–553 K. The feedstock characteristics, product distribution, pyrolysis oil composition, and solid residue composition were analyzed. The presence of MgCl2 significantly changed the product distribution of the pyrolysis oil and oils with only two targeted chemicals successfully collected for the purpose of chemical production. The effects of catalyst loading and pyrolysis temperature on pyrolysis behaviour for the furfural and acetic acid production were studied systematically. The furfural and acetic acid concentration in pyrolysis oil increased in the presence of magnesium chloride in our investigated temperature range. The furfural and acetic acid contents in water‐free pyrolysis oil are about 54 % and 28 % when the pyrolysis temperature is 553 K. The results of solid product analysis showed that 85 % of hemicellulose was decomposed, while cellulose and lignin were relatively stable. This study makes it possible to produce chemicals from biomass material through a multi‐step pyrolysis process.

Ion hydration and associated defects in hydrogen bond network of water: observation of reorientationally slow water molecules beyond first hydration shell in aqueous solutions of MgCl2.

Effects of the presence of ions, at moderate to high concentrations, on dynamical properties of water molecules are investigated through classical molecular dynamics simulations using two well-known nonpolarizable water models. Simulations reveal that the presence of magnesium chloride (MgCl(2)) induces perturbations in the hydrogen bond network of water leading to the formation of bulklike domains with ''defect sites'' on boundaries of such domains: water molecules at such defect sites have less number of hydrogen bonds than those in bulk water. Reorientational autocorrelation functions for dipole vectors of such defect water molecules are computed at different concentrations of ions and compared with system of pure water. Earlier experimental and simulation studies indicate significant differences in reorientational dynamics for water molecules in the first hydration shell of many dissolved ions. Results of this study suggest that defect water molecules, which are beyond the first hydration shells of ions, also experience significant slowing of reorientation times as a function of concentration in the case of MgCl(2). However, addition of cesium chloride (CsCl) to water does not perturb the hydrogen bond network of water significantly even at higher concentrations. This difference in behavior between MgCl(2) and CsCl is consistent with the well-known Hofmeister series.

Structure of Hormaomycin, a Naturally Occurring Cyclic Octadepsipeptide, in the Crystal

Abstract The structure of hormaomycin has been determined in two crystals grown under different conditions, i. e. in the absence and in the presence of magnesium chloride. In both crystals, the macrocyclic hexadepsipeptide assumes a rather flat conformation, and the dipeptide side chain resides in the same equatorial plane. This is a significant difference in comparison with the compact bent conformation of hormaomycin in solution, as previously determined by an extensive NMR study

Effect of magnesium chloride on growth, crystalline perfection, structural, optical, thermal and NLO behavior of γ-glycine crystals

In the present study, single crystals of γ-glycine possessing excellent non-linear optical properties were successfully grown at room temperature in the presence of magnesium chloride (MgCl2) for the first time by using the slow solvent evaporation method. The second harmonic conversion efficiency of γ-glycine crystal was determined using Kurtz powder technique with Nd:YAG laser and was found to be 6 times greater than that of the standard inorganic sample potassium dihydrogen phosphate (KDP). The crystalline perfection of the grown crystal was analyzed using high-resolution X-ray diffraction (HRXRD) rocking curve measurements. The grown crystal was subjected to single crystal XRD and powder XRD, which confirmed that the crystal has hexagonal structure and belongs to space group P31. Inductively coupled plasma optical emission spectrometry (ICP-OES) was carried out to quantify the concentration of Mg element in the grown γ-glycine single crystal. Fourier transform infrared (FTIR) spectral studies were made to identify the functional groups. The optical band gap was likewise estimated for γ-glycine crystal using UV–vis–NIR study. The optical measurements of γ-glycine crystal helped to calculate the optical constants such as refractive index (n), the extinction coefficient (K), electric susceptibility (χc) and both the real (∈r) and imaginary (∈i) components of the dielectric permittivity functions of photon energy, which is essentially required to develop optoelectronic devices. Thermogravimetric analysis (TGA) and differential thermal analysis (DTA) were used to study thermal stability and decomposition point of the grown crystal.

The fungal resistance of wood modified with glutaraldehyde

Abstract Scots pine sapwood (Pinus sylvestris L.) and European beech wood (Fagus sylvatica L.) were treated with glutaraldehyde (GA) in aqueous solution in the presence of magnesium chloride as a catalyst to evaluate the durability improvement towards staining and rot fungi. The GA modified specimens were dipped in a spore suspension of the blue stain fungus Aureobasidium pullulans and incubated for 8 weeks. The growth on both pine and beech wood was restrained, when the weight percent gain (WPG) of the specimens was above 7%. Under this condition, GA-modified beech wood did not suffer any mass loss after incubation with the white rot fungus Trametes versicolor. The threshold to prevent decay of beech and pine specimens towards the brown rot fungus Coniophora puteana was at a WPG of only 3%. GA treatment to a WPG over 6% protected the Scots pine stakes from soft rot decay during 32 weeks’ exposure according to ENv 807 (2001).

Magnesium Chloride–Catalyzed Thiolysis of Epoxides: Synthesis of β-hydroxy Sulfides

A mild and convenient ring opening of epoxides with thiophenol and its derivatives takes place at room temperature in the presence of magnesium chloride as catalyst to afford the corresponding β-hydroxy sulfides along with minor amounts of 2-chlorocycloalkanols in good yields. When the crude reaction mixtures are treated with aqueous sodium hydroxide solution, pure 2-arlythiocycloalkanols are obtained in good yields.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Deicer Impacts on Pavement Materials: Introduction and Recent Developments

A review of the impacts of deicers used in winter maintenance practices of Portland cement concrete and asphalt concrete roadways and airport pavements is presented. Traditional and relatively new deicers are incorporated in this review, including sodium chloride, magnesium chloride, calcium chloride, calcium magnesium acetate, potassium acetate, potassium formate, sodium acetate, and sodium formate. The detrimental effects of deicers on Portland cement concrete exist through three main pathways: 1) physical deterioration such as salt scaling; 2) chemical reactions between deicers and cement paste (a cation-oriented process, especially in the presence of magnesium chloride and calcium chloride); and 3) deicers aggrevating aggregate-cement reactions (such as the anion-oriented process in the case of chlorides, acetates, and formates affecting alkali-silica reactivity and the cation-oriented process in the case of calcium chloride and magnesium chloride affecting alkali-carbonate reactivity). The deicer impacts on asphalt concrete pavements had been relatively mild until acetate- and formate-based deicers were introduced in recent years. The damaging mechanism seems to be a combination of chemical reactions, emulsifications and distillations, as well as the generation of additional stress in the asphalt concrete.

Synthesis of Needle-Like Aragonite Crystals in the Presence of Magnesium Chloride and Their Application in Papermaking

PCC (precipitated calcium carbonate) and ground calcium carbonate have been widely used in alkaline papermaking. Unfortunately, although increasing filler level in papers can improve the paper properties such as brightness, opacity, stiffness gloss, smoothness, porosity, and printability, as well as decrease cost, some strength of the paper is negatively affected. In this research, needle-like aragonite was synthesized using Ca(OH)2 and CO2 as reactants in the presence of MgCl2 and characterized with scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The physical and optical properties of the paper handsheets containing these needle-like aragonite fillers were evaluated. Results indicated that tensile strength, Z-direction tensile strength and folding endurance of the paper were improved by the needle-like aragonite crystals compared to the paper using commercial PCC (precipitated calcium carbonate) as filler. The stiffness of the paper handsheet on the machine direction was increased, but no evident difference in the cross direction was found. The improvement of paper strength mainly resulted from the twining effect between the aragonite whiskers and paper fibers. The optical properties of the paper were slightly decreased with the use of the needle-like aragonites compared to commercial PCC. These results suggest that paper cost can be decreased by increasing the content of needle-like aragonite filler while paper strength will not be decreased compared to PCC filler.

Mg2+ content control of aragonite whisker synthesised from calcium hydroxide and carbon dioxide in presence of magnesium chloride

This research is concerned with thermodynamic control of inorganic whisker synthesis in existence of some additives. The polymorphism and morphology control of calcium carbonate (CC) is an active research area because of wide applications of CC. Magnesium chloride has been used to improve the formation of aragonite whisker synthesised from Ca(OH)2 and CO2. However, the reaction kinetics and the purity of final products affected by MgCl2 have not been theoretically studied. In the present research quantitative thermodynamic calculation showed that MgCl2 can decrease relative supersaturation by several orders of magnitude and so is favourable to the formation of aragonite. High reactant ratio of MgCl2/Ca(OH)2 will give a marked decrease in pH within the transformation of Ca(OH)2 into Mg(OH)2, but a small decrease in pH in the following CaCO3 formation, which is disadvantageous to the control of the synthesis with pH. Both solid Mg(OH)2 and MgCO3 may exist in aragonite product, but can be avoided by pH control. Maximum MgCO3 content in aragonite product is <1·00 wt-% and MgCO3 can be removed by slightly decreasing pH using excessive CO2 adsorption, which will result in a negligible decrease in Ca2+ conversion and an increase in carbonate ion concentration. High carbonate ion concentration, unfortunately, is disadvantageous to the reuse of MgCl2 solution. The present study gives a guidance of synthesising aragonite in the presence of inorganic salts such as MgCl2.

Synthesis of needle-like aragonite from limestone in the presence of magnesium chloride

Needle-like aragonite was synthesized with a reversible solution reaction from limestone without calcinations. Scan Electron Microscope (SEM) and X-ray Diffraction (XRD) were used to characterize the morphology and the crystal structure of aragonite. The synthesis of aragonite whisker involves two steps. At first GCC (Ground Calcium Carbonate) was dissolved in an aqueous solution of magnesium chloride with reflux and air flush. Then CO 2 was bubbled into the suspension at a low temperature to produce aragonite whisker. An in-house designed reactor and acid–base titration analysis were used to measure the remaining GCC content in the reaction mixture. A kinetics equation of GCC dissolution was developed, which showed a first-order kinetic feature to magnesium chloride concentration. A reaction rate constant of 0.04234 h −1 was obtained. The dissolution rate of GCC in magnesium chloride is much higher than that in the magnesium sulfate solution. Some aragonite whiskers with a length of ca. 20 μm and an aspect ratio of 8–12 can be synthesized.

Uranium(VI) extraction from chloride solution with benzyloctadecyldimethyl ammonium chloride (BODMAC) in a liquid membrane process

The recovery of uranium(VI) from chloride solution using a liquid emulsion membrane (LEM) technique was studied. The emulsion is constituted by the quaternary salt of benzyloctadecyldimethyl ammonium chloride (BODMAC, R4NCl) as a carrier, kerosene as organic diluent, Span 80 as emulsifying agent and 0.5 mol/l Na2CO3 as stripping phase. The important variables affecting the LEM permeation process such as the concentrations of extractant, internal strip phase, types of organic diluent, and the presence of magnesium chloride or magnesium sulfate were investigated. It was found that, at a given condition, the maximum extraction rate of uranium(VI) reached 80%. The emulsion was stable at low pH in the presence of certain amounts of electrolytes such as NaCl and MgCl2.